ID: 1141296196

View in Genome Browser
Species Human (GRCh38)
Location 16:82772074-82772096
Sequence TAACCGACACCAGCACATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 58}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141296196_1141296199 -2 Left 1141296196 16:82772074-82772096 CCTTGATGTGCTGGTGTCGGTTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1141296199 16:82772095-82772117 TAGCAATGGCTTGGAAGAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 191
1141296196_1141296200 14 Left 1141296196 16:82772074-82772096 CCTTGATGTGCTGGTGTCGGTTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1141296200 16:82772111-82772133 GAGCTGGATGTTAAATTGTTAGG 0: 1
1: 0
2: 3
3: 20
4: 195
1141296196_1141296201 29 Left 1141296196 16:82772074-82772096 CCTTGATGTGCTGGTGTCGGTTA 0: 1
1: 0
2: 0
3: 5
4: 58
Right 1141296201 16:82772126-82772148 TTGTTAGGAATTTTGCAATCTGG 0: 1
1: 0
2: 5
3: 52
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141296196 Original CRISPR TAACCGACACCAGCACATCA AGG (reversed) Intronic
900765602 1:4503140-4503162 TAACAGGGCCCAGCACATCATGG + Intergenic
901632906 1:10656595-10656617 TCTCCGCCACCAGCACAGCATGG - Intronic
908627100 1:66057718-66057740 TAACTGTCACCAGAACAGCAAGG + Intronic
921193100 1:212726902-212726924 TGATGGACACCAGCACAGCACGG + Intronic
1064042498 10:11980319-11980341 TAACTGACAGCAGCAAATAATGG + Intronic
1067881952 10:50053415-50053437 TCACCCACACCTGCACCTCAGGG - Intergenic
1067887264 10:50101258-50101280 TCACCCACACCTGCACCTCAGGG + Intronic
1069884724 10:71616378-71616400 TAACCCACACCTGAACAGCAGGG - Intronic
1076690628 10:132222355-132222377 CAACCAACACCAGCACACCTGGG + Intronic
1076691837 10:132227763-132227785 TAACCAACCCCAGCATGTCATGG + Intronic
1080555493 11:33412718-33412740 AAACAGACACCAGCACATTTAGG - Intergenic
1082248679 11:49955760-49955782 TATCCTACACCAGCACACAATGG - Intergenic
1087199502 11:95331446-95331468 TCACAGACACCAGAACCTCAAGG + Intergenic
1090647663 11:128778720-128778742 TTCCCGATGCCAGCACATCAGGG - Intronic
1099382662 12:81974612-81974634 AAAAGGACACCAGCACTTCATGG - Intergenic
1100118180 12:91335172-91335194 TAACCATCACCAGAACAGCATGG + Intergenic
1101386574 12:104263420-104263442 CAACAGACACCATCACATCTAGG - Intronic
1106189173 13:27435984-27436006 TAACCGACAGCAGCAATTCAAGG - Intronic
1109927163 13:69158835-69158857 TTACCTACATCAGCACTTCAAGG - Intergenic
1111034260 13:82650336-82650358 TAACAGACACCTCCACAACAGGG - Intergenic
1113919882 13:113901276-113901298 GAACTGACACCAGCAAACCAAGG + Intergenic
1117315131 14:54566049-54566071 TAACATACACCATTACATCATGG - Intergenic
1125432300 15:39607735-39607757 GAACAGACCTCAGCACATCAAGG + Intronic
1138507412 16:57485339-57485361 TAACCAGTACCAGCACAGCAAGG + Intronic
1141281948 16:82636900-82636922 TAACTGGCTCCAGCACACCATGG + Intronic
1141296196 16:82772074-82772096 TAACCGACACCAGCACATCAAGG - Intronic
1141784592 16:86190643-86190665 TAACTGATACCAGCAGGTCAGGG - Intergenic
1145189411 17:20825745-20825767 AAACAGACACCAGCTCTTCAAGG - Intergenic
1150386828 17:64767986-64768008 TAACAGACCCCAGCACAGCCAGG + Intergenic
1151582194 17:74986714-74986736 TCAACGGCACCAGCACATTAGGG + Intergenic
1161773398 19:6243454-6243476 TGACCTACTCCAGAACATCATGG + Intronic
1167718091 19:51157196-51157218 AAAGCCACACCAGGACATCAAGG + Intergenic
926376949 2:12239937-12239959 TAACCAACACCAGGAAAGCACGG - Intergenic
929899248 2:45987011-45987033 AAACAGACATCAGCTCATCAGGG - Intronic
933828189 2:86183227-86183249 TAACTGACTCCAGGAAATCAGGG + Intronic
940634856 2:156286574-156286596 TACCCAACACCAGCACATAATGG + Intergenic
946303684 2:218843080-218843102 TAACCAACACCAACAGAACACGG + Intergenic
1182134826 22:27891618-27891640 TCACCGTCACCAGAACAACATGG - Intronic
952943890 3:38463171-38463193 AAACCCAGACCAGCACATCCTGG - Intronic
956142379 3:66158977-66158999 TGAGGGACATCAGCACATCAGGG + Intronic
956735303 3:72233379-72233401 TAACAGACACCAGCAGATGCTGG - Intergenic
961155423 3:124675728-124675750 TAATTGACATCAGCACCTCAGGG - Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
974025697 4:56731506-56731528 TAACCTACAGCAGCACATTTTGG + Intergenic
981304892 4:143236697-143236719 TAACTGATAACATCACATCAGGG + Intergenic
986360747 5:6975769-6975791 TACCCAACACCAGCTCATGAGGG + Intergenic
987255639 5:16148009-16148031 TACATGACACCAACACATCATGG + Intronic
1001940787 5:175738156-175738178 TCACCCCCAGCAGCACATCAAGG + Intergenic
1007021542 6:38526587-38526609 TACCAGACACCAGCCCATGAAGG + Intronic
1009291571 6:61889311-61889333 AAACAGACAGCAGCACCTCAAGG - Intronic
1009548789 6:65059061-65059083 TACCTGACACTAGAACATCAGGG + Intronic
1012672213 6:102068387-102068409 TAACCGACGCTGGCACTTCAGGG - Exonic
1013760131 6:113508717-113508739 TAACCAAGACCAGCCCATCATGG - Intergenic
1015503595 6:133958840-133958862 TAAACAAAACCAGCACAACATGG - Intronic
1030872462 7:114774227-114774249 TAACCTACACAAGCCCATAAAGG - Intergenic
1034129585 7:148702727-148702749 TAACCCAGACCAGGACATCAGGG - Intronic
1034530897 7:151695974-151695996 TACACGACACCAGCTCTTCAGGG + Intronic
1035957244 8:4094585-4094607 TGACCTACACAAGCACAGCACGG - Intronic
1042895995 8:73668405-73668427 AAATCTACACCAGCAGATCAAGG + Intronic
1044753798 8:95441041-95441063 GAACTGAACCCAGCACATCATGG + Intergenic
1048649102 8:136454375-136454397 CAACAAACACCATCACATCAGGG - Intergenic
1051041424 9:12816990-12817012 TAACCGATACTAGCACAGCATGG - Intronic
1055886371 9:81068866-81068888 TAACCGAAGCCAGCACAGTATGG + Intergenic
1186720021 X:12294079-12294101 TAATAGACACCAGGACATGAAGG - Intronic