ID: 1141297643

View in Genome Browser
Species Human (GRCh38)
Location 16:82784640-82784662
Sequence CACTTTGGATAAGGGTCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141297638_1141297643 1 Left 1141297638 16:82784616-82784638 CCTCTTTATAAAATTAATTAATT No data
Right 1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG 0: 1
1: 0
2: 0
3: 6
4: 85
1141297637_1141297643 29 Left 1141297637 16:82784588-82784610 CCTAGTGAGGGAAGAAGAAGAAT 0: 1
1: 0
2: 3
3: 27
4: 369
Right 1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG 0: 1
1: 0
2: 0
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141297643 Original CRISPR CACTTTGGATAAGGGTCATA GGG Intronic
911238560 1:95438940-95438962 AAATTTGAATAAGGGCCATAGGG - Intergenic
911384983 1:97163661-97163683 CACTTTGTGGAAGGGTCAGAAGG + Intronic
911833973 1:102592496-102592518 GATTTTGGATATGGGTCATTGGG - Intergenic
914942501 1:152035632-152035654 CACTTTGGAGATGGGTCCTGAGG + Intronic
1064126895 10:12670089-12670111 CACTTTGGAAAACTGTCAGACGG - Intronic
1065412819 10:25448683-25448705 CACTTTGGAAAATGGTCTTGTGG - Intronic
1065791363 10:29263548-29263570 CACCTTGGACAAGTGTCACATGG - Intergenic
1067517942 10:46970483-46970505 CATTTTGGTAAAAGGTCATAGGG - Intronic
1067644306 10:48081346-48081368 CATTTTGGTAAAAGGTCATAGGG + Intergenic
1068838188 10:61579576-61579598 CACTCTGCATAAGTGTCTTATGG - Intergenic
1070227236 10:74522342-74522364 CCCTTTGGAAAAGGGTTTTATGG + Intronic
1073262808 10:102203388-102203410 AAATTTGGATAAGGGTCTAAAGG + Intergenic
1075633017 10:124012529-124012551 CACTTTGGAAAAGTGCCCTATGG - Intronic
1076109597 10:127850725-127850747 CATTTTGGATACTGTTCATAAGG + Intergenic
1088446320 11:109932738-109932760 CATTTAGGAGAAGGGTGATAGGG - Intergenic
1088468217 11:110164805-110164827 CATTTTGGATACTGTTCATAAGG - Exonic
1088765512 11:112971958-112971980 GACTTTGGATAAGGATAAAAGGG + Intronic
1090677947 11:129021530-129021552 CCCTTGGGAAAATGGTCATACGG + Intronic
1092835887 12:12487893-12487915 CCATTTGGATGAGGGTCATGGGG - Intronic
1093258136 12:16898322-16898344 GACTTTGTATATGGGTCCTATGG - Intergenic
1097551788 12:61080688-61080710 CATTTTGGATAATGGTGATTTGG - Intergenic
1098322477 12:69259960-69259982 CACTTGGGATAAGAGTGATAAGG - Intronic
1098542095 12:71668092-71668114 CATTTTGGATAAGGTGGATAAGG + Intronic
1099144310 12:79019933-79019955 CTCTTTGGATAAGTGTCCTGTGG - Intronic
1099729024 12:86474011-86474033 TACTTTGGAAGAGGGTCAGAGGG - Intronic
1103134149 12:118493064-118493086 CAGTTTGGATAAGGGTTCTGGGG + Intergenic
1106793448 13:33180186-33180208 CACTTTGGATATGTGACATTTGG + Intronic
1110964206 13:81671161-81671183 CTCTTTAGAAAAGAGTCATATGG - Intergenic
1111225409 13:85265028-85265050 CACCTTGGAAAAAGGTCTTATGG - Intergenic
1112110278 13:96289972-96289994 CTCATTTGAGAAGGGTCATATGG - Intronic
1127582302 15:60349568-60349590 CATTTTGGATAAGGGATATTAGG + Intronic
1140694289 16:77517004-77517026 CACTTTGGATATGGGTCAGTTGG - Intergenic
1141297643 16:82784640-82784662 CACTTTGGATAAGGGTCATAGGG + Intronic
1142780769 17:2179502-2179524 CACACTGGAGAAGGGTCGTAGGG - Intronic
1143600085 17:7939432-7939454 CACCTTGTATGAGGGTCAGAGGG + Intronic
1145297120 17:21600682-21600704 CACATTGGATAAGTGTACTATGG + Intergenic
1145366837 17:22272216-22272238 CACATTGGATAAGTGTACTATGG - Intergenic
1148156292 17:45426862-45426884 CACTTAGGGTAAGTGTTATACGG + Intronic
1150387958 17:64775483-64775505 CACTTCGGATAAGTGTTATATGG + Intergenic
1156131779 18:33984870-33984892 GACTCTGGAAAAGGGTGATATGG + Intronic
1159103586 18:63981228-63981250 CATTTTAGATCTGGGTCATATGG - Intronic
1160893395 19:1391227-1391249 CACTTTTGATAAGCGCCATCAGG - Intronic
1165991958 19:39820931-39820953 CAATTTGGACAAGGCTCAAAGGG + Intergenic
1166562507 19:43742489-43742511 CACAATGGAAAAGGGTTATAGGG - Intronic
930679489 2:54241260-54241282 AAATTTGGATAAGGGTCAGCTGG - Intronic
934907252 2:98216251-98216273 CACATTGGATAAGTGTCCTTTGG + Intronic
936029802 2:109062147-109062169 CACTTTGGATAAAAGTTATCAGG + Intergenic
938035400 2:128030594-128030616 GCCTTTGGATAATGGGCATAGGG - Intergenic
938932407 2:136098403-136098425 CACTTAGTTGAAGGGTCATATGG - Intergenic
940782984 2:157952924-157952946 AAATTTGGCTAAGGGGCATAAGG - Intronic
941202164 2:162525421-162525443 GAATTTGGATAAGGGAGATAGGG + Intronic
941615410 2:167712969-167712991 CATTTTGGATAATGTCCATATGG + Intergenic
945184879 2:207130114-207130136 CCCTTTAGGTAAGGGTCGTAGGG - Intronic
945873286 2:215250606-215250628 CACTTTGCATAATGTTCTTAAGG - Intergenic
946558583 2:220887381-220887403 CAGTTTGGATAAGGCTGATATGG - Intergenic
1174845987 20:53943781-53943803 CACTTGAGATAAGTGTCAGACGG + Exonic
1176901701 21:14450088-14450110 CACAGTGGATGAGAGTCATATGG - Intergenic
1183801786 22:40172231-40172253 CACTTTAGATAAGGTGCACAGGG - Intronic
953415661 3:42714707-42714729 CACCTTGGTGAAGGGTCAAAAGG + Intronic
954349979 3:50035160-50035182 CAATTTGACTGAGGGTCATAAGG + Intronic
956725855 3:72156041-72156063 CACATTAGATAAGAGTCAGATGG + Intergenic
959577478 3:107950031-107950053 GAATTTGGATATGGGTCATGTGG + Intergenic
967840287 3:193999718-193999740 CACTCTGGAAAAGGGATATAAGG - Intergenic
968397933 4:260818-260840 AAGTTGGGATAAGGGCCATAAGG - Intergenic
968415741 4:432303-432325 CAGTTGAGATAAGGGCCATAAGG - Intronic
971624916 4:28907045-28907067 CAGTTTGGATAAGGTTTATCTGG + Intergenic
972798469 4:42446972-42446994 CAATATGGATGAGAGTCATAGGG + Intronic
983854138 4:172620840-172620862 GACTTTAGATAAGGGGAATAAGG - Intronic
983928489 4:173428181-173428203 CACTTTGGAAACAGGTCAAAGGG + Intergenic
991568217 5:68027278-68027300 TTCTTTGGATACAGGTCATATGG - Intergenic
993807790 5:92434741-92434763 CACTTTATTTAATGGTCATATGG + Intergenic
996800799 5:127400602-127400624 CTCTTTGGATAAGGATCTTCAGG + Intronic
1005116320 6:22341958-22341980 CACTTTGGGTATGGGTCATCTGG - Intergenic
1006364876 6:33609556-33609578 CACCCTGGATGAGGGTCAGAAGG + Intergenic
1009710864 6:67318087-67318109 CACTTTGGATAAAAGTAAGATGG + Intergenic
1011859490 6:91737379-91737401 CTTTTTGGAGAAGGGTGATAAGG - Intergenic
1012814570 6:104005981-104006003 AATTTTGGATAAAGGTTATATGG - Intergenic
1015226657 6:130864841-130864863 TACTTTGGATAAGTGTCTAAAGG - Intronic
1021787758 7:24169408-24169430 CACTTTGGATAAAGAACATGTGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1046028257 8:108750974-108750996 GAATTTGACTAAGGGTCATAGGG - Intronic
1046099872 8:109602027-109602049 CAGTTTGGAGATGGGTCATAAGG + Intronic
1047165419 8:122432861-122432883 CACTTTGAATCAGGGTGATGAGG - Intergenic
1050042879 9:1514225-1514247 CACTTTGGCCCAGGGACATAAGG + Intergenic
1054986429 9:71267281-71267303 CATTTTTGATAATTGTCATAAGG - Intronic
1188405025 X:29797310-29797332 CACTTTGGAAAAAGGTCACTTGG - Intronic
1194104005 X:89745117-89745139 CACCTTGGATAATGGGAATATGG - Intergenic
1200182320 X:154158254-154158276 CACTGTGGATGAGTGTCATGGGG + Intronic
1200187974 X:154195368-154195390 CACTGTGGATGAGTGTCATGGGG + Intergenic
1200193624 X:154232508-154232530 CACTGTGGATGAGTGTCATGGGG + Intronic
1200199379 X:154270312-154270334 CACTGTGGATGAGTGTCATGGGG + Intronic
1200455959 Y:3392923-3392945 CACCTTGGATAATGGGAATATGG - Intergenic