ID: 1141292456

View in Genome Browser
Species Human (GRCh38)
Location 16:82732530-82732552
Sequence ATTTGAAACAGGAAGATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 615
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 568}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141292453_1141292456 16 Left 1141292453 16:82732491-82732513 CCAGCCAGGACAAATCTATTTCT No data
Right 1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG 0: 1
1: 0
2: 5
3: 41
4: 568
1141292454_1141292456 12 Left 1141292454 16:82732495-82732517 CCAGGACAAATCTATTTCTGAAG 0: 1
1: 0
2: 0
3: 34
4: 289
Right 1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG 0: 1
1: 0
2: 5
3: 41
4: 568

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141292456 Original CRISPR ATTTGAAACAGGAAGATGAA TGG Intronic
902522104 1:17024826-17024848 ATTAAAAACAGCAAAATGAAAGG + Intronic
902651891 1:17842775-17842797 TATTGAAACAGGAAGAAGCAGGG + Intergenic
906385244 1:45362794-45362816 ATGTGAAACACAAAGATAAATGG + Intronic
906430701 1:45753710-45753732 ATTTGCAAAAAGAAGAAGAAGGG + Intergenic
906466837 1:46089264-46089286 AATTCAAACAGGAGGATGAAGGG + Intronic
906783683 1:48595574-48595596 AATTAAAACAGAATGATGAAGGG + Intronic
906824672 1:48966321-48966343 ATTTGAACAAGGAAATTGAAAGG - Intronic
907164068 1:52394581-52394603 AGTTGAAAGAGGAAGAAGAGGGG + Intronic
907718281 1:56948118-56948140 ATTTGAATCAGGGAGCTGGAAGG + Intronic
908735564 1:67272698-67272720 ATTTGAGAACGGAAGTTGAACGG - Intergenic
908771030 1:67595825-67595847 ATTAGAAACACAAAGATGAAAGG + Intergenic
909106780 1:71420067-71420089 ATTTCAAACAGTAATATAAATGG - Intronic
909315781 1:74216460-74216482 ATTTAAAAAAAGAAGAAGAAAGG - Intronic
909528607 1:76656490-76656512 AATTGAAACAGTAAGATGACAGG + Intergenic
909615257 1:77601663-77601685 CTTTTAAACAGGGAAATGAAGGG - Intronic
909939518 1:81594579-81594601 ATTTTAAATAGGAAAAGGAATGG - Intronic
910573317 1:88730246-88730268 ATCTGAAACAAGAAGTAGAAAGG + Intronic
910855545 1:91691603-91691625 CTTTAAACCAGGAAGAAGAAAGG + Intronic
911199903 1:95033905-95033927 ATTTTAAGCAGGAGAATGAAAGG - Intronic
911471570 1:98325651-98325673 ATTTGAAAAAGAAGGAAGAAGGG - Intergenic
911909255 1:103611603-103611625 ATTAGTAACAGCAGGATGAAGGG + Intergenic
912584376 1:110749165-110749187 GTTTGAAGCAGGAAGCTGTAAGG + Intergenic
912635203 1:111285535-111285557 ATTTCAATCAGTAAGATGTAAGG + Intergenic
914960536 1:152202526-152202548 ATGTGACACAGAAACATGAAGGG + Intergenic
915159124 1:153904195-153904217 ATTTGAAACTGGAAGACAGAGGG + Intronic
915268963 1:154738946-154738968 AATTATAAAAGGAAGATGAAGGG + Intronic
915605405 1:156947243-156947265 AAGTGGAACAGGAAGCTGAAGGG + Intronic
916981947 1:170147371-170147393 CTTTGAAAAAGTAAAATGAAAGG - Intronic
917592593 1:176492078-176492100 ATTGGAAACAGCAAGATGTGAGG + Intronic
918285528 1:183051016-183051038 ATTTGAAAGGAGAAGAGGAAAGG - Intronic
918418974 1:184342681-184342703 ATTGGAAAGATGAGGATGAAAGG - Intergenic
918516596 1:185370132-185370154 ATTTTCAGCAGGAAAATGAAGGG + Intergenic
918639116 1:186817149-186817171 TTTTGAAATAAGAAGATGAAAGG - Intergenic
918879606 1:190099495-190099517 TTTTGAAATAAGAAGAAGAAAGG + Intronic
918893763 1:190313348-190313370 AGATGATACAGGAAGAAGAAAGG + Intronic
918998933 1:191802247-191802269 ATGTAAAAGAGGAAGATCAAGGG + Intergenic
919493496 1:198235205-198235227 TTTTGAAACAAGAAAAAGAATGG - Intronic
920153869 1:203932630-203932652 CTCTTCAACAGGAAGATGAACGG + Intergenic
920211374 1:204331307-204331329 GTGGGAAACAGGAAGAAGAAAGG + Intronic
920972217 1:210752694-210752716 ATTAGAAAGAGGAAGAGGAAAGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921524773 1:216202997-216203019 ATTAGAAATACAAAGATGAAAGG - Intronic
921614430 1:217249802-217249824 ATTTGTAAGTGGAAGATGAGTGG + Intergenic
922228183 1:223663889-223663911 GGTTGAAACAGGAAGACAAAGGG - Intronic
922564471 1:226592785-226592807 AGTGGACACAGGAAGATGCAGGG - Intronic
924091783 1:240509108-240509130 ATTTGTGACAGGAAGATGTGAGG + Intronic
924353355 1:243142031-243142053 ACTTGAAACATGAATATAAATGG - Intronic
924632256 1:245752199-245752221 ATCTGGCAAAGGAAGATGAATGG + Intronic
924944380 1:248836544-248836566 AATTGTAACAGGAAGATGGAGGG - Intergenic
1063163097 10:3434086-3434108 ATTTGAAAAAGCAAGAGGAGAGG - Intergenic
1063177911 10:3568807-3568829 ATTTGTAAGAGGAAGAAGAAGGG - Intergenic
1063808486 10:9676464-9676486 AATTTCAACAGGAAAATGAAAGG - Intergenic
1066558962 10:36647439-36647461 ATCAGAAACAGGAAGAGGTAAGG + Intergenic
1066660154 10:37730359-37730381 CTTTGCAACAGGAAAAGGAAGGG + Intergenic
1068540109 10:58282811-58282833 TTTCGAAACAAGAAGATGAAAGG + Intronic
1068682106 10:59831187-59831209 ATTTAAATTTGGAAGATGAATGG + Intronic
1068917131 10:62444596-62444618 ATTTGAATGAAGAAGATGTAAGG - Intronic
1069054857 10:63834126-63834148 CTTGGAAAAAGGAAGATGATGGG + Intergenic
1069887945 10:71635666-71635688 ATTGGAAAGAGGAAGGTGAGAGG + Intronic
1071038560 10:81278115-81278137 ATGTGAAACAGAAAGAGGACAGG + Intergenic
1071792308 10:88967820-88967842 ATTTAAAACAGGAAAATGGTTGG + Intronic
1072343591 10:94480277-94480299 CTTTGAATGAGGAAGATGATGGG - Intronic
1072446053 10:95499634-95499656 ATCAAAAACAGGAAAATGAAAGG + Intronic
1073110468 10:101060708-101060730 ATTTTAAACAGGAAAAAGAAAGG - Intergenic
1073772770 10:106753379-106753401 ATCTGAAGGAGGAAGAGGAATGG + Intronic
1074014113 10:109515939-109515961 ATTTAAAGCAGGCATATGAAAGG + Intergenic
1074084083 10:110194343-110194365 ATTTGAAAAAGGATTAGGAAAGG + Intergenic
1074407554 10:113192173-113192195 AGCTGAATCAGGAAGAAGAATGG + Intergenic
1074825586 10:117213503-117213525 AAGTGAGACAGGGAGATGAAGGG - Intergenic
1075079885 10:119376232-119376254 ATTTGGAAGAGGAAGGTGACTGG - Intronic
1075984636 10:126774085-126774107 ACTTGAAACTGAAAGTTGAAAGG - Intergenic
1076293243 10:129363891-129363913 ATTTAAAAGAGAAAGATGAGAGG - Intergenic
1076444235 10:130500855-130500877 ATTTGGAAATGGAAGATGGAAGG + Intergenic
1077110793 11:861157-861179 AATTAAAACAGGAAGAGGCAGGG - Intronic
1077981039 11:7301015-7301037 ATTTAACACAGGCAAATGAAGGG - Intronic
1078391799 11:10941257-10941279 GTTTGAAACATGAGGATGTATGG - Intergenic
1078769747 11:14338084-14338106 ATTATAAACAGGAAAATAAAGGG + Intronic
1079649176 11:22905412-22905434 CTTTAAAACAAGAAGATGGAAGG - Intergenic
1079662699 11:23060483-23060505 ATTTGAAAATGCAAGGTGAATGG + Intergenic
1079797300 11:24821693-24821715 ATTTCAAAAAGCATGATGAAAGG + Intronic
1080202789 11:29692674-29692696 ATTTCAGACAGTAAGAGGAAGGG + Intergenic
1080281439 11:30562045-30562067 TTTGGAGACATGAAGATGAAAGG - Intronic
1080475442 11:32585900-32585922 ATGTGCAACAGGAATATGAAAGG - Intronic
1080892023 11:36417333-36417355 CTTTGAAACAGGAAGAGGTAAGG - Intronic
1081147865 11:39585377-39585399 AATTGAAACATGAATATAAAAGG - Intergenic
1082626397 11:55491954-55491976 CTTGCAAACAGGAAGATGCAGGG - Intergenic
1084783461 11:71426984-71427006 TTTTTAAACAGGATGATAAAAGG - Intergenic
1086358507 11:86032095-86032117 CTTTGCAACAGGAAGATAACAGG + Intronic
1087294307 11:96352009-96352031 AATTGAAAGGTGAAGATGAAGGG - Intergenic
1087569789 11:99911346-99911368 TTTGGAAAAAGGAAGAGGAATGG - Intronic
1087651111 11:100869253-100869275 TTTTCAGACAGAAAGATGAAGGG + Intronic
1088080403 11:105905019-105905041 ATCTGAAATAGGAATATCAAAGG - Intronic
1090097139 11:123753629-123753651 ATTAGAAACAAGGAGGTGAAGGG - Exonic
1090180876 11:124698397-124698419 ATTGGAAACAGAGAGATAAAGGG - Intergenic
1090283288 11:125477019-125477041 GTTTGTAGCAGAAAGATGAAAGG + Intronic
1090419700 11:126566032-126566054 TTTTGGAACAGTAAGATGATGGG + Intronic
1090456844 11:126857536-126857558 AAGAGAAACAGGAAGAAGAAAGG - Intronic
1091030594 11:132184150-132184172 ATATGGAACAGGAAGATCTACGG - Intronic
1093276416 12:17133871-17133893 ATTTGAGGCAGGAAGGGGAAAGG - Intergenic
1093479217 12:19587316-19587338 ATTTGAAAAAGTGAGATAAAAGG + Intronic
1093611655 12:21167753-21167775 ATTAGAAACAGAAAGTGGAAAGG - Intronic
1094299794 12:28950132-28950154 GTCTGAAACAGGAAGCTGAGTGG + Intergenic
1094593836 12:31845999-31846021 ATTTTTAAAAGGAAAATGAAGGG - Intergenic
1095135265 12:38593462-38593484 ATTTGAAACACGCAGTAGAATGG - Intergenic
1095594084 12:43939115-43939137 ATTTGCAACAGGAATATTACTGG + Intronic
1095682364 12:44993068-44993090 ATTTTTTCCAGGAAGATGAAAGG + Intergenic
1095743773 12:45634965-45634987 AATGGAAATAGGAAGATGAGGGG - Intergenic
1096188906 12:49601839-49601861 TTTTTAAATAGGCAGATGAATGG - Intronic
1096810464 12:54166393-54166415 ATAGGACACAGGAAGAAGAACGG + Intronic
1097585751 12:61514196-61514218 ATTTTGAAGAGCAAGATGAATGG - Intergenic
1097638170 12:62146693-62146715 ATTTGTAACAGGATGTTGCATGG - Intronic
1097742716 12:63262963-63262985 ATTTAAAACAACAAGTTGAAAGG + Intergenic
1097825457 12:64170825-64170847 ATTTAAAAAAAGAAGAGGAAAGG - Intergenic
1098232064 12:68381590-68381612 AGTTTAAACAGGAAGCAGAATGG + Intergenic
1098250600 12:68566192-68566214 ATTTGAAACAGTATGATCATAGG - Intergenic
1098509514 12:71295358-71295380 ATTTGAAACTGGGAAATAAAAGG + Intronic
1099370712 12:81826343-81826365 ATTTGAACCAGGGAGAGGAAAGG + Intergenic
1099718288 12:86326951-86326973 ATTTGAAGCAGTAATATAAAAGG - Intronic
1099986112 12:89666762-89666784 AATTGAAAGAGGAACATGACAGG - Intronic
1100649317 12:96567442-96567464 ATTTGAATGAGGAAGTTGGATGG + Intronic
1100755325 12:97745125-97745147 ACAAGAAACAGGAAAATGAATGG - Intergenic
1101509320 12:105378907-105378929 ATTTGTAAAAGGAATATAAATGG + Intronic
1102689754 12:114751112-114751134 ATTAGAAACAAGAAGAGGGAAGG + Intergenic
1103678831 12:122677371-122677393 TTTTGATACAGAAAGATGGAGGG - Intergenic
1103859831 12:124003357-124003379 ATTTGCAGTAGGAAAATGAAGGG + Intronic
1104409752 12:128548154-128548176 GTTTCAAACAGGACCATGAATGG + Intronic
1104451824 12:128875381-128875403 ATCTGAGACTGGCAGATGAATGG + Intronic
1104605202 12:130183060-130183082 ATTTGAGACACGGAGATGCAGGG + Intergenic
1105274603 13:18907674-18907696 CTTTGCAACAGGAAAAGGAAGGG + Intergenic
1106044408 13:26124967-26124989 ATTTGAAACAGCAAGACGAAAGG - Intergenic
1106568062 13:30904293-30904315 TTTTGAAACAGGAAGATCAGAGG - Intergenic
1107103120 13:36615194-36615216 ATTTAAAAGAGGATGCTGAATGG - Intergenic
1108192287 13:47954460-47954482 ACTGGACCCAGGAAGATGAAAGG - Exonic
1108208653 13:48116432-48116454 TTTTGAAATAGTAGGATGAAGGG + Intergenic
1108372576 13:49785241-49785263 TTTTTAAACAGGAAGGTGACAGG + Intronic
1109070423 13:57759030-57759052 GTTTGAAACAGGTAGAGAAAAGG + Intergenic
1109099840 13:58168263-58168285 ATTTCTAACAGGAAGAAGAGAGG + Intergenic
1109226156 13:59698561-59698583 ATTTTAAAAAGATAGATGAAAGG - Intronic
1109369459 13:61402788-61402810 ATATGATCCAGGAAGCTGAAAGG + Intergenic
1109584806 13:64385924-64385946 ATTTGAAAAATGAAAAAGAAAGG + Intergenic
1109585246 13:64392940-64392962 ATTAGAAACAGAAAGTAGAATGG - Intergenic
1109701920 13:66036954-66036976 ATTTGAAACAAGTAGTTAAATGG - Intergenic
1109714833 13:66207657-66207679 AGTTGAAATAGCAAGAAGAAGGG - Intergenic
1109779114 13:67084287-67084309 ATTTAGAACAGAAAGAAGAATGG - Intronic
1110427931 13:75390571-75390593 AGTTAAAACACAAAGATGAAAGG + Intronic
1110673006 13:78204717-78204739 ATTTCAAATAGGAAAATAAAAGG + Intergenic
1110966359 13:81702951-81702973 TTTTCAATCATGAAGATGAAAGG + Intergenic
1110978083 13:81866027-81866049 ATATGAAACAAGAAAATAAATGG + Intergenic
1111552693 13:89836306-89836328 AGTTGAAAGAGGAAGAACAAAGG + Intergenic
1111847960 13:93535201-93535223 ATTTGAGAAAGGAATATGAGTGG + Intronic
1112081077 13:95971308-95971330 AATGCAAAGAGGAAGATGAATGG - Intronic
1112246648 13:97741279-97741301 ATTTTACACAGAAAGATGTAGGG - Intergenic
1112703500 13:102039232-102039254 TCTTGAAACAGGAGAATGAATGG - Intronic
1113107782 13:106790059-106790081 TTGTGAAACAGGAAGATGAATGG + Intergenic
1113309685 13:109118871-109118893 ATTTGAGACAGTAACATGAGTGG - Intronic
1113615474 13:111677410-111677432 TGGTGAAGCAGGAAGATGAAAGG - Intergenic
1113620942 13:111762316-111762338 TGGTGAAGCAGGAAGATGAAAGG - Intergenic
1113658695 13:112088495-112088517 ATTTGAAATAGGGAAAGGAAAGG + Intergenic
1114189068 14:20427478-20427500 ATTTGAAACAGAAAGAAGTGGGG - Intergenic
1114343741 14:21773080-21773102 ATTTTAAGCAGGGAGATGATAGG - Intergenic
1114363083 14:21997667-21997689 ATTTCAATAAGGAAGAAGAATGG + Intergenic
1114747367 14:25164214-25164236 ATGGCAAACAGGCAGATGAAAGG - Intergenic
1115268936 14:31530063-31530085 ATCTGTAACAGGAAGGTGAGGGG - Intronic
1115467827 14:33735459-33735481 CCTTGAGACAGGAAGATGACTGG - Intronic
1116623388 14:47235793-47235815 ATGGGAAACAGGAACAGGAAGGG - Intronic
1116704149 14:48275332-48275354 ATTTGAACCATGAAGACCAATGG + Intergenic
1116953265 14:50897871-50897893 ATTTGTAACAGAAAGAGGGACGG - Intronic
1117014615 14:51505903-51505925 AGTAGAAACAGGGAGATGAAGGG - Intronic
1117114226 14:52493274-52493296 ATTTGAAACTAGAAGCTGATTGG - Intronic
1119929249 14:78528812-78528834 ATTTAAAACACAAAAATGAATGG - Intronic
1120741938 14:88118167-88118189 TTCTGAAACTGGAAAATGAATGG - Intergenic
1121022225 14:90587259-90587281 ACTTGAAGCAGGAGCATGAAAGG - Intronic
1123794553 15:23758356-23758378 ACTTGGAACAGGAATTTGAAAGG + Intergenic
1124959729 15:34385436-34385458 ATGAGAAACAGAAAGCTGAAAGG - Exonic
1124976355 15:34531657-34531679 ATGAGAAACAGAAAGCTGAAAGG - Exonic
1126006358 15:44261762-44261784 AAATGAAATATGAAGATGAATGG + Intergenic
1126264315 15:46734772-46734794 AGTTGAAAGATGAAGATGAAGGG + Intergenic
1127269127 15:57385192-57385214 ATGTTAAACAGGAAAATGGATGG - Intronic
1127476892 15:59343005-59343027 ATCTCAAATAGAAAGATGAAAGG - Intronic
1127665519 15:61142312-61142334 AAATGGAAAAGGAAGATGAAGGG - Intronic
1128989332 15:72245703-72245725 CTTTGAGAGAGGGAGATGAAAGG + Intronic
1129547727 15:76416009-76416031 ATTTGCAATATTAAGATGAAGGG + Intronic
1129925964 15:79364633-79364655 AGATGAAACACGCAGATGAATGG + Intronic
1130140513 15:81222198-81222220 ATCTGACACTGGAGGATGAAGGG + Intronic
1130163651 15:81428488-81428510 GTTTGAAACAAGCACATGAAGGG - Intergenic
1130630985 15:85568983-85569005 ATTTGAAATAAGGAGCTGAATGG + Intronic
1131491896 15:92870298-92870320 AAGGCAAACAGGAAGATGAATGG + Intergenic
1131945999 15:97622566-97622588 ATTTTAATCAGTAAGATTAAGGG - Intergenic
1132290399 15:100697012-100697034 ATTTGTAGCAGGAAGATAGAGGG + Intergenic
1133598870 16:7319728-7319750 ATGTGAAGCAGGCAGAGGAAAGG + Intronic
1134040415 16:11064124-11064146 ATTTTAAATAGACAGATGAAAGG - Intronic
1134413210 16:14020719-14020741 ATTGGCAACAGGAAGGAGAATGG - Intergenic
1134561858 16:15217684-15217706 AATGGAAACAGGGAGATAAAGGG - Intergenic
1134922397 16:18129308-18129330 AATGGAAACAGGGAGATAAAGGG - Intergenic
1135720201 16:24810763-24810785 ATTTTAAACATGAAAATGATGGG + Intronic
1136474682 16:30505368-30505390 ATCTGAAACACCAAGAAGAAAGG - Exonic
1138226673 16:55301949-55301971 ATTTAAAAAAGGAAGAAGACGGG - Intergenic
1139180729 16:64745310-64745332 TTTTCAAATAGGAAGATGGAGGG - Intergenic
1140381050 16:74488237-74488259 ATTTGAAAAAGAAAGAAAAAAGG + Intronic
1140857626 16:78991740-78991762 AGATGAAACAGGAAGGTGAGGGG + Intronic
1141292456 16:82732530-82732552 ATTTGAAACAGGAAGATGAATGG + Intronic
1141307269 16:82877158-82877180 ATTTAAGATAGGAAGATGATTGG + Intronic
1141391267 16:83666685-83666707 ATCTGAAAGAGGAAGAGCAAAGG - Intronic
1141880247 16:86853468-86853490 ATTAGAGACAGGAAGAGGCATGG + Intergenic
1143442410 17:6985665-6985687 ATTTAAAACACCAAAATGAATGG - Intronic
1143797981 17:9353298-9353320 ATCTGGGACAGGAAGATAAAAGG - Intronic
1145281743 17:21473043-21473065 ATCTGCAAGAGGAACATGAATGG - Intergenic
1146075306 17:29723212-29723234 ATTTGGAATTGGAAAATGAAGGG - Intronic
1146618064 17:34372442-34372464 ATTTGCAACAGGCAGTTGACTGG - Intergenic
1147342111 17:39759047-39759069 ATTTGAAATAGGAATGTTAATGG - Intergenic
1147706802 17:42431193-42431215 ATTTAAAAAAAGAAAATGAAAGG - Intergenic
1149119484 17:53144790-53144812 ATTTGAAACAAGTAAAAGAATGG - Intergenic
1149332188 17:55595542-55595564 CTTAGAAACAGAAAGTTGAATGG - Intergenic
1150834508 17:68552346-68552368 AGTTGAAACACAAAGAGGAAAGG - Intronic
1152844573 17:82591799-82591821 TTTGGAAACAGGAAGCAGAAGGG - Intronic
1152971551 18:166776-166798 CTTTGAAACAGGATGATGATTGG + Exonic
1153389301 18:4535615-4535637 ATGTTAAGCAGCAAGATGAATGG + Intergenic
1153588038 18:6644259-6644281 ATTTGAAAAAGAAACAAGAAGGG + Intergenic
1153664129 18:7352656-7352678 ATTAGAAACAGGCAATTGAAAGG - Intergenic
1153749881 18:8218471-8218493 AATTGAATAAGCAAGATGAATGG + Intronic
1154089907 18:11348280-11348302 ATTTTAAAAAGGAAAGTGAAAGG + Intergenic
1154107534 18:11535507-11535529 ATTTGCAACAGGAAAAGGAAGGG + Intergenic
1154466291 18:14644928-14644950 CTTTGCAACAGGAAAAGGAAGGG + Intergenic
1154937406 18:21075314-21075336 AATTGAAAGAGGAACAGGAAGGG + Intronic
1155600840 18:27545324-27545346 ATTGGCAACTTGAAGATGAATGG + Intergenic
1155827839 18:30470714-30470736 ATTTGAGATCAGAAGATGAATGG - Intergenic
1155882500 18:31167072-31167094 ATTTGAAACAGTAAGTTTAGTGG - Intergenic
1155952642 18:31930076-31930098 ATTTGAAACAGGCATATGTTAGG - Intronic
1156691946 18:39718748-39718770 ATCTAAAGGAGGAAGATGAAAGG - Intergenic
1159238051 18:65703184-65703206 ATTGGATACATGAAGAGGAAAGG + Intergenic
1159259331 18:65991532-65991554 TATTGAAACAAGAAGCTGAAAGG - Intergenic
1164892956 19:31840460-31840482 ATTTGAGACAGGAATATTTAGGG - Intergenic
1165723033 19:38093170-38093192 ATTTTTAACAGGAAGGTCAAGGG + Intronic
1167448291 19:49552143-49552165 ATTAAAAACAGGAAGATGGCTGG - Intergenic
926489660 2:13508192-13508214 TTTGGAAACTGTAAGATGAATGG - Intergenic
926927650 2:18003874-18003896 ATCCGAAACAAGCAGATGAAGGG - Intronic
927421680 2:22939879-22939901 ATCTGAAACAGAAATATCAAAGG + Intergenic
928254917 2:29713895-29713917 TTTTTAAACAGGACGATGAAAGG - Intronic
928826650 2:35429646-35429668 ATCTGAGACAGGAATATGTAGGG + Intergenic
928993115 2:37256523-37256545 AGTTGAATTTGGAAGATGAATGG + Intronic
929433538 2:41908951-41908973 TTTTGAAAGAGGAAGAGGGAAGG + Intergenic
929629783 2:43447538-43447560 ATTTGTGACAGGCAGATTAATGG - Intronic
929799683 2:45088943-45088965 ATTTGCCACAGGAAGATCATGGG - Intergenic
930246613 2:48990093-48990115 TTTTGAAAAAGGAAGAGAAAAGG - Intronic
931517926 2:63061067-63061089 ATTTTAAACATGAAAATGCATGG - Intergenic
931694057 2:64859192-64859214 AGATGAAACAGGCAGCTGAAAGG + Intergenic
932071849 2:68628565-68628587 AATGCAGACAGGAAGATGAATGG - Intronic
932311114 2:70742101-70742123 ATTTGAATTAGGAATATTAAAGG - Intronic
932549327 2:72751650-72751672 ATTTGAAACAAGAAATGGAAAGG + Intronic
932658755 2:73633880-73633902 ACTTGAACCAGGAAGGTGGAGGG - Intergenic
932936276 2:76106437-76106459 ACTGGACTCAGGAAGATGAAAGG - Intergenic
933176445 2:79179133-79179155 TTTTGAAACTGGAGGAAGAAGGG + Intergenic
933827042 2:86171790-86171812 GTTTTAAACAAAAAGATGAAAGG + Intronic
934060338 2:88286428-88286450 CATTGAAACAGAAGGATGAAAGG - Intergenic
934626888 2:95866722-95866744 TTTAAAAACAGGAATATGAAGGG + Intronic
934806671 2:97234568-97234590 TTTAAAAACAGGAATATGAAGGG - Intronic
934830839 2:97522607-97522629 TTTAAAAACAGGAATATGAAGGG + Intronic
935324243 2:101921555-101921577 ATTTGACACAGGAATATTTATGG + Intergenic
936044349 2:109174629-109174651 ATAAGGAACAGGAAGATAAATGG + Intronic
936169700 2:110158110-110158132 ATCAGTAACAGGAAGATAAATGG - Intronic
937005404 2:118507977-118507999 ATTGGAAAAATGAATATGAATGG - Intergenic
938115215 2:128597823-128597845 TTTTCAAAAAGGAAGTTGAAAGG + Intergenic
938573629 2:132584646-132584668 ATTTCCAAAGGGAAGATGAAAGG + Intronic
938802753 2:134778086-134778108 ATTTGAAAAGGGAAGAGGAAAGG + Intergenic
938846121 2:135210944-135210966 GCTTGAACCAGGAAGATGGAGGG + Intronic
939202705 2:139058531-139058553 ATTTGAAACATGAAAATAGAAGG - Intergenic
939241855 2:139571840-139571862 TCTGAAAACAGGAAGATGAAGGG + Intergenic
939245272 2:139615575-139615597 TTTTGAAATGGGAAGATGAGTGG + Intergenic
939362888 2:141196760-141196782 GTTTGGAACAGGAAGATGGTAGG - Intronic
939824849 2:147001608-147001630 CTTTGAAACAGCTACATGAAAGG - Intergenic
940296816 2:152134978-152135000 ATCTGAAACAGGAAGCTTAGTGG + Intronic
940534489 2:154923013-154923035 AATTAAAAAGGGAAGATGAATGG + Intergenic
940570891 2:155431541-155431563 ATTTTATACTTGAAGATGAAAGG + Intergenic
940571456 2:155440728-155440750 TTTTGAAAACAGAAGATGAATGG + Intergenic
940624795 2:156160220-156160242 ATCTGGAAGAGGATGATGAAGGG + Intergenic
940827567 2:158430101-158430123 AAATGGAACAGGAAGATAAAAGG + Intronic
940944700 2:159602273-159602295 GTAAGAAACAGGAAGAGGAAAGG + Intronic
941283019 2:163576479-163576501 CTTTGAAAAAGTAAGATCAATGG + Intergenic
941343698 2:164339909-164339931 ATGTGGAAAAGGAAAATGAAGGG + Intergenic
941637280 2:167948503-167948525 ATTTGGTACAGAATGATGAAAGG - Intergenic
941802351 2:169673979-169674001 AATTGAGACAGGAAGGGGAAGGG - Intronic
942275705 2:174321676-174321698 ATGAGAAAAAGGAAGAAGAAAGG - Intergenic
942800116 2:179864994-179865016 AAATAAAAAAGGAAGATGAAAGG - Intergenic
943122360 2:183752541-183752563 ATTTAAAACAGGCAGATGGTAGG - Intergenic
943560344 2:189454068-189454090 ATATGATACAGTAAGATGAAAGG + Intronic
943966490 2:194340681-194340703 GTTTGAATAAAGAAGATGAAAGG - Intergenic
944009937 2:194962970-194962992 ATTGGGAAAAGTAAGATGAAGGG - Intergenic
944130135 2:196338699-196338721 ATTTGAAGCATAAAGATGGATGG + Intronic
944411807 2:199452596-199452618 TTTTGAAAAAGGATGATTAATGG - Intronic
944427846 2:199602382-199602404 TCCTGAAACAGGAAGCTGAATGG - Intergenic
944556080 2:200889123-200889145 GTTTGAGATAGGAAGATGAGGGG - Exonic
944649332 2:201813397-201813419 ATTTGAAATAAGATGATGATAGG + Intronic
945063625 2:205929734-205929756 ATTTGAAACGGGAAGGCGATAGG - Intergenic
946873494 2:224106129-224106151 ATTTGAAAGAGGAAGGAAAATGG - Intergenic
947155730 2:227161437-227161459 ATGTAAAACAGCAAGAGGAAAGG - Intronic
948900683 2:240955555-240955577 ATTTTAGACAGGCAGAGGAAGGG + Intronic
1169406900 20:5329253-5329275 ACTTGAACCTGGAAGATGGAGGG - Intergenic
1169418131 20:5434757-5434779 ACTTAAAGCAGGAAGATGAAAGG - Intergenic
1169608304 20:7349096-7349118 ATATCAAAGAGGCAGATGAATGG + Intergenic
1170059873 20:12247716-12247738 ATATAAAAAAGGAAGTTGAATGG - Intergenic
1170783439 20:19447591-19447613 AATAGAAACAGGAAGATGGCAGG + Intronic
1170912195 20:20583948-20583970 ATTAGAAACAGCAAGAGTAAGGG - Intronic
1172177566 20:32981582-32981604 TTTTGAAACAGGAAGAAAGAGGG + Intergenic
1173459250 20:43229722-43229744 ATTGGAAAAAGCAAAATGAAAGG + Intergenic
1173472567 20:43335165-43335187 ATTTGGAACTGAAAGAAGAATGG + Intergenic
1173518744 20:43683520-43683542 ATGAGAAAGAGGGAGATGAAGGG + Intronic
1173950030 20:46984789-46984811 TTTTAAAAAATGAAGATGAATGG + Intronic
1174391439 20:50220636-50220658 ATTTGACACAGGAGGATCCAAGG - Intergenic
1175677436 20:60958870-60958892 ATTCGAGACAGGAAGAAGGAAGG + Intergenic
1175717894 20:61267600-61267622 ATTTGATAGAGGAAGATAATGGG - Intronic
1176808299 21:13513674-13513696 CTTTGCAACAGGAAAAGGAAGGG - Intergenic
1176903320 21:14469763-14469785 ATTTAAATCAGGAAGATTTAAGG + Intergenic
1177006656 21:15681142-15681164 ATTTGAACCAGGAATAAAAATGG - Intergenic
1177625070 21:23648479-23648501 ATTTGAAACTACAAAATGAAAGG - Intergenic
1177859180 21:26432968-26432990 ATTTAATAAATGAAGATGAATGG + Intergenic
1177929897 21:27267715-27267737 AATTGAGACAGGAAGAAGACAGG - Intergenic
1178156832 21:29863953-29863975 TATTGGAACAGGAGGATGAAGGG - Intronic
1178248671 21:30979390-30979412 ATTTCAAAAATGAAAATGAAAGG - Intergenic
1178360821 21:31947507-31947529 ATTTAAAACAGGAAAAGGACAGG - Intronic
1178368951 21:32011202-32011224 ACCAGAAACAGGAAGATGCAAGG - Intronic
1178474505 21:32925444-32925466 TTTTAAAAGAGGAAGATGTATGG + Intergenic
1178750485 21:35297891-35297913 ATGTGAAAGAGAAAGAGGAAGGG - Intronic
1180235262 21:46455312-46455334 ATTAGACATAGGATGATGAAAGG - Intergenic
1181734184 22:24868921-24868943 GTTTGAAACTAGAAGATGACAGG + Intronic
1182014182 22:27025398-27025420 AGTTGAAACGGAAAGAGGAAAGG + Intergenic
1182686632 22:32125411-32125433 CTTTGCAACAGGAAAAGGAAGGG + Intergenic
1182772330 22:32804491-32804513 TTTTAAAACAGGAAGTTGATGGG - Intronic
1183733926 22:39633129-39633151 ATTGGAGAGAGGAAGATGGAAGG - Intronic
1184621338 22:45680869-45680891 ATTTAGATCAAGAAGATGAATGG - Intronic
1184852674 22:47129639-47129661 GTTTGAAACTGAAAGATGAGAGG + Intronic
950783839 3:15415909-15415931 ATATGATACAGAAAGATGCAAGG - Exonic
950903071 3:16514023-16514045 ATTTGAGCCAGGATGCTGAAAGG + Intronic
950943430 3:16918227-16918249 ATTTAAACCAGGAAGACAAAAGG + Intronic
951429995 3:22595717-22595739 ATATGAAAAAAGAAGATGATTGG + Intergenic
955114733 3:55986429-55986451 ATTTGAACCAGTAAGTTGGATGG + Intronic
955418906 3:58717859-58717881 AGTTGCATTAGGAAGATGAAGGG + Intronic
955465097 3:59229364-59229386 ATTTAAAACAAGAAGTTTAATGG + Intergenic
955666642 3:61356025-61356047 AGTGGAAACAGGCAGATGATGGG + Intergenic
955870362 3:63432206-63432228 AATTGAGACAGGGAAATGAAGGG - Intronic
956012401 3:64845471-64845493 ATTGGAAACAGGATGATGGCTGG - Intergenic
956289480 3:67646510-67646532 ACTTGAACCTGGAAGATGGAGGG + Intronic
956686405 3:71832603-71832625 ATTTCAGACAGAAGGATGAAGGG + Intergenic
956900134 3:73707050-73707072 ATCTGAGACAGCAAGATGGAAGG + Intergenic
957219438 3:77363030-77363052 ATATCAAACAGGTAGAGGAAAGG + Intronic
957766206 3:84628363-84628385 TTTTAAAAGAGAAAGATGAAAGG + Intergenic
957884235 3:86263432-86263454 ACTTTATACAGGTAGATGAAAGG - Intergenic
959830322 3:110853899-110853921 ACATGAATCTGGAAGATGAAAGG - Intergenic
959847266 3:111048425-111048447 ATTTGGTGCAGGAAGTTGAAGGG - Intergenic
960199838 3:114818840-114818862 ATATTAAACAGGAATAAGAAAGG + Intronic
960237071 3:115295900-115295922 ATTTGACACAGACAGATGAGGGG + Intergenic
961671560 3:128535735-128535757 GATTGTAAGAGGAAGATGAATGG + Intergenic
961937507 3:130600880-130600902 ATTTAAAACAGGAAAAAAAAAGG + Intronic
963753666 3:149210514-149210536 TTTGGACACAGGAAAATGAAAGG + Intronic
963797099 3:149641892-149641914 ATTTGAAGTATGAAGATGACAGG - Intronic
964599474 3:158480983-158481005 TTTTCAAACAAGAACATGAAAGG + Intronic
964762010 3:160143143-160143165 ATTTCAAACAGGGCAATGAAAGG + Intergenic
965365390 3:167792535-167792557 ATGTTAAACTGGAAGATCAAGGG - Intronic
966324979 3:178743805-178743827 ATTTGATGCAGGAGGATCAAGGG + Intronic
967201293 3:187074689-187074711 ATTTGGCAGAGGAAGATGGAGGG + Intronic
967745584 3:193051474-193051496 AATGGAAAGAGGAAGAGGAATGG - Intergenic
969995589 4:11309132-11309154 ATTTGAAACAGGAAAATCGAAGG - Intergenic
970969983 4:21971084-21971106 ATTTGTGACAGGAACATGACTGG + Intergenic
971148340 4:24004292-24004314 TTTTGAAACAGGAGGATGTTTGG - Intergenic
971580396 4:28331462-28331484 ATTAGAAAAGGTAAGATGAATGG + Intergenic
971706536 4:30050425-30050447 ACTTGAATGGGGAAGATGAAAGG + Intergenic
971723942 4:30283822-30283844 ATTTCAAACAGGAAGATGACTGG + Intergenic
971729990 4:30365787-30365809 ATTGGAAACACGAAGATTATCGG + Intergenic
972138677 4:35927431-35927453 ATTTGAAACTGGAATCAGAATGG + Intergenic
972158035 4:36189110-36189132 CTGTGATTCAGGAAGATGAATGG + Intronic
972306589 4:37836444-37836466 ATTTAAAATTGGAAGATTAAAGG - Intronic
972839945 4:42918836-42918858 TTTCCAAACAGGAAGATCAAAGG - Intronic
974243133 4:59278404-59278426 AATTTAACCAAGAAGATGAAAGG + Intergenic
974478210 4:62410358-62410380 ATTGGAGACAGGAAAGTGAAGGG - Intergenic
974489746 4:62549496-62549518 ATTTGAAACTGTTAGAGGAAAGG + Intergenic
974593897 4:63992511-63992533 AATAGAAACAGAAATATGAAGGG - Intergenic
974918917 4:68212606-68212628 ATTTTAAAAAGGAGGAAGAAAGG + Intergenic
974984968 4:69012111-69012133 ATCTGAAGCAGGAAGATGAAAGG - Intronic
974992057 4:69105059-69105081 GTCTGAAGCAGGAAGATGAAAGG + Intronic
976239263 4:82936294-82936316 ATTTGGAACATGAAAATGAAAGG - Exonic
976471860 4:85437898-85437920 ATTTGTAACAGGAAGAACCATGG + Intergenic
976522547 4:86045857-86045879 TTTTCAAACAGGAACATGAAGGG - Intronic
976935668 4:90629187-90629209 AATTGAATCAGGAAGAAAAAAGG + Intronic
976947197 4:90784967-90784989 AGGAGGAACAGGAAGATGAAGGG + Intronic
977137916 4:93329132-93329154 AGTTGAAACTAGAAGATAAAGGG + Intronic
977306128 4:95325539-95325561 ATCTGAAACAGGAATACAAAAGG + Intronic
977889110 4:102287145-102287167 ACTTGAAAAAGGAACATAAATGG - Intronic
978865232 4:113499658-113499680 ATTTGAAACAGAAATATTAAAGG - Intronic
979248582 4:118538266-118538288 ACTTGAAACATGAATATAAATGG + Intergenic
979416014 4:120439697-120439719 ATTTGAAACAGAAACATGAGAGG + Intergenic
979447803 4:120835408-120835430 ATTTGAAAGAGGTAGAATAAAGG + Intronic
979527031 4:121728265-121728287 ACTTGGAACAGAAAGATGATGGG - Intergenic
979674175 4:123393230-123393252 TTTTGAAACAAGAAGTGGAATGG - Intergenic
980434705 4:132755209-132755231 AATAGAAACAGCAAAATGAATGG - Intergenic
980460969 4:133112736-133112758 ATTTAAAAGTGGAATATGAAAGG + Intergenic
983697511 4:170549998-170550020 ATTTAAAGGAGAAAGATGAAAGG + Intergenic
983998840 4:174216895-174216917 ATTTGAGGCAGGACGATGGATGG + Intergenic
984102375 4:175500422-175500444 ACTTGAAGCAGGAAGGTAAATGG - Intergenic
984640099 4:182154866-182154888 ATTTTAAAAAAGAAAATGAAAGG + Intronic
985142974 4:186862189-186862211 ATATGGAACAGCAAAATGAAAGG + Intergenic
985658846 5:1145580-1145602 ATTTGAAACAGGAAGGTCCCTGG + Intergenic
986383573 5:7209163-7209185 ATCTGGAACAGGAAGCTGAGGGG - Intergenic
986574056 5:9194335-9194357 ATTGGATTCAGGAAGAAGAATGG - Intronic
986804976 5:11300837-11300859 TTTGGAAACAGGAAGTAGAAAGG + Intronic
988162583 5:27540163-27540185 ATTTAAAAAAGAAACATGAAGGG - Intergenic
988422775 5:31026527-31026549 AATTGAATCAGGTAGTTGAATGG + Intergenic
988976770 5:36523857-36523879 AAGGGAAACATGAAGATGAAGGG - Intergenic
989600239 5:43193467-43193489 TTTTGAAACGGGATGAGGAATGG - Exonic
989960109 5:50402960-50402982 AATTGAAACAGGAAGACCATGGG + Intronic
990140337 5:52695749-52695771 ATTAGAAACAAGAAGATTAATGG - Intergenic
990250790 5:53912966-53912988 AGATGAAGCAGGAAGATGCATGG + Intronic
991037254 5:62140293-62140315 ATTTGCAAAAGGCAGATGTATGG + Intergenic
991256873 5:64623722-64623744 ACTTTAAACAGGAAGTTTAAAGG - Intergenic
991345654 5:65664057-65664079 GATAGAACCAGGAAGATGAAAGG - Intronic
991424376 5:66475609-66475631 AGCTGAAACCGGAAAATGAATGG + Intergenic
992192538 5:74307706-74307728 CTAAGAAAAAGGAAGATGAATGG - Intergenic
992213162 5:74500735-74500757 ATTTGAAAATGGAACATGATAGG + Intergenic
992315365 5:75547197-75547219 CTTTGAAACAGAAAGTTAAAAGG - Intronic
992497149 5:77305295-77305317 ATTGGAAGCAGGAAGGAGAAGGG + Intronic
993120078 5:83764460-83764482 ACTTGATGGAGGAAGATGAAAGG - Intergenic
993481894 5:88434137-88434159 ATTCGAGACAGGCAGAAGAAGGG + Intergenic
993930759 5:93935919-93935941 AATTCAAACAGGAAAATCAAGGG + Intronic
993957832 5:94258213-94258235 ATTCAAAAGAGGAAGAGGAAGGG + Intronic
994934877 5:106241847-106241869 ATTTCAAACAAGAGGATGGAGGG + Intergenic
994981930 5:106886284-106886306 AGTTGAAGCAGGAAAAAGAATGG + Intergenic
995035010 5:107523711-107523733 ATTTCAAAAAGGAAAGTGAAGGG - Intronic
995359257 5:111275985-111276007 ATTTGATACAAGAAGATGGTGGG - Intronic
995504478 5:112845437-112845459 AGTTGCAACAAGAAGATGAAGGG - Exonic
995739319 5:115338293-115338315 ACTTGAAAGAGTAAGAAGAAGGG - Intergenic
996597281 5:125219882-125219904 CTTAGAAACAGAAAGTTGAATGG + Intergenic
996618175 5:125467185-125467207 ATGTGAAACACAAAGAAGAAGGG - Intergenic
996656546 5:125944034-125944056 ATATGAAGCAGAAAAATGAAAGG - Intergenic
996723986 5:126657820-126657842 CTTTTTAACAGAAAGATGAAGGG - Intergenic
996957141 5:129197011-129197033 ATTTTAAATAGAGAGATGAAGGG - Intergenic
997996403 5:138590244-138590266 GTGAGAATCAGGAAGATGAAGGG + Intergenic
998155026 5:139781062-139781084 TTTGGAGACTGGAAGATGAAAGG - Intergenic
998504275 5:142659544-142659566 CTTTGAAGCAGAATGATGAAAGG + Intronic
998722221 5:144966117-144966139 GTTTCCAACATGAAGATGAAAGG - Intergenic
999648736 5:153745101-153745123 AGTGGAAACAGGAAGAGCAAAGG - Intronic
999853885 5:155572189-155572211 ATTTGAAACAGGAAGTATTAAGG - Intergenic
999957093 5:156714311-156714333 ATTTTAAACAGCAAAATCAAAGG - Intronic
1000179356 5:158792835-158792857 ATATACAACTGGAAGATGAAGGG + Intronic
1000543055 5:162565383-162565405 ATTGCAAAAGGGAAGATGAATGG - Intergenic
1000790988 5:165607051-165607073 ATTTGAAGGAGGAAGGTGAGAGG - Intergenic
1000890915 5:166800789-166800811 ATTTTAAACAGGAACATGTTAGG + Intergenic
1001069039 5:168568130-168568152 ATTTGACACAGGAACATGGCAGG + Intronic
1001322613 5:170695228-170695250 CTTTGAAACAGACAGATGAGGGG - Intronic
1001626051 5:173133445-173133467 ATTTTAGACAGTAATATGAAGGG + Intronic
1002611404 5:180420835-180420857 ACTTGAAACAGGAGGAATAAAGG + Intergenic
1002802960 6:543800-543822 TTTTGAAGGAGGAAGATGACTGG + Intronic
1003179162 6:3777394-3777416 ATAGGGAACAGGAAGATGCAGGG + Intergenic
1003510025 6:6771847-6771869 TTTTGAAACAGAAAGTTGAAAGG + Intergenic
1004753372 6:18586098-18586120 CTTTGAAAGAGGAAGATCCAAGG - Intergenic
1004908780 6:20261721-20261743 CTTTGAAAAAGGAAAAAGAATGG - Intergenic
1005929248 6:30469744-30469766 ACTGGACCCAGGAAGATGAAAGG + Intergenic
1005992470 6:30911947-30911969 ATTTCAGGCAGGAAGATGTAAGG + Intronic
1007127045 6:39434072-39434094 ATTTGAAAGAGAAAGAGCAAAGG + Intronic
1007674986 6:43585966-43585988 ATTTGAACTAGGAAGAGGATAGG - Intronic
1007922341 6:45621662-45621684 ATTTGCAACAGGCATCTGAAAGG + Intronic
1008132435 6:47734052-47734074 ATTAGAAACTGGAAAAGGAAAGG + Intergenic
1008421757 6:51309078-51309100 ACATGAAACAGGAAGAAAAAGGG - Intergenic
1008437483 6:51493590-51493612 ATCTGAAACATGAAGAACAATGG + Intergenic
1008760676 6:54848156-54848178 ATGTGAAACAGAATGATGGAAGG + Intronic
1008840105 6:55892794-55892816 AACTAAAACAGAAAGATGAAAGG - Intergenic
1009376354 6:62975298-62975320 ATGTGAAACAGGGAGAAGACAGG + Intergenic
1009441858 6:63689110-63689132 GTTTGAATCAGGAAAATAAAAGG - Intronic
1009451759 6:63809548-63809570 ATTGGAAACATGAAGAAAAAAGG + Intronic
1009753822 6:67909026-67909048 CTTTAAAACAGGAAGGAGAAAGG - Intergenic
1010784641 6:79986041-79986063 AGATGCAACAGTAAGATGAAGGG + Intergenic
1011050979 6:83149441-83149463 TTGTGAAACAGGAAGGGGAAGGG + Intronic
1013108069 6:107042944-107042966 ATCTGAAACAGGGAGACCAAAGG - Intronic
1013455722 6:110327873-110327895 ATTTGAAACACGTGGATGATAGG - Intronic
1013572386 6:111442000-111442022 AGGTGAAACAGGAAGAATAAAGG + Intronic
1014497019 6:122137861-122137883 ATTTTAAACAAAAAGATAAATGG - Intergenic
1014763089 6:125379453-125379475 ATCAGATTCAGGAAGATGAAAGG - Intergenic
1014834066 6:126139067-126139089 AATTGAACCAGGAAAATAAAAGG - Intergenic
1015018159 6:128439195-128439217 ATGTGAAGCAGGAAGGGGAAGGG - Intronic
1015098391 6:129445694-129445716 ATTTAGAACAGGAAGCTGACCGG + Exonic
1016159215 6:140856434-140856456 TTTTAAAACAAGAACATGAAGGG - Intergenic
1016220190 6:141659130-141659152 ATTTGAGACAGAAAGAAAAAGGG + Intergenic
1016409971 6:143772567-143772589 ATTTGAGAAAGGAGGATGAGGGG - Intronic
1016486489 6:144545445-144545467 ATTTGAAACAGAATGAACAAAGG - Intronic
1016551091 6:145281227-145281249 ATTTGAAAAAGGAAAATTTAGGG - Intergenic
1017067177 6:150539834-150539856 ATTTTGCACAGGGAGATGAATGG + Intergenic
1018276715 6:162140202-162140224 ATTTTAAACAGGAAACTAAAAGG - Intronic
1018715055 6:166525669-166525691 TTTTGAAAAAGAAAAATGAAAGG - Intronic
1018786358 6:167111077-167111099 ATTTGAAAAAGGAAGGAGAGGGG + Intergenic
1020195199 7:6032674-6032696 ATTTAAAACAGGTAGTAGAAAGG + Intronic
1020373336 7:7458331-7458353 ATTTGAACCGGGGAGGTGAATGG + Intronic
1020421241 7:8007759-8007781 AGTTGAAACAGAAATATAAAAGG - Intronic
1020610683 7:10393413-10393435 ATTTAAAATAAAAAGATGAAAGG - Intergenic
1021534105 7:21683246-21683268 ATTTTTAACTGGAAGATGAATGG + Intronic
1022452998 7:30533375-30533397 AGCTGAAACAAGAAGACGAAGGG - Intronic
1023001238 7:35810059-35810081 ATTTGAAACATGAAATTGAGAGG + Intronic
1023229418 7:38009935-38009957 ATTAGAGACAAGAAGAGGAAGGG + Intronic
1023242929 7:38168223-38168245 AATTGAAACAGAAAGTAGAATGG + Intergenic
1023337755 7:39187684-39187706 ATTAGAAAGATGAACATGAATGG + Intronic
1023339923 7:39209436-39209458 ATTTCAAAGAGGAAGACAAAGGG - Intronic
1023391583 7:39716205-39716227 AATAGCAAGAGGAAGATGAAGGG + Intergenic
1023645763 7:42313183-42313205 ATATCAAAAAGGAAGATAAAAGG - Intergenic
1024356571 7:48419334-48419356 ATTTCCAAAAGGAATATGAATGG - Intronic
1024359226 7:48450765-48450787 TTTTGAAAAATGAACATGAAAGG - Intronic
1024632844 7:51263353-51263375 GTTTTAAGCAGGAAGATAAATGG + Intronic
1024895805 7:54260291-54260313 ATATGAAACGGGACGATCAAAGG - Intergenic
1026244701 7:68608812-68608834 ATATAAAACAGGAAGATCCAGGG - Intergenic
1027455039 7:78379704-78379726 ATTGGAAAGAGAAAGATGGATGG - Intronic
1027591076 7:80119932-80119954 ATTTTTAACAGGAAGGGGAATGG - Intergenic
1027694909 7:81398331-81398353 TTTTTAAAGAGGAAGAAGAAGGG - Intergenic
1027764177 7:82318842-82318864 AATAGAAAGAGGAAGAAGAAGGG + Intronic
1028530754 7:91836042-91836064 ACTTGAAACATGAATATAAAAGG - Intronic
1028651299 7:93152842-93152864 ATATTAAAGAGGAAGAGGAATGG + Intergenic
1028946528 7:96586147-96586169 ATTTTAAAAAGGAAGAAGATGGG + Intronic
1029288574 7:99484168-99484190 AGTGGAATCAGGAAGAGGAAGGG + Intronic
1029552930 7:101247572-101247594 AGGGGACACAGGAAGATGAAGGG + Intronic
1029662163 7:101969923-101969945 AATTGAAAAAGGAAGGAGAAAGG - Intronic
1030053395 7:105559851-105559873 ATTAGAAAAAGGAAAAAGAATGG + Intronic
1030094930 7:105890356-105890378 GTTTGAAACAAGGAGATCAAGGG - Intronic
1030450537 7:109704756-109704778 ATTTTAAAAAGAAATATGAAAGG - Intergenic
1030573580 7:111258330-111258352 ATTGAAAACAAGAAGATCAAGGG + Intronic
1030885909 7:114937235-114937257 TTTAGAAACAGGAAAATAAAGGG + Intronic
1030952622 7:115810643-115810665 ATTTGAAACATTAATATGTAAGG + Intergenic
1032532763 7:132635885-132635907 ACTTGAAATAGGTAAATGAATGG + Intronic
1033142143 7:138837246-138837268 ATTTCAGACATGAAGGTGAAGGG + Intronic
1033959661 7:146898957-146898979 ATTTAAAACAAGGAGATGACAGG - Intronic
1034022508 7:147660591-147660613 ATTTCAAAATGGAATATGAAGGG - Intronic
1035859969 8:3017653-3017675 ATTTGAAGAAACAAGATGAAAGG - Intronic
1036331769 8:7834908-7834930 ATTCAAAACAAAAAGATGAAGGG - Intergenic
1036987527 8:13553258-13553280 ATCTAAAACAGTAAGAAGAAAGG - Intergenic
1037064515 8:14560370-14560392 ATTTTAAAAATGAAGATTAAAGG + Intronic
1037071018 8:14649409-14649431 ATTTCAAACAGGAAGAATTAGGG - Intronic
1037674130 8:21039696-21039718 ATTTGAAAGGGAAAGATGGATGG - Intergenic
1038302003 8:26360226-26360248 ACTTGAAAGAGGAGGATGGAAGG + Exonic
1038956462 8:32473782-32473804 GGTTGAAGCAGGAAGATCAATGG - Intronic
1039321233 8:36434385-36434407 AGTTGAAAAAGGAGGAAGAAAGG + Intergenic
1039334762 8:36576719-36576741 ATTCCAAACAGGAAAATGGAGGG - Intergenic
1040845041 8:51828963-51828985 ATATAAAACAAGAAAATGAAAGG - Intronic
1041375685 8:57207819-57207841 ATTTGAGACAGGTAGTTTAATGG + Intergenic
1041376448 8:57212198-57212220 ATTTGAGACAGGTAGTTTAATGG + Intergenic
1041554675 8:59139916-59139938 CAGTGCAACAGGAAGATGAATGG + Intergenic
1041824495 8:62078492-62078514 ACTTGAAACAGAATTATGAATGG - Intergenic
1041864127 8:62549443-62549465 GTTTTAAGCAGAAAGATGAAAGG - Intronic
1042015972 8:64312036-64312058 GTTTAAAACAGGAAGATGGCAGG - Intergenic
1043170528 8:76960342-76960364 ATTTGAAACCCAAAGATGGAAGG - Intergenic
1043332208 8:79131331-79131353 AGTTGAGATAGGAAGATGAATGG - Intergenic
1043856365 8:85269807-85269829 GGCTGAGACAGGAAGATGAATGG - Intronic
1045057453 8:98381925-98381947 ATTTTAAAAAGCAAAATGAATGG - Intergenic
1045740255 8:105350049-105350071 ATTTCAAACAGTAAGATTAGTGG + Intronic
1046004671 8:108464518-108464540 ATTTCAAACAGGAGCTTGAATGG - Intronic
1046089744 8:109487471-109487493 ATTTGAAACAAGAGGATGGATGG - Intronic
1046110967 8:109723932-109723954 ATTCTAAACATGAAAATGAAAGG + Intergenic
1046590737 8:116203270-116203292 AGTTGAAACAATAAGTTGAATGG + Intergenic
1046741485 8:117833812-117833834 ATTTGAAAAAGGAAGAAAAAAGG + Intronic
1046990764 8:120450417-120450439 ACTCAAAACAGGAAGAAGAAAGG - Intronic
1047120353 8:121896476-121896498 ATTTGCCACAGGAAGTTGATAGG + Intergenic
1048070142 8:131012425-131012447 ATTTAAAAAAGGAAGATTAGTGG - Intronic
1048221779 8:132548920-132548942 ATTTGTACCATGAAGATGAAAGG + Intergenic
1048250020 8:132857473-132857495 TTCTGAAAAAGGAATATGAAAGG + Intergenic
1048519791 8:135142857-135142879 GTTTGAAAGAGGAAGATGAAGGG + Intergenic
1049045384 8:140147087-140147109 ATATGAAACTGGAAAATGAGAGG - Intronic
1049138239 8:140925712-140925734 ATTTGTAACTGGAAGATGCAAGG + Exonic
1049493910 8:142920267-142920289 AATGGAAACTGGAAGCTGAAAGG - Intergenic
1049907945 9:236235-236257 ATTGGAGACAGGAAGAAGAAAGG + Intronic
1050130969 9:2412104-2412126 ATTGGAAAAAGGAAGACAAAGGG + Intergenic
1050786541 9:9410631-9410653 CTTTGAAACAGGAAGTTTTAGGG + Intronic
1051200445 9:14614315-14614337 ATTTGAAACAGAAATAACAATGG - Exonic
1051355421 9:16235688-16235710 GCTAGAAACAGGAAGAGGAAGGG - Intronic
1051522812 9:18009217-18009239 AGAAGAAATAGGAAGATGAAGGG - Intergenic
1051969225 9:22866447-22866469 AACTGAGACAGGAAGATGAGAGG + Intergenic
1052068488 9:24052541-24052563 ATTTGAAGCAGAAAGATAGAGGG - Intergenic
1052518118 9:29509899-29509921 ATGTGAAACATGGAGTTGAAGGG - Intergenic
1053092949 9:35296477-35296499 TTATGAAACAGGAAGAAGATGGG - Intronic
1053367274 9:37532078-37532100 ATTTGTAACAGGAAAATAAATGG - Intronic
1055112918 9:72577178-72577200 AGTTCTAACAGGAAGAGGAAAGG - Intronic
1055989277 9:82088208-82088230 ATCTGAAACACGAAGCTGAGAGG - Intergenic
1056298774 9:85220813-85220835 AGTGGAAACAGGTGGATGAAGGG + Intergenic
1057482597 9:95457089-95457111 ATTTTTACAAGGAAGATGAAAGG - Intronic
1057553540 9:96069662-96069684 AATTCAGACAGGAAGCTGAAGGG - Intergenic
1058214299 9:102214722-102214744 ATTTGAAAGTAAAAGATGAAAGG + Intergenic
1058278558 9:103080863-103080885 ATTTGAATCTGAAAGATGAAGGG - Intergenic
1059520558 9:114937548-114937570 ATTTTAAACTGGAAGAGGAAGGG - Intergenic
1060248269 9:121964769-121964791 ATTTGAAATATGAAAATGAGGGG - Intronic
1060309813 9:122449237-122449259 ATTTCACACTGGAATATGAATGG + Intergenic
1185631581 X:1519342-1519364 ATTGGAATCAGAAAGATGATTGG - Intronic
1185686735 X:1935009-1935031 GTCTGAAACAGAAAGAAGAAAGG + Intergenic
1186128022 X:6436583-6436605 TCTTGAAACAAGAAGATGGATGG + Intergenic
1186536218 X:10351422-10351444 ACTTGAAGAAGGAAGCTGAAAGG - Intergenic
1187089586 X:16081461-16081483 ATTTGGAACAGTCAGATGAGAGG + Intergenic
1187438880 X:19299163-19299185 ATTAGAAACAGCAAGGAGAATGG - Intergenic
1187477197 X:19622159-19622181 ATTTGTAATATGAAGATGACAGG + Intronic
1187821606 X:23293608-23293630 GTTTTACACAGGAAGTTGAAGGG + Intergenic
1188482079 X:30646643-30646665 ATGTGAAACTGGAAGACCAAAGG + Intergenic
1188715369 X:33453838-33453860 ATTTCAAAAAGTAAGAGGAATGG + Intergenic
1188949875 X:36357962-36357984 ATACGACACAGGAAGATGACTGG - Intronic
1189020509 X:37332928-37332950 ATTTGAAAGGGGAAAATGTAGGG + Intergenic
1189212551 X:39296180-39296202 ATATGAGACAGGAAGAAAAAGGG + Intergenic
1189627929 X:42919700-42919722 AATTAAAACAAGAAGGTGAAGGG + Intergenic
1189783881 X:44542539-44542561 ATTTGAAGATGGGAGATGAAGGG + Intronic
1193092013 X:77504034-77504056 ATTGGAGACAGGAAGATAATTGG - Intergenic
1193230431 X:79038414-79038436 ACTTGAGAAAGGAAGATGAGTGG - Intergenic
1195279376 X:103316152-103316174 ATTAGAAACAGCATGATCAATGG + Intergenic
1195708220 X:107753422-107753444 ATCTGAAACAGGAAGGGGCACGG - Intronic
1195873923 X:109517999-109518021 ATATGAAACAGAAAAATGAACGG + Intergenic
1196074817 X:111564160-111564182 TTTTGAAAAAGGAAGAACAAGGG + Intergenic
1197298459 X:124749456-124749478 CTTTGAAAGATGCAGATGAAAGG - Intronic
1197552600 X:127911811-127911833 AATTTAATCAGGAAGGTGAAAGG + Intergenic
1198473534 X:136973256-136973278 ATATGGGACAGGAACATGAAAGG - Intergenic
1198513917 X:137384782-137384804 ATATGAAACTGGCATATGAAAGG + Intergenic
1198826034 X:140698878-140698900 ATTTCATATATGAAGATGAAAGG + Intergenic
1198957521 X:142148754-142148776 AGTAGAAAAAGGAAGAGGAAAGG + Intergenic
1199056608 X:143303792-143303814 ACTTGAGTCAGGAAGATGTAGGG - Intergenic
1201404808 Y:13638857-13638879 ATTTTATACAGAAAGTTGAAGGG + Intergenic
1201633076 Y:16091773-16091795 ATTCTAAAAAGTAAGATGAATGG - Intergenic
1201862535 Y:18615184-18615206 ATTTGTAATATGAAGATGCAGGG - Intergenic
1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG + Intergenic
1202334466 Y:23792527-23792549 ATATTAAACATTAAGATGAAAGG + Intergenic
1202536302 Y:25877532-25877554 ATATTAAACATTAAGATGAAAGG - Intergenic