ID: 1141291900

View in Genome Browser
Species Human (GRCh38)
Location 16:82725738-82725760
Sequence AGAGCCAAAAGGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 613
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 561}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141291900 Original CRISPR AGAGCCAAAAGGAATGAGGA TGG (reversed) Intronic
900836760 1:5010825-5010847 ACAGCCAACAGGAGTGAGGCTGG - Intergenic
900984690 1:6066517-6066539 AGAGGCAGAAGGAAGGAAGACGG - Intronic
902220083 1:14959082-14959104 AGAGCAAAGAGGAAGGAGGCCGG + Intronic
903188682 1:21644098-21644120 AGAGCCACAACGCATGTGGAGGG + Intronic
905509005 1:38503536-38503558 AGAGGAAACAGGAAGGAGGAAGG + Intergenic
905513081 1:38539126-38539148 AGAGCAAAAGGGAATCTGGAAGG + Intergenic
905547002 1:38807848-38807870 AGACCCAGGAGGAATGTGGATGG - Intergenic
906513097 1:46422784-46422806 AGAGGCAGAAGGACAGAGGAGGG + Intergenic
907057204 1:51380546-51380568 AGAGTAAAAGGAAATGAGGAGGG + Intronic
907788737 1:57640457-57640479 TGAGGCTAAATGAATGAGGAGGG + Intronic
908403488 1:63792039-63792061 AGGGCCAAGAAGAATGAGCAGGG + Intronic
908578320 1:65485833-65485855 ACATCCAAGAAGAATGAGGATGG + Intronic
908839828 1:68267778-68267800 TGAACCCAAAGCAATGAGGAAGG - Intergenic
909947441 1:81679306-81679328 AGAACCCAAAGGAATAAAGAGGG + Intronic
910050278 1:82965261-82965283 AGACCAAAATAGAATGAGGAGGG - Intergenic
910135677 1:83966346-83966368 AGAGACAGAGGGAAGGAGGAGGG - Intronic
910548007 1:88440887-88440909 AGAGAAAAAGGGAAGGAGGAGGG + Intergenic
910734855 1:90442399-90442421 AGAGAAAAAAGGAAAGAGGGAGG + Intergenic
911409955 1:97491365-97491387 AGCACCTAATGGAATGAGGAAGG + Intronic
912419785 1:109535239-109535261 AGAGCCCAAAGCCATGGGGAAGG + Intergenic
912543111 1:110431702-110431724 AGAGCCCAAAGGCAGCAGGAAGG - Intergenic
912861423 1:113217179-113217201 AGAGCCAAGAGGGAAGGGGAAGG - Intergenic
912866857 1:113265414-113265436 TGAGTCAACAGGAATGAAGAAGG + Intergenic
913183933 1:116349623-116349645 AGAGCAAAAGGGTATGAGAATGG + Intergenic
913461579 1:119091741-119091763 ACAGCCAACAGGAAGGGGGAAGG + Intronic
913711323 1:121486742-121486764 AGAACCAGCAGCAATGAGGATGG + Intergenic
915015986 1:152734317-152734339 AGAGAGAAAAGAAAAGAGGAAGG - Intergenic
915170252 1:153972701-153972723 AGATGCAATAGGAGTGAGGAGGG - Intronic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917644071 1:177012680-177012702 ACAGCCAGAGGGAATGATGAAGG + Intronic
917978694 1:180256201-180256223 AGAGCCAGACGGGCTGAGGAGGG - Intronic
918237441 1:182593923-182593945 GGAGCCAGAGGGAAGGAGGAAGG - Intergenic
918379892 1:183943467-183943489 AGAAGAAAAAGGAAAGAGGAAGG + Intronic
918525188 1:185456923-185456945 AGATCCAAAAGGTATGAGGGAGG - Intergenic
918657976 1:187053028-187053050 AGAGCAATAAGAAAAGAGGAAGG + Intergenic
919058823 1:192605731-192605753 AGAGACAGATGGAAGGAGGAAGG + Intergenic
919797595 1:201330740-201330762 AGCGCCACAAGGACTGAGGTTGG + Exonic
920735407 1:208528912-208528934 ACAGCCAAAAGGAGAAAGGAAGG - Intergenic
920880672 1:209877548-209877570 AGAGAAGAAAGGAAGGAGGAAGG - Intergenic
922880719 1:228978611-228978633 AGAACTAACAGGAATGTGGATGG + Intergenic
922913122 1:229233907-229233929 AGAAACAAGAGGAATGGGGAGGG + Intergenic
922930357 1:229384190-229384212 CTAGCCAGAAGGAAGGAGGAAGG - Intergenic
923268472 1:232334599-232334621 AGGGGCAAAAGGGAGGAGGAAGG - Intergenic
923498258 1:234543442-234543464 AAAACAAAAAGGAAGGAGGAGGG - Intergenic
923780437 1:237017985-237018007 AGAGAGAAAAGGAAGAAGGAAGG - Intergenic
924200090 1:241649665-241649687 GAAGACAAAAGGAAGGAGGAGGG - Intronic
924227079 1:241930888-241930910 AAAGGAAAAAGGAATGAGGCTGG + Intergenic
924421081 1:243910831-243910853 AGAGGCAAAAGGAAGCAAGAGGG + Intergenic
924642480 1:245847541-245847563 GGAGCCAAAAGAAATCAGGTGGG - Intronic
1062966043 10:1608585-1608607 AAGGAAAAAAGGAATGAGGAAGG + Intronic
1063625933 10:7690016-7690038 AGAGACAAAAGGAGTGTGGAAGG - Intergenic
1064178791 10:13098013-13098035 ACAGATAAAGGGAATGAGGAAGG + Intronic
1065325386 10:24546044-24546066 AGAGACAGAAGGGATGAGGGAGG - Exonic
1065748495 10:28863813-28863835 AAAACAAAAAGGAAGGAGGAAGG - Intronic
1066023212 10:31322092-31322114 AGAGCCAAAAGTGATGAAAATGG - Intronic
1066209632 10:33224209-33224231 AGAGGCAGAAGGAATAAGGAAGG - Intronic
1066453281 10:35550474-35550496 AGGGACAAAAGGAGTGGGGAGGG - Intronic
1067512635 10:46908576-46908598 AGAGCAAATAGGAAAAAGGAAGG - Intergenic
1067649609 10:48143246-48143268 AGAGCAAATAGGAAAAAGGAAGG + Intergenic
1068611881 10:59069305-59069327 AGAGCCAAAGAGAAGTAGGAAGG - Intergenic
1068814893 10:61298119-61298141 TGAGCCACAGGAAATGAGGAAGG + Intergenic
1068976255 10:63013364-63013386 AGAGCCACAAGAGATGAGGTTGG + Intergenic
1071257691 10:83887424-83887446 AGTGATAAAAGGAATGAGGGTGG + Intergenic
1071526359 10:86362001-86362023 AGAGGCAAAATGAATGAGCTTGG + Intronic
1071585965 10:86821800-86821822 AGAAACAAAAGGAGGGAGGAAGG - Intronic
1071876235 10:89846327-89846349 GGAGGCAAAAGGAAGGAGGGAGG + Intergenic
1071930192 10:90460922-90460944 AGAACAAAGAAGAATGAGGAAGG + Intergenic
1072161286 10:92769694-92769716 CCAGCCAACATGAATGAGGAAGG - Intergenic
1072770589 10:98134457-98134479 ATAGCCGAGAGGAATGAGGAAGG + Intergenic
1072890499 10:99319516-99319538 AGAGAATAACGGAATGAGGATGG + Intergenic
1073524865 10:104170870-104170892 AGAGCCTAATGGAATGAGGTTGG - Intronic
1073653349 10:105384992-105385014 AGAGCCAAGATTAATGAGAAGGG + Intergenic
1073965426 10:108983549-108983571 AAAGCCAGAAGGAATGAAGTTGG + Intergenic
1074708716 10:116159113-116159135 AGAACCAAAATCAATGAGTAGGG + Intronic
1074724097 10:116289778-116289800 AGAGAGAGAAGGAAGGAGGAAGG - Intergenic
1074840832 10:117349271-117349293 AGAGGCAGAAGGAATGAGAAGGG + Intronic
1075141914 10:119845365-119845387 AAAACAAAAATGAATGAGGAAGG + Intronic
1075267944 10:121021219-121021241 AGAGACAGAAGGCATGAGAAAGG - Intergenic
1075526755 10:123193663-123193685 AGGGCCAAACTGAATTAGGAGGG - Intergenic
1075921273 10:126215328-126215350 AGAGGCCACAGGAAAGAGGAAGG - Intronic
1077836015 11:5928953-5928975 ACAGACAAAAGGAAAAAGGAGGG - Intronic
1078300513 11:10126437-10126459 AGATCAAGAAGGAAAGAGGAAGG + Intronic
1079130205 11:17742822-17742844 AGAGCCAAAAGAAATTCAGATGG - Intronic
1079857142 11:25619776-25619798 AAAGACAAAAGGCATGAGAAAGG - Intergenic
1079936850 11:26627348-26627370 AGACCCAAAAGTAAAGAAGAAGG - Intronic
1080774044 11:35369241-35369263 AGAGACAAAAGTAATAAAGAGGG + Intronic
1080865780 11:36193712-36193734 AAGGCATAAAGGAATGAGGAGGG - Intronic
1081103002 11:39028619-39028641 AGAGCCAAACAGAGTGAGGAAGG + Intergenic
1081930025 11:46863001-46863023 AGAGCAAAAGAGAATGAGGGAGG - Intronic
1084023164 11:66430388-66430410 GGAGCAAAAAGGTATGAGAAAGG + Intergenic
1084197286 11:67530667-67530689 AGAGCCATAAGGAGGGAGGAAGG - Intergenic
1085228202 11:74941828-74941850 ACAGAAAAAAGGAATGAGAAAGG + Intronic
1086375929 11:86200604-86200626 AGAATCAAGAGAAATGAGGAAGG - Intergenic
1086591522 11:88520982-88521004 AGTGCCAGAAGGAAGGAGGGTGG - Intronic
1087600866 11:100313717-100313739 AGAGCAGAGGGGAATGAGGAGGG + Intronic
1089055914 11:115584670-115584692 AGAGGAAGAAGTAATGAGGAGGG + Intergenic
1089126669 11:116181130-116181152 AGAGGCAAAAGGAAGGGGGTGGG + Intergenic
1089256194 11:117195547-117195569 AGAATCAGAAGGAAGGAGGAGGG + Intronic
1089461661 11:118657618-118657640 AGAGCCAGAAGGGATGAAGCCGG + Exonic
1089505594 11:118959940-118959962 AGTGCCCAAAAGAAAGAGGAAGG + Intergenic
1090630772 11:128645373-128645395 AGAGAAAAAAGGAAGGAGGGAGG + Intergenic
1091036935 11:132243128-132243150 AGAGCCAAAAACATTGAGAAGGG - Intronic
1091144602 11:133266713-133266735 ACAGTCCAAGGGAATGAGGATGG + Intronic
1091223706 11:133945692-133945714 AGAGCCAAGAGGAAAGGGGTGGG + Intronic
1091965186 12:4734777-4734799 AGTGCCAAGAGATATGAGGACGG - Intronic
1092079797 12:5706342-5706364 AGAGCAAAAGGGAGTGGGGAGGG - Intronic
1092212090 12:6652926-6652948 AAAGGCAAAAAGAGTGAGGAGGG - Exonic
1092312531 12:7374025-7374047 AGAGGAAAGAGGGATGAGGAAGG - Intronic
1092514889 12:9200457-9200479 AGAGATAATAGGAATAAGGAAGG + Intronic
1093669988 12:21862382-21862404 AGAGGCAAGAGGAAGGGGGAGGG - Intronic
1093683739 12:22032402-22032424 AAATCCAAAAGTAATGAGGAAGG + Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094171261 12:27494813-27494835 AAGGCCAAAGGGAAGGAGGAAGG - Intronic
1095307572 12:40656154-40656176 GTAGCCAAAAGTATTGAGGAAGG + Intergenic
1095788205 12:46134459-46134481 AGAGAAAGAAGGAATGAAGAAGG - Intergenic
1096317527 12:50581504-50581526 AGAGTAAAAAGAAATGTGGAAGG + Intronic
1096631280 12:52928249-52928271 AGAGCCCAAAGCAATGTGGCTGG + Intronic
1097043632 12:56171438-56171460 AGACCCAGAAAGAATGAGGCTGG + Intronic
1097069728 12:56346099-56346121 AGAGCCAAAAAGGATTAGGGAGG + Intronic
1097613866 12:61860588-61860610 AGAGCAAAGAGCAAAGAGGATGG - Intronic
1097685489 12:62687096-62687118 AGAGCCATAAAGAATGTGGTTGG + Intronic
1097916262 12:65023404-65023426 AGAGCCAGAAGGAAGGAGCCTGG + Intergenic
1098580100 12:72089433-72089455 AGAGCAAAAAGTAATGAGGCCGG - Intronic
1099388318 12:82046833-82046855 AGGACCAAAAGGCATGAGAATGG + Intergenic
1100204134 12:92329775-92329797 AAAGCAAAATGGAAAGAGGATGG + Intergenic
1100292681 12:93232697-93232719 AGTGCCAGAAGGAAGGAGGATGG - Intergenic
1100439270 12:94600765-94600787 AGAGCCAAAATGGATCAGGAAGG - Intronic
1101251168 12:102938138-102938160 AGAGCAGAGAGGAATGAGGCAGG + Intronic
1101607170 12:106256356-106256378 AGAGAGAGAAGGATTGAGGAAGG - Intronic
1101688480 12:107050183-107050205 AGAGAGAAAAACAATGAGGAGGG + Intronic
1103136132 12:118509448-118509470 GGAGCCAAAAAGAAAGAGAAAGG - Intergenic
1104066804 12:125313486-125313508 AGAGAGAAAGGGAAGGAGGAAGG - Intronic
1104620390 12:130307627-130307649 AGAGCCAAAAGGGATGAGCAAGG - Intergenic
1105068582 12:133220094-133220116 AGAGGCGAAAGGCAGGAGGAGGG + Intronic
1105227476 13:18449865-18449887 AAAACCAAGAGGAATGAGGTAGG + Intergenic
1106744480 13:32685317-32685339 AGGGCCAAAAGGCATGAAGAGGG + Intronic
1107404222 13:40097931-40097953 TCAGCCAAATGGAATGAGGCAGG + Intergenic
1107404378 13:40098892-40098914 TCAGCCAAATGGAATGAGGCAGG + Intergenic
1107570915 13:41657248-41657270 AGAGCCAAGAGGAGAGAGGCTGG + Intronic
1108305265 13:49125244-49125266 ACAGCCAAAAGGGATGGGCAGGG + Intronic
1109877180 13:68420684-68420706 AACCCCAAAAGGAAGGAGGAAGG - Intergenic
1110114811 13:71799780-71799802 AGAGCCAAAAGGAAAAAATATGG + Intronic
1110411932 13:75214294-75214316 AGAGGGATGAGGAATGAGGAGGG - Intergenic
1110457159 13:75702245-75702267 AGAGCCAGAAGGAAGGAGCAGGG - Intronic
1110557776 13:76879605-76879627 ACAGGCAAAAGGAAAGAGGAAGG + Intergenic
1110690241 13:78424145-78424167 AGAGGAAAAAGGAAACAGGAAGG + Intergenic
1111556655 13:89889756-89889778 AGAGCCAAAATGTTTGGGGATGG + Intergenic
1112061905 13:95749413-95749435 TGGGCCAAAGGGAAAGAGGAAGG + Intronic
1112720234 13:102236073-102236095 AGAGCAAAAAGTCATGGGGAAGG - Intronic
1112788285 13:102975728-102975750 AGAGGCAGAAGGATTGAAGAAGG + Intergenic
1113583188 13:111443421-111443443 AGAGGCAAAAGACATGAAGATGG - Intergenic
1115727679 14:36234946-36234968 ATAGCCCCAAGCAATGAGGAAGG + Intergenic
1116116053 14:40652418-40652440 AAAGGAAAAAGGAAGGAGGAAGG - Intergenic
1116172237 14:41417694-41417716 AGAGACAAAATGAATGGGCATGG - Intergenic
1117354587 14:54911691-54911713 AAAGCCAAAAGGAATGAAACTGG - Intergenic
1118171785 14:63395737-63395759 AGAGGGAAAAGGGAGGAGGAGGG + Intronic
1118329764 14:64806140-64806162 AGAGAGAAAAGGATAGAGGAGGG + Intronic
1118443044 14:65829116-65829138 AAAGGCAGATGGAATGAGGAGGG + Intergenic
1119623142 14:76148124-76148146 AGAGCAAAAACCAATGAGGGAGG + Intergenic
1119747906 14:77057466-77057488 AGAGTTAAAAAGAATGAGGCTGG - Intergenic
1121693364 14:95893445-95893467 AGAGCCATAAGGAGTGAGGGCGG - Intergenic
1121774444 14:96581477-96581499 AGAGCCGAAAGGAAAGCGCAGGG + Intergenic
1121860203 14:97310145-97310167 AGAGGCAAAATGCATGAGAACGG + Intergenic
1121974570 14:98391030-98391052 AAAGACAAAAGGCATGAGCAAGG + Intergenic
1122848661 14:104514671-104514693 GGAGCCAAAAAGGATGAGGGTGG + Intronic
1202830218 14_GL000009v2_random:19817-19839 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1124343415 15:28904584-28904606 AGAGGGAAAAGGAAGGAAGAGGG - Intronic
1124553082 15:30700157-30700179 AGAGCCAAAAGGAGTCCAGATGG + Intronic
1124678161 15:31705513-31705535 AGAGCCAAAAGGAGTCCAGATGG - Intronic
1124688454 15:31801733-31801755 ACAGCCAAGAGAAATCAGGATGG + Intronic
1125254833 15:37751473-37751495 AGAGCAAAAGGGAGGGAGGAAGG + Intergenic
1125387359 15:39152486-39152508 AGAGGCCAAAGGAAGGAGTACGG + Intergenic
1125767523 15:42145495-42145517 AGAGACAAGAAGAATGAGGGAGG - Intronic
1125959000 15:43813006-43813028 AGAGCTAAAAAGAATCAAGAGGG - Exonic
1125990577 15:44102909-44102931 AGACCTAAAAGGAATGAAAAGGG + Intronic
1126022646 15:44417736-44417758 AGAGCCAAACTGTATCAGGAAGG + Intergenic
1126286343 15:47016660-47016682 AGAGACAAAGGGAAGGAAGAGGG - Intergenic
1127273952 15:57426065-57426087 GGAGCCAGAAGAAAGGAGGAGGG - Intronic
1127338480 15:58014854-58014876 AGAGCCAAAAAAGATGGGGATGG + Intronic
1128345985 15:66852670-66852692 AGAGTAAAATGAAATGAGGAGGG - Intergenic
1128458816 15:67850673-67850695 AGAGAGAGAAGGAACGAGGAGGG + Intergenic
1128484258 15:68069340-68069362 ACGGGCAAAAGGAAGGAGGAGGG - Intronic
1128541378 15:68536863-68536885 CCAGCCAATAGGAAGGAGGAAGG - Intergenic
1128955688 15:71940943-71940965 AGAGACAGAAGAAAGGAGGAGGG + Intronic
1129781898 15:78277767-78277789 GGAGCCAAATGGAGTGAGGGTGG + Intronic
1130561955 15:84965784-84965806 CTAGCCAGAAGGAAAGAGGAAGG - Intergenic
1130682515 15:86009095-86009117 AGACCAAAAAGGAAGGAAGAAGG + Intergenic
1130864096 15:87917295-87917317 ACAGCTGAAAGGAATAAGGAAGG + Intronic
1131287547 15:91074296-91074318 AGAGCACAAGGGAATGAGGTAGG - Intergenic
1131453364 15:92564337-92564359 AGAGTCAACAGGAAAGTGGAAGG + Intergenic
1132150432 15:99454778-99454800 AGCTCCAACAGAAATGAGGAGGG - Intergenic
1132404259 15:101532916-101532938 AGAGCCAAATGGAAGCAAGAAGG - Intergenic
1133136850 16:3717967-3717989 AAAGCTAAAGCGAATGAGGAAGG + Intergenic
1133517243 16:6521401-6521423 AGAGAAAAAAGAAATGAGGAAGG - Intronic
1134912044 16:18036359-18036381 AGAGAATAAACGAATGAGGAAGG - Intergenic
1135130923 16:19853338-19853360 AGAGCAGAAAGGAATGAGCTAGG - Intronic
1135818020 16:25653674-25653696 AGAGAGGAAAGGAAGGAGGAAGG - Intergenic
1135829523 16:25761079-25761101 AGAGCCAAAAGGAGTCAGGTTGG + Intronic
1136140919 16:28288110-28288132 AGAGACAGAAGGAAGGATGATGG + Intergenic
1136374100 16:29854900-29854922 AGAGCCAACAGGAAGGAGAAAGG + Intergenic
1137447329 16:48539795-48539817 AGAGACAAAAAGAATGAGGGAGG + Exonic
1139421706 16:66853250-66853272 AGACCCTAAGGGAAGGAGGAGGG + Intronic
1139696958 16:68681974-68681996 AGATCAGAAAGGAATAAGGAAGG - Intronic
1141291900 16:82725738-82725760 AGAGCCAAAAGGAATGAGGATGG - Intronic
1141548452 16:84787978-84788000 AGAGTGAGAAGGAATGAGCAGGG + Intergenic
1141683169 16:85555682-85555704 AGAACCAGAAGGAAAAAGGAAGG - Intergenic
1142867876 17:2801848-2801870 AGAGGAAAAAGGAATGAAGGTGG - Intronic
1143280875 17:5753230-5753252 AGAGAAAAGAGGAAAGAGGAAGG - Intergenic
1143294838 17:5863208-5863230 AAAGGAAAAAGGAAGGAGGAAGG - Intronic
1143400833 17:6640902-6640924 AGAGCAAAAAGCCATGCGGATGG + Exonic
1143545512 17:7592935-7592957 TGGGCCAAAAGGAAAGATGATGG - Intronic
1143988492 17:10936329-10936351 AGAGCCCAAAGGAAGGTGGGAGG + Intergenic
1144129784 17:12235138-12235160 AGAGCCAAAATATATGGGGATGG + Intergenic
1144365623 17:14541775-14541797 AGAGGGAGAAGGAGTGAGGAAGG - Intergenic
1146156728 17:30530517-30530539 GGAGCCAAAAGGCAGGAGGCTGG - Intergenic
1146413459 17:32610041-32610063 AAAGCCTAAAGAAATGAGAATGG + Intronic
1146585278 17:34076869-34076891 AAAGCAAGAAGGAAGGAGGAGGG + Intronic
1146785493 17:35717236-35717258 ATTGCCAAGAGGAATGTGGAAGG + Exonic
1147045322 17:37746945-37746967 AGAGCCAGAAGGAAGCGGGATGG + Intergenic
1147158473 17:38557459-38557481 AGGGCCCAAAGGAAGGAGCAGGG + Intronic
1147441594 17:40450901-40450923 AAAGCCATAAGGCTTGAGGATGG - Intronic
1147575376 17:41595887-41595909 AGAGGGAAAGGGAAAGAGGAAGG + Intergenic
1149637281 17:58181027-58181049 GGAGGGAAAAGGAGTGAGGAGGG - Intergenic
1149988409 17:61366159-61366181 TGAGCCAACAGGGAGGAGGAGGG + Intronic
1150568279 17:66362409-66362431 AGAGCCAAGAGGCATCAGGAAGG - Intronic
1150895323 17:69203464-69203486 AGAGGGAAAAGAGATGAGGATGG - Intronic
1150947638 17:69765468-69765490 AGAGCAGAAAGGAACGGGGAGGG - Intergenic
1151212565 17:72555434-72555456 AGAGCCAAAAGAAATGACAAAGG + Intergenic
1151518412 17:74612186-74612208 AGAGAGAAAAGGACGGAGGAAGG - Exonic
1152155788 17:78631837-78631859 AGAGAGAAAAGGAGTGAGGGAGG + Intergenic
1152161538 17:78671395-78671417 AGAGCCAAGAGGAGAGAGGAGGG + Intergenic
1152434139 17:80264815-80264837 GGAGCCAAGAGGAATGGGGTGGG - Intronic
1152922263 17:83071953-83071975 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
1154525902 18:15289612-15289634 AAAACCAAGAGGAATGAGGTAGG - Intergenic
1155390911 18:25335604-25335626 AGAGCCAAGAGGATTGAGCGAGG - Intronic
1157420314 18:47542189-47542211 AGAGTCATAGGGTATGAGGAGGG - Intergenic
1158768150 18:60481092-60481114 AGACTCAGAAGGAAGGAGGATGG - Intergenic
1159379813 18:67642345-67642367 AGAGCTAAGAGGAGTGAGGATGG + Intergenic
1159673820 18:71256267-71256289 AGAGCCCCAAGGAAACAGGATGG - Intergenic
1160607776 18:80065418-80065440 ACAGAAAAAAGGAATGAGGAAGG + Intronic
1161918733 19:7250327-7250349 AGAGAGAAAAAGAAAGAGGAGGG + Intronic
1162333598 19:10046320-10046342 AGAGTCAGAGGGAAAGAGGAGGG - Intergenic
1162865332 19:13541670-13541692 AGAGAGAAAGGGAAGGAGGAAGG + Intronic
1162897982 19:13776765-13776787 AGAGGAAACAGGAGTGAGGAGGG - Intronic
1162947080 19:14050626-14050648 AGACCTAAAAGAGATGAGGAGGG + Intronic
1164065271 19:21709408-21709430 AGAGTCCAAAGGAGTGAGGAGGG - Intergenic
1164130148 19:22354642-22354664 AGAGTCCAAGGGAGTGAGGAGGG - Intergenic
1164169185 19:22709360-22709382 AGAGTCCAGGGGAATGAGGAGGG + Intergenic
1164222078 19:23203925-23203947 AGAGTCCAAGGGAGTGAGGAGGG - Intergenic
1164833230 19:31339243-31339265 AAAGAGAAAAGGAATGAGAAAGG + Intronic
1164903472 19:31947776-31947798 AGAGCCAAAAGGCAGAAGAAGGG - Intergenic
1165148717 19:33748933-33748955 AGAGCCTCAAGGAGTGAGGCTGG + Intronic
1165343004 19:35225571-35225593 AGAGGCAAAGGCAAGGAGGATGG + Intronic
1165445081 19:35852263-35852285 AGAGACAAAAGGAGAGAGAACGG - Intronic
1165522630 19:36326672-36326694 AGAGCCAATAAAAATCAGGAAGG - Intergenic
1165668996 19:37658815-37658837 AGAACCAAAGAAAATGAGGAGGG - Intronic
1165893260 19:39127245-39127267 AGAGCCATAAGAAGTGAGGTGGG - Intronic
1167001552 19:46748132-46748154 AAAGCCTTAAGGAATGAGGAAGG - Intronic
1167122132 19:47523817-47523839 AGAGCCCACAGGACAGAGGATGG + Intronic
1202642473 1_KI270706v1_random:107955-107977 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
925932485 2:8720444-8720466 AGAGCCAAGAGGAAGGAGCCGGG + Intergenic
926722438 2:15971247-15971269 AGAGCTATTGGGAATGAGGACGG + Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
929437059 2:41937016-41937038 AGTGCCAACAGGAATAAAGATGG + Exonic
929856970 2:45645689-45645711 AGAGCAAAAGGGAGGGAGGACGG + Intergenic
931821939 2:65961119-65961141 TCTGCCAAAAGGAATGAGGCTGG + Intergenic
931866826 2:66421965-66421987 AAAGCTAAAAGCACTGAGGAAGG + Intergenic
932294761 2:70615195-70615217 TCAGCCAAAAGGAAGAAGGAAGG - Intronic
932879573 2:75488665-75488687 AGAACGTAAAGGAATGAGCAAGG + Intronic
932983637 2:76699751-76699773 AGAGGAAAAAGGAAGGAAGAGGG - Intergenic
934476325 2:94595988-94596010 AGAGCCCTGAGGAATGAAGAGGG + Intronic
935090952 2:99894347-99894369 AGAGAAAAAAGGGAGGAGGAAGG + Intronic
936613012 2:114019968-114019990 TGTGACAAAAGGAATGAGAATGG + Intergenic
937248937 2:120511342-120511364 AGAGAGAAAAGGGAAGAGGAGGG - Intergenic
937421082 2:121755858-121755880 AAAGGCAAAGGGAATGGGGAAGG - Intronic
937509859 2:122583148-122583170 AGAAGAAAAAGGAAGGAGGAAGG + Intergenic
938665025 2:133526150-133526172 ACAGAGAAAGGGAATGAGGAAGG + Intronic
938685996 2:133738252-133738274 AGAGGAAAGAGGAATGGGGATGG + Intergenic
939718299 2:145613992-145614014 AGAGTGAAAAAGAATGAGCAGGG + Intergenic
939949777 2:148456051-148456073 AGAACAAAAAGGAAAGAGGACGG - Intronic
942135966 2:172925916-172925938 AGAGTAAAAAAGAAAGAGGAGGG + Intronic
944131203 2:196349228-196349250 AGAGGAAATAGGAATGAGGATGG - Intronic
944329453 2:198448003-198448025 GGAGACAAAAGAAAGGAGGATGG + Intronic
944707979 2:202310116-202310138 AGAGCTTAAAGGAATGGGCATGG - Intergenic
945326620 2:208489503-208489525 AGAGCAAAAAGGAGTGGGGAGGG + Intronic
946007505 2:216538246-216538268 AGAGCTCAAAGGACAGAGGAAGG - Intronic
946287373 2:218714222-218714244 AGAGCAAAGAGGAAGGAAGAAGG + Intronic
946667798 2:222068879-222068901 AAAGGCACAAGGAATGAGAAGGG - Intergenic
947073257 2:226315021-226315043 AGACCCAGAAGGAAGAAGGAAGG - Intergenic
947714484 2:232332839-232332861 AGTGCCAGAGGGGATGAGGACGG + Intronic
1168845965 20:944916-944938 GGAGGCAGAAGGAATGCGGAGGG - Intergenic
1168989186 20:2079698-2079720 AGTGACACAAGAAATGAGGATGG - Intergenic
1169447937 20:5688088-5688110 AGACACAAAGGGAAAGAGGAAGG - Intergenic
1171271788 20:23823829-23823851 AGAAGCAAAAGGAAGGAGGGAGG + Exonic
1171889577 20:30698137-30698159 AGAGAAACAAAGAATGAGGAGGG - Intergenic
1172082202 20:32350924-32350946 AAAGCCCAAAGGAAAGAGGGTGG - Intergenic
1172463622 20:35138450-35138472 AGTGACAAATGGAATGAGCATGG - Intronic
1172974468 20:38895813-38895835 AGAGAAAGAAGGAAGGAGGAAGG - Intronic
1173906407 20:46632838-46632860 AGAGAGAAAAGGAGAGAGGAAGG - Intronic
1173943220 20:46929708-46929730 AGAGCAAAGAGGACTGAGGCTGG + Intronic
1174191355 20:48742882-48742904 AGAAGCCAAAGGAATGAGGGGGG + Intronic
1174348848 20:49952304-49952326 AGAGCCCAAAGGGAAGAGAAGGG - Exonic
1175380557 20:58559626-58559648 AGAGTCAAAAGGGAAGAGGGAGG + Intergenic
1176609405 21:8864655-8864677 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1176771521 21:13078873-13078895 AAAACCAAGAGGAATGAGGTAGG + Intergenic
1176964034 21:15192129-15192151 AAAGGGAAAAGGAATAAGGACGG + Intergenic
1176965706 21:15209337-15209359 ACAGCCAAAAGGAAGAAGAAGGG + Intergenic
1177385702 21:20407107-20407129 AGAGACAAAAGAAAAGAGTAAGG - Intergenic
1178684193 21:34698391-34698413 AGAGACAAAAGGAATGAAGGAGG + Intronic
1179013317 21:37573737-37573759 AGAGCTCAAGGGATTGAGGAGGG + Intergenic
1179237900 21:39563562-39563584 AGAGAGAGAAGGAAGGAGGAAGG - Intronic
1179542335 21:42091624-42091646 AGAGGAAAAAGGAAAGAAGACGG + Intronic
1180359500 22:11874502-11874524 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1180389941 22:12220120-12220142 AGATAAAAAAGGAAAGAGGAAGG - Intergenic
1180415995 22:12714360-12714382 AGATAAAAAAGGAAAGAGGAAGG + Intergenic
1180518655 22:16173319-16173341 AAAACCAAGAGGAATGAGGTAGG + Intergenic
1180725817 22:17945832-17945854 TGAGACAAAAGGGATGAGGTGGG + Intronic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182250959 22:28999869-28999891 AGAGACAGAAGGAAAGGGGACGG + Intronic
1182711107 22:32323868-32323890 GCAGCAAAAAGGAGTGAGGAGGG - Intergenic
1183332368 22:37228498-37228520 AGAACCAAGAGGAAGGAGAAGGG + Intronic
1183593998 22:38798703-38798725 AGAACCAAAAGGAGGGAGGGAGG - Intergenic
1184398634 22:44260741-44260763 GCAGCAAAAAGGAGTGAGGAGGG - Intronic
949129841 3:486787-486809 AGAGCCAATAGGTTTGTGGATGG - Intergenic
949430856 3:3974074-3974096 ATAGCACAAAGGAATGAGGGAGG - Intronic
949689104 3:6614130-6614152 AGAGGCAAAAGGATTTTGGAGGG + Intergenic
950505983 3:13394886-13394908 AAAGGCAAAAGAAATGATGAAGG + Intronic
950545793 3:13637234-13637256 AGAGGGAAAAGGAAGGAGAAAGG + Intronic
951544193 3:23808819-23808841 AGAGCCTAGAGGATTGAGGTGGG - Intronic
951685879 3:25343880-25343902 GGAACTAAAAGGAAAGAGGATGG + Intronic
951703311 3:25518573-25518595 AGACCCAAAAGAAATAACGATGG + Intronic
952255290 3:31689958-31689980 AGAGAAAAATGGAAGGAGGAAGG + Intronic
952740887 3:36733304-36733326 AGAGTGGAAAGGAATGAGCAGGG - Intronic
953205757 3:40827427-40827449 AGAGCCACTTGGAAGGAGGAGGG - Intergenic
953366675 3:42351300-42351322 AGAGCCAGCAGGGAGGAGGAGGG + Intergenic
953791301 3:45950116-45950138 AGAGCCAAATGGAAGGGAGAAGG - Intronic
954954277 3:54505463-54505485 AGAGCCCAAAGTAAAGAGTAGGG - Intronic
955475312 3:59330278-59330300 AGAGCCAGAAGAAATAAGAAGGG + Intergenic
955600271 3:60637574-60637596 ACAGCCAATAGGAATAATGATGG - Intronic
955786145 3:62541036-62541058 TAAGCAAAAAGGAATTAGGAGGG + Intronic
955990723 3:64624277-64624299 AGAAAGAAAAGGAAAGAGGAAGG + Intronic
956228794 3:66989360-66989382 AGAGGCGAAAGGCATGTGGAAGG - Intergenic
956741408 3:72279166-72279188 GGAGAGAAAAGGAAGGAGGAGGG + Intergenic
956793080 3:72694941-72694963 AGACCCAGAAGGAAGGACGAAGG - Intergenic
956828782 3:73024923-73024945 CAAGCCAAAGGGTATGAGGATGG + Intronic
958117166 3:89234979-89235001 AGAGAAAAAAGAAAGGAGGAGGG - Intronic
958536825 3:95414758-95414780 AGAGAAAGAAGAAATGAGGAAGG + Intergenic
958636846 3:96755792-96755814 TCAGCCAAAAGGAATGGGGCAGG - Intergenic
958891621 3:99790229-99790251 CCAGCCAGAAGGAAGGAGGAAGG + Intronic
959211731 3:103392123-103392145 AGAAACAAAAGTAATGAAGAGGG - Intergenic
959595986 3:108128903-108128925 AGAGGCAGAAGGAAGCAGGATGG + Intergenic
960206565 3:114908023-114908045 AGACCCAAAAGAAATGAAGGAGG + Intronic
960899460 3:122540363-122540385 AGAGACAGAAGGAGAGAGGAGGG - Intronic
962473353 3:135732959-135732981 AGAGCAATCAGGAAAGAGGAAGG - Intergenic
963015632 3:140821424-140821446 AGAGCCAAAGTGACAGAGGAGGG - Intergenic
963148702 3:142021253-142021275 AGAACCAAATAGAAAGAGGAAGG - Intronic
963363700 3:144307870-144307892 AGGGTCAGTAGGAATGAGGAGGG + Intergenic
963745854 3:149124610-149124632 AGAGCCAAATGTAATGAAAAGGG - Intergenic
964067076 3:152593330-152593352 GGAGAAAAAAAGAATGAGGAGGG + Intergenic
964195408 3:154058787-154058809 AGAGTGAGAAGGAATAAGGAGGG - Intergenic
964572314 3:158122208-158122230 ACAGCCGAAAGAAAGGAGGAAGG + Exonic
964801351 3:160562902-160562924 AGTGCCAAAAGATATGAGGTAGG + Intronic
965394214 3:168142585-168142607 AGAGCCCACAGGAATGAGGATGG + Intergenic
966486110 3:180471992-180472014 TGAGCCAAAAGGAATAAAGTTGG + Intergenic
966657920 3:182380449-182380471 AGAGTAAGAAGGAAGGAGGAAGG + Intergenic
967842402 3:194017244-194017266 AGAGCTGAGAGGCATGAGGATGG - Intergenic
967902159 3:194465539-194465561 TTAGCCACAAGGAATCAGGAAGG + Intronic
968074552 3:195809364-195809386 GGAGCCAAAAGGAACGGGGCTGG + Intronic
968811488 4:2801425-2801447 AGAGGCAAAAAGAAGGAAGAAGG - Intronic
969434394 4:7178443-7178465 AGAAACAAAAGTAATGAAGAAGG - Intergenic
969479236 4:7438663-7438685 AAAGAAAAAAGGAAAGAGGAAGG - Intronic
969525311 4:7701234-7701256 AGAGAAAAAAGGAGAGAGGAGGG + Intronic
969686823 4:8680198-8680220 AGAGACAAAGAGAAAGAGGAAGG + Intergenic
970894140 4:21083113-21083135 AGAGACAAAAGAAGTGAAGAAGG - Intronic
971218106 4:24680659-24680681 AGAGACAAAAGGAGTGAGGGAGG + Intergenic
971411924 4:26382859-26382881 AAACTCAAAAGGAATGAGGCAGG - Intronic
971460381 4:26889720-26889742 AGAGGCCATAGGAAGGAGGAAGG - Intronic
971766523 4:30839264-30839286 ATAGCCAAAAGGAATGAGAAGGG + Intronic
972279604 4:37589587-37589609 AGAGCCAAAAGGAGGAAGGAGGG - Intronic
972397128 4:38666970-38666992 AGGGACAAAAGAAATCAGGAGGG + Intronic
972774992 4:42232174-42232196 AGAGGAAAAAGGAGAGAGGAGGG + Intergenic
973531281 4:51839092-51839114 AGAGAGAAAAGGAAGGAAGAAGG + Intergenic
974196993 4:58587902-58587924 AGAGACAAAAAGAATGAACAAGG - Intergenic
974914904 4:68167596-68167618 AGAGAAAGAAGGGATGAGGATGG - Intergenic
975660321 4:76682019-76682041 AGAGCCAGAGGGAAAGTGGAGGG - Intronic
975745923 4:77473681-77473703 AGAGCCAACAGGTAGGAGCAGGG - Intergenic
976105545 4:81613312-81613334 AGAGCCAAGACCAATGAGAAGGG - Intronic
976397002 4:84566759-84566781 AGAGAGAAAAGAAATGAGAAAGG + Intergenic
977151159 4:93513668-93513690 AGAGCAAAAAGGAATTATCATGG + Intronic
977434535 4:96976428-96976450 ATAGCTAAAAGGGAGGAGGAAGG - Intergenic
978284922 4:107065313-107065335 AGAGACAGAAAGAAAGAGGAAGG - Intronic
978419109 4:108511289-108511311 ACAGCCAGAAGGAATCAGGTGGG + Intergenic
978487762 4:109275565-109275587 TGAGGGAAAAGAAATGAGGATGG + Intronic
978600636 4:110423901-110423923 GTAGCCAAAAGGGATGAGAAGGG + Intronic
978681910 4:111391161-111391183 ACACCCATAAGGAATAAGGAAGG - Intergenic
979823253 4:125200666-125200688 AAAGCTAAAAAGGATGAGGAAGG + Intergenic
982094642 4:151910956-151910978 AGAGCCAACAAGAATGCAGAAGG + Intergenic
982391676 4:154871195-154871217 GGAGGCAGAAGGAAAGAGGAGGG + Intergenic
982714007 4:158787822-158787844 AGAGCAAAGAGAAATGAGGCAGG - Intronic
983486175 4:168333199-168333221 ACAGCAAAAAGAAATGAGTAAGG + Intergenic
983840406 4:172450649-172450671 GGAGAGAAAAGGAATGAGGTTGG - Intronic
983984400 4:174040731-174040753 AGAGGCAAAAGGAGTGTAGACGG + Intergenic
984288250 4:177761291-177761313 GGGGCCCAAGGGAATGAGGAGGG + Intronic
984379358 4:178970699-178970721 AAGCCCAAAAGGAATGAAGAAGG - Intergenic
985168832 4:187126797-187126819 AGAGACAAAAGAAAGAAGGAAGG - Intergenic
1202769838 4_GL000008v2_random:193852-193874 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
985658932 5:1146139-1146161 AGAGCCTTTGGGAATGAGGAGGG - Intergenic
987057978 5:14213222-14213244 AGAGTGAAAAGAAAAGAGGAGGG - Intronic
987914109 5:24189427-24189449 GGAGCCAAAAGGAATATGGGTGG - Intergenic
988258558 5:28851975-28851997 AGAGGCAGAACCAATGAGGAGGG - Intergenic
988457681 5:31401485-31401507 AGAGTTAAAAGAAATGAGGTGGG - Exonic
988693008 5:33591653-33591675 AGAGGGAAAAGGACTGAGCATGG - Intronic
988720737 5:33876592-33876614 AGAGAGAAAAGGAGGGAGGAGGG + Intronic
989192804 5:38687875-38687897 AAAGACAAAAGAAAAGAGGAAGG - Intergenic
989304546 5:39938301-39938323 AGAGCCAAATGGTAAGATGACGG - Intergenic
989333996 5:40292990-40293012 AGATGAAACAGGAATGAGGAAGG - Intergenic
989511353 5:42291423-42291445 AGAACCAATAGGAATCATGATGG - Intergenic
989954296 5:50338587-50338609 AAAGAGAAAAGGAAAGAGGATGG + Intergenic
992036006 5:72776952-72776974 AGAATTAAAAAGAATGAGGAAGG + Intergenic
992146778 5:73858605-73858627 AGAGCCAAGAGGATTGTTGATGG - Intronic
992184010 5:74225981-74226003 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
992482210 5:77163282-77163304 AAAGACAAAAGAAATGTGGAGGG - Intergenic
992515559 5:77488607-77488629 AGAGACAACAGAAATGAGGTTGG + Intronic
992744217 5:79803525-79803547 AGAGCCTGCAGGAGTGAGGAAGG - Intergenic
993271750 5:85806055-85806077 AGAGAGAAGAGGAATGAAGAGGG + Intergenic
993330509 5:86594491-86594513 AGAGAGAAAAAGAAAGAGGAAGG + Intergenic
993409834 5:87559672-87559694 AAACCCAGATGGAATGAGGAAGG - Intergenic
994458105 5:100039769-100039791 ATAAGCAAAAGCAATGAGGAAGG + Intergenic
994610342 5:102029722-102029744 AGAAGCAAATGGAATGAAGATGG - Intergenic
995095045 5:108225923-108225945 AGAGCCAAAAGTAAGGAAGGAGG - Intronic
995371658 5:111425611-111425633 AAAGCTAAAAGGAATTAGCATGG + Intronic
995458021 5:112372430-112372452 AGAGCCAAAACAAATCAGGAAGG + Intronic
996074062 5:119168866-119168888 CAAGACAAAAGGAAAGAGGAAGG - Intronic
996590697 5:125144037-125144059 ATAGGCAAAAGCAAAGAGGAAGG - Intergenic
997426944 5:133809687-133809709 AGAGACAGAAGGAAGGAGTAAGG + Intergenic
997445242 5:133935523-133935545 AGAGGCAACAGGAATGTGTATGG + Intergenic
998374366 5:141681411-141681433 TGAGCCCAAGGGAATGAGCAGGG - Intronic
998882395 5:146656863-146656885 AGAGACAGAAGGAATGGTGAGGG - Intronic
999091351 5:148939034-148939056 AGAGACAAGAGGACTGAAGAGGG - Intronic
999142153 5:149369641-149369663 AGGTCCAAAAGGAATGAAAAGGG - Exonic
999615477 5:153418328-153418350 AGAGTCATATGGAATGAGGCTGG - Intergenic
1000842776 5:166242483-166242505 AATGCTAAAAGGAATGAAGAAGG + Intergenic
1001108778 5:168878000-168878022 ACAGCGAAAAGGAGAGAGGAGGG - Intronic
1001359317 5:171065237-171065259 AGTGCCAAAAAGGTTGAGGATGG - Intronic
1001525660 5:172426810-172426832 AGAGCCAGAGGGAGAGAGGAGGG + Intronic
1001832502 5:174801227-174801249 AGAGGCAAAGGGACTGAGAAAGG - Intergenic
1002193684 5:177491356-177491378 AGTGCCAAAAGGAAGAAGAAAGG + Intronic
1002586788 5:180253593-180253615 AGGGCCAGCAGGAGTGAGGAAGG - Intronic
1003518489 6:6837256-6837278 AGAGTAAGAAGGAATAAGGAAGG - Intergenic
1004154408 6:13154869-13154891 AAAGCCAAAATTATTGAGGAAGG + Intronic
1004872457 6:19920678-19920700 ACAGGCAAAAGGAATGAGGTGGG - Intergenic
1004892680 6:20116497-20116519 AGGGACAGAAGGAAGGAGGAAGG + Intronic
1004979568 6:21008207-21008229 GGAGCCAAAAAGAAAGATGAGGG + Intronic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1005089696 6:22043508-22043530 AAAGCCAAAAGGAGGTAGGAGGG - Intergenic
1005293549 6:24401978-24402000 AGAGACAAAAGGAAGGGGGAAGG - Intergenic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005468661 6:26140572-26140594 AGAGCAAAGAGAAATGTGGAAGG + Intergenic
1005915867 6:30351100-30351122 AGCTCCAAAAAGAATCAGGATGG - Intergenic
1006093117 6:31639806-31639828 AGTGCCAAAGAGAATTAGGAAGG - Intronic
1006111989 6:31752771-31752793 AGAGAAAAAAGGATTGGGGAGGG - Intronic
1006217722 6:32459701-32459723 TGAGCCAGAAGGAATTAGGAGGG - Intergenic
1006285875 6:33093550-33093572 AGATCCTACAGGAATGAGGTAGG - Intergenic
1006724543 6:36188248-36188270 AGAGAGAAAGGGAAGGAGGAAGG - Intergenic
1007724235 6:43905197-43905219 AGAGAAAGAAGGAAGGAGGAAGG - Intergenic
1007823170 6:44577248-44577270 GGAGTGAAAAGGAGTGAGGACGG + Intergenic
1008280679 6:49592226-49592248 AGAGCCAAGAGGCGTGAGAAGGG + Intergenic
1008326418 6:50187517-50187539 AGAGAGAAAAGGAGGGAGGAAGG - Intergenic
1008571846 6:52824532-52824554 AGACCCAGAAGGACTAAGGAAGG + Intergenic
1008977810 6:57448442-57448464 AGAGCCAATATGAGTGAGCATGG + Intronic
1010161977 6:72867522-72867544 AGAGCCAACAAGAAGGAGAAGGG + Intronic
1011940752 6:92840158-92840180 AGAGCCAAAGGGGATGATGGAGG - Intergenic
1011949128 6:92942557-92942579 AGAGAGAAAAAGAAAGAGGAAGG - Intergenic
1012425921 6:99114318-99114340 AGAGGCAAAAGGAGATAGGATGG - Intergenic
1012985500 6:105871561-105871583 ATATCAAAAAGGAAAGAGGATGG - Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1013667120 6:112360295-112360317 AGAGACAAAAGCAATGACGCGGG - Intergenic
1014296916 6:119629602-119629624 AGAGCAAAAAGGATTTATGAGGG + Intergenic
1014869934 6:126581423-126581445 AAAAACAAAAGGAAAGAGGAAGG - Intergenic
1015129602 6:129794541-129794563 CCAGCCAAAAGGAATCAAGAGGG - Intergenic
1015141066 6:129932382-129932404 AGAGAGAAAAAGAAAGAGGAGGG + Intergenic
1016068922 6:139714169-139714191 TGATTCAAAAGCAATGAGGAGGG + Intergenic
1016672517 6:146725583-146725605 GGTGCCAAAAAGAATGGGGATGG + Intronic
1017200592 6:151750003-151750025 AAATACAAAAGGAATGAGGGAGG + Intronic
1017209822 6:151842840-151842862 AGAGCCAAAGCGACTGAGGAAGG + Intronic
1018418298 6:163620393-163620415 AGAGCCCAACGGATTGAGGAAGG - Intergenic
1018454229 6:163937867-163937889 AGAGCAACAAGGCAGGAGGAGGG + Intergenic
1018992121 6:168682116-168682138 AGAAACAAAAGGAGGGAGGAAGG + Intergenic
1019281848 7:204548-204570 AGAGCCATCAGAAATGGGGAGGG + Intronic
1019590734 7:1829483-1829505 AGAGCCAAGAGGACTGTGGCTGG + Intronic
1019867359 7:3724761-3724783 GAAGGAAAAAGGAATGAGGAGGG + Intronic
1020719555 7:11723966-11723988 AGACCCAAAAGCAGTAAGGATGG + Intronic
1020861467 7:13497019-13497041 AAAGCCAATAGGAATTGGGAAGG - Intergenic
1020903034 7:14029299-14029321 AAAACCAAAAGGAATCAGGAAGG - Intergenic
1021352276 7:19609880-19609902 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
1022955893 7:35379737-35379759 ACAGTCAAATGGAAAGAGGAAGG - Intergenic
1023464003 7:40433553-40433575 AGATTCAAAAGGAAACAGGAAGG - Intronic
1024042279 7:45564920-45564942 AAAGGCAACAGGAATGGGGAGGG - Intergenic
1024613201 7:51084629-51084651 AGAGCCCAGAGGAAAGAAGATGG - Intronic
1025620917 7:63169990-63170012 GTAGCCAAAAGGAATGAGGAGGG + Intergenic
1025823744 7:64994546-64994568 AGAGGCAAAAGGAAACAGAAAGG - Intronic
1027131122 7:75592158-75592180 AAAGACAAAGGGAAGGAGGATGG + Intronic
1027373177 7:77529070-77529092 AGGGCCTAAAGAGATGAGGAAGG + Intergenic
1028057961 7:86272178-86272200 AAAGCGAAAGTGAATGAGGAAGG - Intergenic
1028219137 7:88174794-88174816 AGAGAGAAAAGAAATGGGGAAGG - Intronic
1029264705 7:99328967-99328989 AGAGAGAAAAGGGATGAGGGGGG + Intronic
1030486801 7:110179074-110179096 AGAGGGAAAAGAAAGGAGGAAGG + Intergenic
1030524748 7:110639587-110639609 AGAGAATAAAGGAGTGAGGAAGG + Intergenic
1030916207 7:115316941-115316963 ATTGCCAAAACAAATGAGGAAGG + Intergenic
1031037792 7:116807175-116807197 AGAGACAAAAGGCAGGGGGAGGG + Intergenic
1031214803 7:118877111-118877133 AGAGGGGAAAGGAAAGAGGAGGG + Intergenic
1031391034 7:121215197-121215219 AGAGCCAAAAGGATGGAGCTGGG - Intronic
1032112591 7:129089166-129089188 AGACCCAAAGGCAATGAGAAAGG - Intergenic
1032624624 7:133577588-133577610 AGAGCCAAAAGGACTGAACAAGG - Intronic
1032782989 7:135179043-135179065 AGAAGCAAAAGGAAATAGGAAGG + Intergenic
1033949063 7:146761053-146761075 TGAGCAAAAAGGAATGCCGAGGG - Intronic
1035115352 7:156518970-156518992 AGAGCCAACAGGCATGAGCGAGG + Intergenic
1035116303 7:156527164-156527186 GGAGCCAAATGGACTCAGGAAGG - Intergenic
1036126596 8:6068607-6068629 AAAGCAGAAAGGAAGGAGGATGG - Intergenic
1036412815 8:8518423-8518445 AGAGCCATAAGAAATGAAGAGGG - Intergenic
1037218818 8:16490927-16490949 TGAGCCAACATGAATGTGGATGG + Intronic
1037235127 8:16710982-16711004 AAAGCAAAAAGGAATATGGATGG - Intergenic
1037480650 8:19302206-19302228 TGAGAGGAAAGGAATGAGGAAGG + Intergenic
1037583901 8:20263404-20263426 AGAGCCAAAATGTTGGAGGAGGG - Intronic
1037676994 8:21059495-21059517 AGAGCTACAGGGAATGGGGAAGG - Intergenic
1037698972 8:21254986-21255008 AGAGCCAAAAGTGAAGAGGATGG - Intergenic
1037741577 8:21612967-21612989 AGTGCCAAAAGCAGGGAGGAGGG + Intergenic
1038053333 8:23833887-23833909 AGAGCCAAGAAGAGTGGGGAGGG + Intergenic
1038058257 8:23882592-23882614 AGAACCAAAAGGATGGATGAGGG - Intergenic
1038067110 8:23974734-23974756 AGAGGCAAAAAGAGAGAGGATGG + Intergenic
1038150375 8:24938062-24938084 AGAGAGGAAAGGAAGGAGGAAGG + Intergenic
1038550790 8:28466717-28466739 AGAGCCAAAAGGAAGGTGAGAGG + Intronic
1039434956 8:37553667-37553689 AGAGTCAAAAGGCAAGAGGACGG - Intergenic
1040026156 8:42784710-42784732 AAAGGAAAAAGGAAAGAGGAGGG + Intronic
1040384898 8:46908012-46908034 AGAGCCAGAGGGAAGGAGGCAGG + Intergenic
1040538472 8:48330192-48330214 AGAGCCAAAAGGAAAAAAAAAGG - Intergenic
1041324743 8:56652385-56652407 AGAGGCAAAAGGAATATCGAGGG + Intergenic
1041343983 8:56876505-56876527 AGAGACAGAAGGAGGGAGGAAGG + Intergenic
1041644510 8:60237834-60237856 AGAGTTATAAGGAGTGAGGAAGG - Intronic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1044333393 8:90947177-90947199 AGAAACAAAAGGAATGGGGTGGG - Intronic
1044367829 8:91370299-91370321 AGAGGGAAAAGGAGAGAGGAGGG - Intronic
1044714270 8:95086561-95086583 AGAGACAAGAGGAAGGAGGGAGG - Intronic
1044778977 8:95723851-95723873 AGAGGTGAAAGGACTGAGGATGG + Intergenic
1044893363 8:96861413-96861435 AAAGCAATAAGGATTGAGGAAGG + Intronic
1045237993 8:100373254-100373276 AGAGCCAAAGAGAATGAGGGAGG - Intronic
1045426786 8:102075008-102075030 CCAGGCAAAAGGAAGGAGGAAGG + Intronic
1047401410 8:124551509-124551531 AGAGCCAACAGGAATCTGCAGGG + Intronic
1047440870 8:124877259-124877281 AGAGACAAAAAGGATGAGTAGGG - Intergenic
1047637158 8:126776919-126776941 AGACCCAGAAGGAAAGAAGAGGG + Intergenic
1047965173 8:130041164-130041186 AGGGGAAGAAGGAATGAGGAGGG - Intergenic
1048520098 8:135145940-135145962 AGAGACAGAAGGAAAGAGAATGG - Intergenic
1049371691 8:142271044-142271066 AGAGCCAAAGGGCAGGAGCAGGG - Intronic
1049956694 9:699565-699587 GAAGCCAAAAGGAGTTAGGAAGG + Intronic
1050466381 9:5928653-5928675 AGACCTTAAAGAAATGAGGAAGG - Intronic
1050491514 9:6193414-6193436 AGAACCAAATGGAATGATGGAGG + Intergenic
1050568684 9:6914744-6914766 AGAGATAGAAGGAATGGGGAAGG - Intronic
1051164759 9:14249718-14249740 AAAGGGAAAAGAAATGAGGAAGG + Intronic
1051272631 9:15370484-15370506 ACATACAAAAGGATTGAGGAAGG - Intergenic
1052847858 9:33353168-33353190 AGAGAAAAAAAGAAAGAGGAAGG - Intronic
1052853713 9:33393934-33393956 AGAGCCCTGAGGAATGAAGAAGG - Intronic
1053342451 9:37349119-37349141 AATGCCAAATTGAATGAGGAGGG + Intronic
1053584480 9:39442511-39442533 TGAGGAAAAAGGAATGATGAAGG - Intergenic
1053681739 9:40490088-40490110 AGAGCCCTGAGGAATGAAGAGGG - Intergenic
1053931732 9:43118417-43118439 AGAGCCCTGAGGAATGAAGAGGG - Intergenic
1054106060 9:61001257-61001279 TGAGGAAAAAGGAATGATGAAGG - Intergenic
1054281975 9:63134846-63134868 AGAGCCCTGAGGAATGAAGAGGG + Intergenic
1054294831 9:63325605-63325627 AGAGCCCTGAGGAATGAAGAGGG - Intergenic
1054392851 9:64630092-64630114 AGAGCCCTGAGGAATGAAGAGGG - Intergenic
1054427501 9:65135301-65135323 AGAGCCCTGAGGAATGAAGAGGG - Intergenic
1054502876 9:65886239-65886261 AGAGCCCTGAGGAATGAAGAGGG + Intronic
1054839591 9:69722336-69722358 AGATCCAAAAGAAATGAAGCTGG + Intronic
1055877253 9:80958401-80958423 AGAGGGAAAAGGACGGAGGAAGG - Intergenic
1056468333 9:86880771-86880793 AGGTACAAAAGGAATGAGGGTGG - Intergenic
1056741678 9:89261586-89261608 AGTGCCAGAAGGAAAGAGCAAGG + Intergenic
1057440421 9:95079032-95079054 AGAGCAAAAGGGAAGGAGGCTGG - Intronic
1059750982 9:117247056-117247078 GGAGCCAAAAGCACTGAGGAGGG + Intronic
1060431075 9:123551894-123551916 AGATCCAGAAGGAAGAAGGAAGG - Intronic
1061215562 9:129219690-129219712 AGAGCCCCAAGAAAAGAGGAAGG - Intergenic
1062324863 9:136007937-136007959 AGAGCCAGGAGGAAGGCGGAAGG - Exonic
1203694738 Un_GL000214v1:87531-87553 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203704812 Un_KI270742v1:29901-29923 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203559192 Un_KI270744v1:35910-35932 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203641535 Un_KI270751v1:16532-16554 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203650533 Un_KI270751v1:115975-115997 AGATAAAAAAGGAAAGAGGAAGG - Intergenic
1185512455 X:673713-673735 AGAGACAAAAGGAGGGAAGAGGG + Intergenic
1185680035 X:1881003-1881025 AGAGACAAAAGAAAAAAGGAAGG + Intergenic
1186239715 X:7553345-7553367 AGAGCAAAAAGGAAGGGGAAAGG + Intergenic
1186313490 X:8344898-8344920 AGAGGCAAATTGTATGAGGAGGG - Intergenic
1186787939 X:12970921-12970943 AGAGCCAAAAGAAATGTAAAAGG - Intergenic
1186853483 X:13603150-13603172 AGAGCCAAAAGGGATCAGTAGGG - Intronic
1187264481 X:17718679-17718701 AAAGCAAAAAGGAAGAAGGAAGG + Intronic
1187608704 X:20916139-20916161 AGAACCAACAGGAATCAGTATGG + Intergenic
1188561415 X:31472619-31472641 AAAGCCACAGGGACTGAGGATGG + Intronic
1189000304 X:36937146-36937168 AGAGAGAAAAGAAAAGAGGAAGG + Intergenic
1189376056 X:40467080-40467102 AGAGCCAAAGGGAATAGGGGAGG + Intergenic
1189563199 X:42212390-42212412 AAAGCCAAAAGGCATGGGGTAGG + Intergenic
1189851378 X:45179524-45179546 AGAGACAAAATGAATGAAAAAGG + Intronic
1190338783 X:49280016-49280038 GCAGTCAAGAGGAATGAGGATGG - Intronic
1190549763 X:51567285-51567307 AGAGTCAAAAGGAAAGGGAAGGG + Intergenic
1190720201 X:53141581-53141603 AAAGAAAAAAGGAAAGAGGAAGG - Intergenic
1192184370 X:68936679-68936701 GGAGACAAAAGGGAAGAGGAAGG + Intergenic
1192536583 X:71933757-71933779 AGAGGCAGCAGAAATGAGGAAGG - Intergenic
1192698383 X:73442848-73442870 AGTTCCAAAGGGATTGAGGAGGG + Intergenic
1194383316 X:93222384-93222406 ATTGCCAAGAGGAATGTGGAAGG - Intergenic
1196016901 X:110949278-110949300 ACACTCAAGAGGAATGAGGAGGG - Intronic
1198063341 X:133070038-133070060 AGAGACAAGAGGAAAGATGAGGG + Intronic
1198111963 X:133509750-133509772 AGTGGCAGGAGGAATGAGGAGGG + Intergenic
1198770311 X:140123861-140123883 AGAGGCAAAAGGAAAGATGGTGG - Intergenic
1199399345 X:147378196-147378218 AGGGCCAATGGGAATGAGTAGGG - Intergenic
1200274612 X:154719868-154719890 AATGCCACAAGGAATGACGAGGG + Intronic
1201410908 Y:13698525-13698547 AGAACCAAAAGAAATGTAGAAGG - Intergenic
1201720763 Y:17094346-17094368 AGACCCAAAAGGACTGAGTTTGG - Intergenic