ID: 1141297797

View in Genome Browser
Species Human (GRCh38)
Location 16:82785945-82785967
Sequence CAGGGGAACCACACAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 1, 2: 15, 3: 112, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141297797_1141297806 20 Left 1141297797 16:82785945-82785967 CCTGCTACTGTGTGGTTCCCCTG 0: 1
1: 1
2: 15
3: 112
4: 320
Right 1141297806 16:82785988-82786010 CAGGCTAAACTAATTCCGACTGG 0: 14
1: 86
2: 137
3: 110
4: 156
1141297797_1141297804 1 Left 1141297797 16:82785945-82785967 CCTGCTACTGTGTGGTTCCCCTG 0: 1
1: 1
2: 15
3: 112
4: 320
Right 1141297804 16:82785969-82785991 TGGCTAGGGTTAGACCACACAGG 0: 41
1: 90
2: 120
3: 59
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141297797 Original CRISPR CAGGGGAACCACACAGTAGC AGG (reversed) Intronic
900209514 1:1447086-1447108 TAGGGGAACCACACAGCAGTAGG - Intergenic
900213843 1:1470669-1470691 TAGGGGAACCACACAGCAGTAGG - Intergenic
900219331 1:1498948-1498970 AAGAGGAACCACACAGCAGTAGG - Intergenic
900221350 1:1511048-1511070 TAGGGGAACCACACAGCAGTAGG - Intergenic
900323865 1:2097914-2097936 CAGGGGAACCACACAGCAGCAGG - Intronic
901362931 1:8719281-8719303 CAGTGGAGCCACACAGCAGCTGG + Intronic
902052225 1:13572992-13573014 TAGGGGAAGGACACAGCAGCAGG + Intergenic
903635040 1:24807482-24807504 TAGGGGAAAGACACAGCAGCAGG - Intronic
904567361 1:31435702-31435724 CAGGGGGACAACACAGGAGTCGG + Intergenic
904713564 1:32449588-32449610 TAGGGGAACGACACAGCAGCAGG - Intergenic
905051867 1:35058651-35058673 TAGGGGAACAACACAGCAGCAGG + Intergenic
905093352 1:35447712-35447734 CAGGCGAACCACACTGCACCTGG + Intronic
906293869 1:44637109-44637131 CTGGGGAATCTCACAGCAGCTGG + Intronic
906507880 1:46393691-46393713 CAGGGGAAGGACACAGCATCAGG - Intergenic
906904694 1:49877152-49877174 CAGGGCAATCACACAGGAGACGG - Intronic
907962991 1:59299733-59299755 TAGGGGAACGACACAGCAACAGG - Intronic
909085812 1:71169168-71169190 AAGGAGAAGCACACAGTGGCAGG + Intergenic
909143285 1:71894344-71894366 CAGGGGAACCACATTGAAACAGG + Intronic
909238714 1:73184008-73184030 CAGGGGAACGACACAGCAGCAGG + Intergenic
909673709 1:78215380-78215402 TAGGGGAACAACACAGAAGCAGG + Intergenic
909843252 1:80356726-80356748 AAGGGGGACCTCACAATAGCTGG - Intergenic
910805786 1:91188811-91188833 CATGGGAAAAACACAGTATCTGG + Intergenic
912176524 1:107164918-107164940 CAGGGGAACCACACAGCGTCAGG - Intronic
912989720 1:114473400-114473422 TAGGGGAACAACACAGCAGCAGG - Intronic
913064440 1:115237591-115237613 TAGGGGAACAACACAGCAGCAGG - Intergenic
913159827 1:116134706-116134728 CTGGGGACTCACACAGGAGCTGG + Exonic
914913516 1:151804577-151804599 CAGGGGAAACTCACAGGAGCAGG - Intronic
916411689 1:164552623-164552645 TAGGGGAACAACACAGCAGTAGG - Intergenic
916505563 1:165425356-165425378 CATGGCAATCACACAATAGCAGG - Intronic
917099264 1:171429274-171429296 CAGGGGAAGGACACAGAAACAGG + Intergenic
917312548 1:173691898-173691920 TAGGGGAATAACACAGCAGCAGG - Intergenic
918270691 1:182895812-182895834 CTGGGGAACTACCCAGTAGTGGG - Intergenic
920267734 1:204736955-204736977 CAAGAGAACCAGACTGTAGCAGG + Intergenic
921203181 1:212826103-212826125 TAGGGGAACGACACAGCAGTAGG - Intergenic
921632801 1:217455468-217455490 GAGAGGAACTACACAGTGGCAGG - Intronic
922276816 1:224086830-224086852 TAGGGGAACGACACAGCAGCAGG + Intergenic
922974378 1:229771389-229771411 CAGGGGAACTTCACTGGAGCAGG + Intergenic
923282513 1:232457903-232457925 CAGGGCACCCAGACAGTTGCAGG + Intronic
924714775 1:246563121-246563143 CAGTGGAAACACACAGCGGCAGG - Intronic
1063097459 10:2921002-2921024 CATGGCAACCACACAGCATCAGG + Intergenic
1063309545 10:4939341-4939363 CAGGGGAAAGACACAGCAGAAGG + Intronic
1064756693 10:18577909-18577931 TAGGGGAATGACACAGCAGCAGG + Intronic
1064773760 10:18752759-18752781 TAGGGGAATGACACAGCAGCAGG + Intergenic
1064827366 10:19420140-19420162 CAGGGGAACGACAGAGCAGCAGG - Intronic
1065464295 10:26002443-26002465 TAGGGGAACGACACAGCAGCAGG - Intronic
1065810566 10:29439029-29439051 CAGGGGAATGACACAGCAGCAGG - Intergenic
1065888467 10:30100044-30100066 CAGGGGAAGGACACAGCAGCAGG + Intronic
1065889607 10:30109837-30109859 CAGGGGGTCCACACATCAGCTGG - Intronic
1066667683 10:37802083-37802105 CAGGGAAACTATAAAGTAGCAGG - Intronic
1067662060 10:48243603-48243625 AAGGGGAACCAGACGGGAGCAGG + Intronic
1068613480 10:59086535-59086557 CAGTGGATCTTCACAGTAGCTGG - Intergenic
1068985150 10:63101373-63101395 TAGCGGAACGACACAGCAGCAGG + Intergenic
1069071866 10:63997962-63997984 CAGAGGAAAAACACAGAAGCTGG + Intergenic
1069733459 10:70634655-70634677 TAGGGGAACGATACAGCAGCAGG - Intergenic
1071282757 10:84117494-84117516 TAGGGGAACAGCACAGCAGCAGG + Intergenic
1071282877 10:84118725-84118747 TAGGGGAACGACACAGCAGCAGG - Intergenic
1071283873 10:84126364-84126386 TAGGGGAACGACACAGCAGCAGG - Intergenic
1072884230 10:99259743-99259765 AAGGGGGACCACACAGCAGGAGG + Intergenic
1074997433 10:118769996-118770018 GAGGGGAACGACACAGCAGTAGG + Intergenic
1076866692 10:133169889-133169911 CGGGGGAACCACGGAGTAGGGGG - Intronic
1077086831 11:757011-757033 CGTGGGCACCACACAGGAGCAGG + Intronic
1077434035 11:2529942-2529964 CAGGAGCACCTCACAGAAGCAGG - Intronic
1077453096 11:2662633-2662655 CAGGGGAATCACACCGTGGCCGG - Intronic
1077559686 11:3251605-3251627 TAGGGGAACGACACAGCAGTAGG + Intergenic
1077565578 11:3297408-3297430 TAGGGGAACGACACAGCAGTAGG + Intergenic
1077937486 11:6802879-6802901 TAGGGGAACGACACAGCAGCAGG - Intergenic
1078860797 11:15244503-15244525 CAGGGGTACCACTCATTACCTGG - Intronic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079261122 11:18882327-18882349 CAGGGGAAAAACACATTACCAGG - Intergenic
1079271218 11:18987639-18987661 TAGGGGAACAACACAGCAGCAGG - Intergenic
1081775219 11:45671688-45671710 CAGGGGAACCACCTGGAAGCAGG - Intergenic
1082295649 11:50438854-50438876 CAGGGGAAGCTCACAGGACCAGG - Intergenic
1084987072 11:72884413-72884435 CAGTGAAACCTCACAGTAACAGG + Intronic
1085544013 11:77300264-77300286 TAGGGGAACGACACAGCAGCAGG + Intronic
1087639824 11:100744949-100744971 TAGGGGAACGACACAGCAGCGGG - Intronic
1087640509 11:100750311-100750333 TAGGGGAAAGACACAGCAGCAGG - Intronic
1087640550 11:100750556-100750578 TAGGGGAAGGACACAGCAGCAGG - Intronic
1087700346 11:101430303-101430325 CAGGGCAGCAACACAGTACCTGG + Intergenic
1088834344 11:113565280-113565302 CTGGGGAAGGGCACAGTAGCAGG + Intergenic
1089374261 11:117983385-117983407 CAGGGAAACCTCCCAGGAGCAGG + Intergenic
1089506957 11:118969858-118969880 GAGGGGAACCACACAGACACTGG + Intergenic
1089956952 11:122580301-122580323 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1090324402 11:125872091-125872113 CAGGGGAATGACACAGCAGTAGG - Intergenic
1092587124 12:9911069-9911091 ATGGGGAACTACACAGAAGCAGG - Intronic
1092847320 12:12595885-12595907 TAGGGGAACGACACAGCAGCAGG - Intergenic
1093950492 12:25160594-25160616 TAGGGGAATGACACAGTAGCAGG + Intronic
1094475471 12:30837392-30837414 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1094582284 12:31744480-31744502 TAGGGGAACCACACAGCAGCAGG - Intergenic
1094583824 12:31758670-31758692 TAGGGGAATGACACAGCAGCAGG + Intergenic
1095191574 12:39263869-39263891 CAGGGCAACCACGCAGGAGAAGG + Intergenic
1097715987 12:62966710-62966732 TAGGGGAACAACACAGCAGCAGG + Intergenic
1097757187 12:63419490-63419512 TAGAGGAACAACACAGCAGCAGG + Intergenic
1097844918 12:64356481-64356503 CAGGGGAATGACACAGCAGTAGG - Intronic
1098994660 12:77105214-77105236 AAGGTGAACCACATAGTAACTGG - Intergenic
1099798376 12:87426225-87426247 CAGGGGAAAGACACAGCAGTAGG + Intergenic
1100716867 12:97315199-97315221 TAGGGGAATGACACAGCAGCAGG - Intergenic
1101387677 12:104272249-104272271 TAGGGGAAAGACACAGCAGCAGG - Intronic
1101565199 12:105898330-105898352 TAGGGGAACGACACAGCAGCAGG - Intergenic
1102605533 12:114064752-114064774 TAGGGGAACAACACAGCAGCAGG + Intergenic
1103362633 12:120362816-120362838 CAGAGAAGCCACACAGTAGCTGG - Intronic
1104224678 12:126819910-126819932 TAGGGGAACGACACAGCAGTAGG + Intergenic
1104695071 12:130857255-130857277 CAGGAGAACCACACAGCAGTAGG + Intergenic
1105458789 13:20565420-20565442 CAGGGGAAGGACACAGCAGCAGG + Intergenic
1105569069 13:21582793-21582815 TAGGGGAAAGACACAGCAGCAGG + Intronic
1106222111 13:27754882-27754904 TAGGGGAACGACACAGCAGAAGG + Intergenic
1106639348 13:31567207-31567229 CAGGGGAACAAAAAAGTAGCTGG - Intergenic
1109339436 13:61036581-61036603 TAGGGGAACAGCACAGCAGCAGG + Intergenic
1109459926 13:62643341-62643363 TAGGAGAACCACACAGCAGTAGG + Intergenic
1109909224 13:68888825-68888847 TAGGGGAATGACACAGCAGCAGG - Intergenic
1109910134 13:68898652-68898674 TATGGGAACCACACAGCAGTAGG + Intergenic
1110756392 13:79179665-79179687 TAGGGGAATGACACAGCAGCAGG - Intergenic
1112538859 13:100286342-100286364 CAGGGGAACAACACAGCAGCAGG - Intronic
1112609357 13:100940745-100940767 CAGGGGAATCAGTCAGTACCAGG - Intergenic
1113219573 13:108084680-108084702 TAGGGGAACTACACTGCAGCAGG + Intergenic
1113535077 13:111059570-111059592 TAGGGGAACGACACGGCAGCAGG - Intergenic
1113945113 13:114039632-114039654 CAGGGTGACCCCACAGGAGCTGG + Intronic
1114223196 14:20715353-20715375 CAGGGGAAAGACACAGCAGTAGG - Intergenic
1114235828 14:20822895-20822917 TAGAGGAACGACACAGCAGCAGG - Intergenic
1114236509 14:20828431-20828453 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1114595797 14:23910677-23910699 CAGAGAAATCACACAGTTGCTGG + Intergenic
1114763543 14:25344848-25344870 AAGTGGAACCACACAGTCCCAGG - Intergenic
1114912627 14:27219822-27219844 TAGGGGAACAACACAGCAGTAGG + Intergenic
1116396021 14:44449609-44449631 TAGGGGAACAACACAGCAGTAGG - Intergenic
1117756483 14:58979515-58979537 CAGGGTCACCCGACAGTAGCTGG - Intergenic
1119252833 14:73171595-73171617 TAGGGGAAGAACACAGCAGCAGG - Intronic
1119692039 14:76680991-76681013 CAGGGGAATGACACAGCAGCAGG + Intergenic
1120395721 14:83964690-83964712 TAGGGGAACGACACAGCTGCAGG + Intergenic
1121240486 14:92426441-92426463 CAGCTGAACCACATAGTACCTGG + Intronic
1122383095 14:101323929-101323951 TAGGGGAACAACACAGCAGTAGG + Intergenic
1123705850 15:22950746-22950768 CCTGTGAGCCACACAGTAGCCGG + Intronic
1124233726 15:27968781-27968803 CAGGGAAACCACACAGAGGCGGG + Intronic
1124888375 15:33708842-33708864 TAGGGGAACGACACAGCAGCAGG - Intronic
1124934191 15:34154879-34154901 TAGGGGAATGACACAGTAGTAGG - Intronic
1125970454 15:43907132-43907154 AAGGGCACCCACAGAGTAGCTGG - Intronic
1127908510 15:63395688-63395710 CAGGGGAACAACACAGCAGCAGG - Intergenic
1128602354 15:69007926-69007948 TAGGGGAACAACACAGCAGCAGG + Intronic
1130329380 15:82909357-82909379 CAGGGGAAAGACACAGCAGTAGG - Intronic
1131845673 15:96488214-96488236 CAGGTGATCTACAGAGTAGCTGG - Intergenic
1131867111 15:96722892-96722914 CAGGGGAACCTCACAACATCAGG - Intergenic
1132717156 16:1296930-1296952 TAGGGGAACCACACAGCAGGAGG - Intergenic
1133061446 16:3177419-3177441 TAGGGGAATGACACAGCAGCAGG + Intergenic
1133063344 16:3189299-3189321 CATGGGAACCTCCCAATAGCAGG - Intergenic
1135626219 16:23997139-23997161 CATGGGAACCCCAAAGTGGCTGG - Intronic
1135847196 16:25929489-25929511 CAAGGGATCCAGACAGTAGTGGG - Intronic
1136077337 16:27826213-27826235 CTGGGGAAAGACACAGTGGCAGG + Intronic
1138433627 16:56984976-56984998 CAGGGGAACAACATAGCAGCAGG + Intergenic
1139653882 16:68375970-68375992 CAGGGGCCGCACACAGGAGCAGG - Intronic
1140458856 16:75122214-75122236 TAGGGGAACGACACAGCAGTAGG - Intergenic
1141297797 16:82785945-82785967 CAGGGGAACCACACAGTAGCAGG - Intronic
1141954498 16:87361383-87361405 CAGGGGCACAACACAGGAGACGG + Intronic
1142181404 16:88672638-88672660 CAGGGGAAGCAAAAAGGAGCTGG + Intergenic
1143795779 17:9335182-9335204 TAGGGGAACAACACAGCAGCAGG + Intronic
1144244279 17:13347534-13347556 TAGGGGAATGACACAGCAGCAGG - Intergenic
1147624013 17:41887585-41887607 GAGGGGAAGCTCACAGTGGCAGG + Exonic
1148142128 17:45336555-45336577 CAGCTGAGCCACACAGAAGCTGG - Intergenic
1148951734 17:51319228-51319250 AAGGGGAACAACACAGCAGTAGG - Intergenic
1150391968 17:64795197-64795219 CAGGGGAACCCCGCAGAAGTTGG - Intergenic
1151678603 17:75612725-75612747 CAGGGGAGCCCCACCGGAGCAGG - Intergenic
1151894462 17:76970588-76970610 TAGGGGAACGACACAGCAGCAGG + Intergenic
1152762926 17:82118942-82118964 CACGGGGACCACACACTACCAGG - Intronic
1153021497 18:633666-633688 TAGGGGAACCACACAGCAGCAGG - Intronic
1153463124 18:5359194-5359216 CAGGGGAACCACACACAACAGGG - Intergenic
1153826112 18:8876414-8876436 TAGGGGAATGACACAGCAGCAGG + Intergenic
1153826179 18:8877014-8877036 TAGGGGAACAATACAGCAGCAGG - Intergenic
1153826874 18:8882967-8882989 TAGGGGAACGACACAGCAGCAGG - Intergenic
1153881168 18:9422903-9422925 TAGGGGAACGACACAGCAGCAGG - Intergenic
1154142184 18:11833938-11833960 CAGAGGGGCCACACAGCAGCAGG - Intronic
1154157727 18:11956992-11957014 CAGGGGAATGACACAGCAGTAGG + Intergenic
1154427043 18:14280049-14280071 CTGGGGATGCACACAGCAGCAGG - Intergenic
1155158307 18:23176423-23176445 AATGGGGGCCACACAGTAGCAGG - Intronic
1155803642 18:30139973-30139995 CAGGGGAACGACACAGCAGTAGG + Intergenic
1156516700 18:37686202-37686224 CAAGGGAACCCCCCAGGAGCTGG + Intergenic
1158084144 18:53630130-53630152 TAGGGGAACCACACGGCAGCAGG - Intergenic
1158498239 18:57975971-57975993 CAGGGATACCCCACAGCAGCTGG - Intergenic
1158908306 18:62035437-62035459 CAGGGGAACTCCACAGCTGCGGG - Intergenic
1161172121 19:2817518-2817540 TAGGGGAACAACACAGCAGTAGG - Intergenic
1163050264 19:14677909-14677931 TAGGGGAACGACACAGCAGCAGG - Intronic
1163077986 19:14912895-14912917 CAGGGGAACGACACAGCAGTAGG - Intergenic
1163215553 19:15874098-15874120 TAGGGGAACGACACAGCAGCAGG + Intergenic
1163631567 19:18420236-18420258 CAGGGGCCCCACACAGCTGCTGG - Intronic
1163747167 19:19055407-19055429 CGGGGGGCACACACAGTAGCAGG + Intronic
1163927515 19:20360221-20360243 TAGGGGAACGACACAGCAACAGG + Intergenic
1163929553 19:20375879-20375901 TAGGGGAAAGACACAGCAGCAGG + Intergenic
1163959534 19:20675716-20675738 TAGGGGAAACACACAGAAGTAGG + Intronic
1164608024 19:29613804-29613826 TGGGGGAACCACAGAGAAGCAGG - Intronic
1164655411 19:29917600-29917622 TAGGGGAACAACACAGCAGCAGG + Intergenic
1165342824 19:35224836-35224858 CAGGAGAAGCACACAGGTGCTGG - Exonic
1165673580 19:37701525-37701547 TAGGGGAACGACACAGCAGCAGG + Intronic
1167906608 19:52665749-52665771 TAGGGGAATGACACAGCAGCAGG + Intronic
925636387 2:5945333-5945355 CAGGGGACCCACACAGGCCCGGG + Intergenic
926119980 2:10236504-10236526 CATGGGAACCACAAGTTAGCTGG - Intergenic
926646793 2:15298393-15298415 CAGGGGAAAAACACAGGAGTTGG + Intronic
926999902 2:18783705-18783727 CAGGGGAACCACAGAGGACATGG - Intergenic
928439912 2:31283817-31283839 TAGGGGAACGACACAGCAGCAGG + Intergenic
930247848 2:49003394-49003416 CGGGGAAACCACAAAGTAGCTGG - Intronic
932005188 2:67920432-67920454 TAAGGGAACGACACAGCAGCAGG + Intergenic
933279047 2:80312251-80312273 TAGGGGAACCACACAGCAGTAGG - Intronic
933883460 2:86695387-86695409 TAGGGGAACAACACAGCAGTAGG + Intronic
934151758 2:89154115-89154137 CTGGGGAATCACAGAGCAGCAGG + Intergenic
934215502 2:90027791-90027813 CTGGGGAATCACAGAGCAGCAGG - Intergenic
934664422 2:96159629-96159651 GAGGGCAAACACACAGTACCAGG - Intergenic
934946914 2:98549046-98549068 CAGGGGAAGCCCACAGGAGGAGG - Intronic
935048620 2:99504309-99504331 TAGGGGAACGACACAGCAGCAGG + Intergenic
935805055 2:106737420-106737442 CAGGGGAAGGACCCAGTAGGAGG + Intergenic
935958978 2:108405093-108405115 CAGGGGAAAGACACAGCAGTAGG + Intergenic
937169605 2:119852313-119852335 CAGGGGAAGGACACAGAAACAGG + Intronic
939166308 2:138644798-138644820 CAGGGGAACGACACAGCAACAGG - Intergenic
939913279 2:148008739-148008761 TAGGGGAACGACAGAGCAGCAGG + Intronic
939940061 2:148338744-148338766 CAGGAGAAACACACAGGAACAGG + Intronic
940303695 2:152202807-152202829 TAGGGGAACGACACAGAAGCAGG + Intergenic
940802245 2:158145533-158145555 GAGGGGAAGGACACAGCAGCAGG + Intergenic
940897705 2:159096590-159096612 TAGGGGAACAACACAGCAGCAGG - Intronic
941876045 2:170434474-170434496 TAGGGGAATGACACAGCAGCAGG - Intronic
942109524 2:172666506-172666528 TAGGGGAACGACACAGCAGTAGG - Intergenic
943154218 2:184152165-184152187 TAGGGGAACGACACAGCAGCAGG + Intergenic
945720491 2:213412293-213412315 TAGGGGAACAACACAGCAGCAGG + Intronic
945933925 2:215883912-215883934 CAGGGGAACCACAGTGTGTCAGG - Intergenic
946298064 2:218802181-218802203 TAGGGGAACGACACAGCAGCAGG + Intronic
947417806 2:229916332-229916354 TAAGGAAAACACACAGTAGCAGG + Intronic
947498023 2:230652974-230652996 TAGGGGAATGACACAGCAGCAGG + Intergenic
947556832 2:231100342-231100364 CAGGGGAATGACACAGCAGCAGG - Intronic
947814549 2:233027568-233027590 TAGGGGAACGACACAGCAGTAGG - Intergenic
948007880 2:234625529-234625551 GGTGGGAACAACACAGTAGCTGG + Intergenic
948103113 2:235391147-235391169 CTGGGGGACCACACAGGAGATGG + Intergenic
948109621 2:235444250-235444272 CAGGGGAACGACACAGCAGTAGG - Intergenic
948138623 2:235656641-235656663 CAGGGGAACGACACAGCAGCAGG + Intronic
948155608 2:235778615-235778637 CAGGGGAGCCACATGGTAGCCGG - Intronic
948350999 2:237340785-237340807 CAGGGGAATGACACAGTTGCAGG - Exonic
948878405 2:240842435-240842457 TAGCGGAACCACACAGCAGCAGG - Intergenic
948987849 2:241536275-241536297 CAGGGGAGACACAGAGGAGCTGG + Intergenic
1168745480 20:236081-236103 CAGGGCAGGCACACAGCAGCTGG + Intergenic
1168822458 20:784411-784433 CAGGGGAACCACACAGCAGTAGG - Intergenic
1168823330 20:792106-792128 TAGGGGAACGACACAGCAGCAGG + Intergenic
1169354372 20:4895106-4895128 CAGGGGAACCACTTCGGAGCTGG + Intronic
1169835542 20:9873777-9873799 TAGGGGAACGACACAGCAGTAGG + Intergenic
1171236424 20:23529120-23529142 TAAGGGAACAACACAGCAGCAGG - Intergenic
1172135407 20:32683365-32683387 CTGGGGAGACAGACAGTAGCTGG - Intergenic
1174275696 20:49402332-49402354 TAGGGGAAAGACACAGCAGCAGG + Intronic
1175024135 20:55883327-55883349 AAGGGGAAGCACAAAGGAGCAGG - Intergenic
1175716373 20:61256816-61256838 AAGGGGACCCACACAGGCGCAGG - Intronic
1175907882 20:62390611-62390633 CAGGGGAGACACACTGCAGCCGG + Exonic
1176075138 20:63244923-63244945 CAGGCCAACCACTCAGCAGCCGG + Intronic
1176138873 20:63536569-63536591 GCGGGGAACCAGACAGCAGCTGG - Intronic
1176150395 20:63587941-63587963 CATGGGAACCACACTGCAGTGGG - Exonic
1177415075 21:20782316-20782338 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1177925281 21:27206709-27206731 GAGGCAAACCACACAGAAGCTGG + Intergenic
1179996157 21:44975407-44975429 CATGGGAGCCACACAGTGCCAGG + Intronic
1181161540 22:20962855-20962877 CAGGAGAACCTGACAGTAGAGGG + Intergenic
1183217015 22:36487307-36487329 TAGGGGAACAACACAGCAGTAGG - Exonic
1183531450 22:38356067-38356089 CAGTGGAAACACACAGCGGCAGG + Intronic
949163816 3:913096-913118 CAGGGGAACGACACAGCAGTAGG + Intergenic
949787376 3:7756987-7757009 CAGGAGAACAACACAGCAGCAGG + Intergenic
950567747 3:13781013-13781035 CAGGGGAATCTCTCAGTGGCTGG + Intergenic
952519748 3:34144916-34144938 TAGTGGAACGACACAGCAGCAGG + Intergenic
952821456 3:37489963-37489985 TAGGGGAACGACACAGCAGTAGG - Intronic
953972820 3:47360272-47360294 TAGGGGAACAACACAGCAGCAGG - Intergenic
954604342 3:51897241-51897263 TAGGGGAACGACACAGCAGCAGG + Intronic
954605008 3:51902709-51902731 TAGGGGAATGACACAGCAGCAGG + Intronic
955364895 3:58302518-58302540 GAGGGGAGCCACACAGCAGAGGG + Intergenic
955623289 3:60889254-60889276 CAGGGGAACGACACGGCAGCAGG + Intronic
957509848 3:81173482-81173504 CAGGGTGACCACAAAGTATCTGG + Intergenic
957975153 3:87433732-87433754 TAGGGGAATGACACAGCAGCAGG + Intergenic
958796667 3:98713417-98713439 TAGGGGAACCATACAGCAGCAGG - Intergenic
958974395 3:100650423-100650445 CAGAGGAAACACACAGTAAACGG - Intronic
959175459 3:102904247-102904269 TAGGGGAACCACACAGCAGTAGG - Intergenic
960720900 3:120623476-120623498 TAGGGGAATGACACAGCAGCAGG - Intergenic
961935333 3:130576850-130576872 CAAGGAAATCAGACAGTAGCTGG + Intronic
962330783 3:134476022-134476044 CACGGGAAGCACACAGGACCTGG + Intergenic
963525860 3:146412741-146412763 TAGGGGAACGACACAGCAGTAGG - Intronic
963711565 3:148753411-148753433 CAGGGGAACAACACAGCAGCAGG - Intergenic
966043681 3:175523672-175523694 AAGGGGAAGGACACAGCAGCAGG - Intronic
966306533 3:178542031-178542053 TAGGGGAACAACACAGCAGCAGG + Intronic
966457085 3:180129283-180129305 TAGGGGAACAACACAGAAGCAGG - Intergenic
966764099 3:183443821-183443843 TAGGGGAACAACACAGCAGTAGG + Intergenic
967358260 3:188598127-188598149 CAGGGCAACCACAGGATAGCTGG + Intronic
968645531 4:1738711-1738733 CAGGGGAACAACACAGCAGTAGG - Intronic
969180402 4:5436221-5436243 CAGGGGCCCAACTCAGTAGCAGG - Intronic
970093077 4:12431287-12431309 TAGGGGAACAACACAGCAGCAGG - Intergenic
971066834 4:23042499-23042521 TAGGGGAATGACACAGCAGCAGG + Intergenic
972784409 4:42313774-42313796 TAGGGGAATGACACAGCAGCAGG + Intergenic
972785230 4:42320429-42320451 TAGGGGAATGACACAGCAGCAGG + Intergenic
973006772 4:45017542-45017564 TAGAGGAACGACACAGCAGCAGG + Intergenic
975204926 4:71634559-71634581 TAGGGGAAGGACACAGAAGCAGG - Intergenic
975361718 4:73477850-73477872 CAGAGGAAAGACACAGAAGCTGG - Intergenic
975911978 4:79277786-79277808 TAGGGAAACAACACAGCAGCAGG + Intronic
975992479 4:80271542-80271564 CAGGAGAAGGCCACAGTAGCAGG + Intronic
976011373 4:80493354-80493376 TAGGGGAATGACACAGTAGCAGG - Intronic
976197029 4:82542797-82542819 CAGGTGAAAGACACACTAGCTGG + Intronic
977531248 4:98202642-98202664 TAGGGGAATGACACAGCAGCAGG + Intergenic
978314443 4:107419850-107419872 TAGGGGAATGACACAGCAGCAGG + Intergenic
980341154 4:131548981-131549003 TAGGGGAATGACACAGCAGCAGG + Intergenic
980439270 4:132818606-132818628 TAGGGGAATGACACAGCAGCAGG - Intergenic
982823909 4:159978226-159978248 TAGGGGAACGACACAGCAGCAGG + Intergenic
982885969 4:160783265-160783287 TAGGGGAAAGACACAGCAGCAGG - Intergenic
983583404 4:169331103-169331125 TAGGGAAACGACACAGCAGCAGG + Intergenic
983637960 4:169917414-169917436 TAGGGGAACGACACAGCAGTAGG - Intergenic
983674039 4:170271037-170271059 TAGGGGAACGACACAGCAGTGGG + Intergenic
986727645 5:10611425-10611447 CAGGCGAACCACACAGACACAGG - Intronic
987117085 5:14734322-14734344 TAGGGAAACAACACAGCAGCAGG + Intronic
988499469 5:31772384-31772406 CAGGAGAACAACACAGCAGTAGG + Intronic
988969697 5:36454742-36454764 TAGGGGAACGACACAGCAGCAGG + Intergenic
989388607 5:40877666-40877688 CAGGGGAACGACACAGCAGCAGG - Intergenic
989615896 5:43336303-43336325 TAGGGGAACCACACAGGAGTAGG - Intergenic
990992031 5:61695999-61696021 TAGGGTAAACACACAGGAGCAGG - Intronic
993055578 5:82975764-82975786 TAGGGGAACGACACAGCAGCAGG - Intergenic
994430440 5:99652892-99652914 CGGGGGAATGACACAGCAGCAGG + Intergenic
994578139 5:101607823-101607845 AAAGGGAAGCACACATTAGCAGG + Intergenic
994622636 5:102180968-102180990 TAGGGGAATGACACAGCAGCAGG - Intergenic
995128985 5:108609783-108609805 TAGGGGAACAACACAGCAGCAGG - Intergenic
995731622 5:115249437-115249459 TAGGGGAACAACACAGCAGCAGG - Intronic
995769823 5:115656601-115656623 CCTGGGATCCACACAGTAGAGGG - Intergenic
996101383 5:119449109-119449131 TAGGGGAATGACACAGCAGCAGG + Intergenic
997513598 5:134469271-134469293 TAGGGGAACCGGAGAGTAGCAGG - Intergenic
997754938 5:136387315-136387337 TAGGGGAACCACACAACAGCGGG + Intronic
998552228 5:143088770-143088792 TAGGGGAACGACACAGCGGCAGG - Intronic
998938323 5:147254628-147254650 TAGGGGAACGACACAGGAGCAGG - Intronic
999118586 5:149187884-149187906 TAGGGAAACGACACAGCAGCAGG + Intronic
999789968 5:154930250-154930272 TAGGGGAACGACACAGCAGCAGG + Intronic
1000110590 5:158104580-158104602 CTGGGGAACCACACAGGGGGTGG + Intergenic
1001558235 5:172650785-172650807 TAGGGGAACAACACAGCAGCAGG - Intronic
1001558861 5:172656070-172656092 TAGGGGAACGACACAGCAGCAGG - Intronic
1005344697 6:24877787-24877809 TAGGGGAACGACACAGCAGTAGG - Intronic
1005716613 6:28555263-28555285 CAGATGAAACACACAGGAGCTGG + Intergenic
1005817188 6:29563287-29563309 TAGGGGAACGACACAGCAGTAGG - Intronic
1005853898 6:29845722-29845744 TAGGGGAATAACACAGCAGCAGG + Intergenic
1005997580 6:30940756-30940778 CAGAGGAACCAGAAAGGAGCAGG - Intergenic
1006326217 6:33355948-33355970 TAGGGGAACGAAACAGCAGCAGG - Intergenic
1007770130 6:44185617-44185639 TAGGGGAACGACACAGCAGCAGG + Intergenic
1008046007 6:46851878-46851900 CAAGGAAAGCACACAGTATCAGG - Intergenic
1008104932 6:47431048-47431070 TAGGGGAACGACACAGCAGCAGG + Intergenic
1008280202 6:49587375-49587397 TAGGGGAATGACACAGCAGCAGG - Intergenic
1008580095 6:52898870-52898892 TAGGGGAACGACACAGCAGCAGG - Intronic
1009191179 6:60631781-60631803 CAGGGCAACCAGGCAGGAGCAGG - Intergenic
1009635385 6:66258982-66259004 TAGGGGAATGACACAGCAGCAGG + Intergenic
1010397155 6:75405683-75405705 TAGGGGAACGACACAGCAGCAGG - Intronic
1011317236 6:86049069-86049091 TAGGGGAACCACACAGCAGCAGG - Intergenic
1011569955 6:88724921-88724943 TAGGGGAAGGACACAGCAGCAGG + Intronic
1012672577 6:102073822-102073844 CAGGGGAACAACACAACAGTAGG - Intergenic
1013058936 6:106612846-106612868 TAGGGGAATGACAGAGTAGCAGG + Intronic
1013549233 6:111190784-111190806 CAGGGGGGCCACACAGCAGGGGG + Intronic
1013814580 6:114082897-114082919 CAGGGGAACAACACAGCAGCAGG + Intronic
1014110260 6:117612763-117612785 TAGGGGAACGACACAACAGCAGG - Intergenic
1014471486 6:121820473-121820495 CAGGGGAATGACACAGCAGTAGG + Intergenic
1015521414 6:134135293-134135315 TAGGGGAACGACACAGCAGCAGG - Intergenic
1016813134 6:148280246-148280268 CAGGGCAACCACCCAGAGGCAGG - Intronic
1017133479 6:151128335-151128357 TAGGGGAACGACACAGCAGCAGG + Intergenic
1017177970 6:151522591-151522613 TAGGAGAACAACACAGCAGCAGG + Intronic
1017972519 6:159325581-159325603 GAGGCGAACCTCAAAGTAGCGGG + Intergenic
1018181218 6:161225314-161225336 TAGGGGAAGGACACAGCAGCAGG + Intronic
1020459947 7:8418002-8418024 TAGGGGAACTACACAGCAGCAGG + Intergenic
1020655996 7:10928541-10928563 TAGGGGAACGACACAGCAGCAGG + Intergenic
1020745665 7:12075246-12075268 TAGGGGAAAGACACAGTAGTAGG + Intergenic
1021275272 7:18642360-18642382 CAGGGGAACCACAGAAAAGTAGG - Intronic
1022746705 7:33180224-33180246 TAGGGGAACAACACAGCAGTAGG + Intronic
1023436081 7:40141931-40141953 TAGGGGAATGACACAGCAGCGGG - Intronic
1023436802 7:40147999-40148021 TAGGGGAACAACACAGCAGCAGG - Intronic
1023443737 7:40210692-40210714 TAGGGGAACGACACAGTAGCAGG - Intronic
1023798075 7:43810457-43810479 TAGGGGAATGACACAGCAGCAGG + Intergenic
1023799318 7:43819776-43819798 TAGGGGAACGACACAGCAGCAGG + Intergenic
1023799755 7:43823696-43823718 TAGGGGAACGACACAGCAGCAGG + Intergenic
1024324940 7:48102101-48102123 CAGGGTGAGCCCACAGTAGCTGG + Intronic
1025213459 7:57035073-57035095 CATGGAAACCACAGAGCAGCCGG - Intergenic
1025658494 7:63541750-63541772 CATGGAAACCACAGAGCAGCCGG + Intergenic
1026799261 7:73388548-73388570 TAGGGGAATGACACAGCAGCAGG - Intergenic
1027729949 7:81858837-81858859 TAGGGGAACGACACAACAGCAGG - Intergenic
1028333443 7:89624428-89624450 TAGGGGAATGACACAGCAGCAGG + Intergenic
1028793355 7:94878024-94878046 TAGGGGAACCGCACAGCAGCAGG + Intergenic
1029180006 7:98693552-98693574 CAGGGTAACCACACAGCTCCTGG + Intergenic
1029470433 7:100751111-100751133 CAGTGGAATCACAGAGTTGCTGG + Intronic
1029819552 7:103132682-103132704 CAAGGGATCCTCCCAGTAGCTGG - Intronic
1031945700 7:127837983-127838005 CAGGGGAACAACATAGCAGTAGG - Intronic
1032326887 7:130937179-130937201 CAGGAGAAGCACCCAGTAGATGG + Intergenic
1033092924 7:138403485-138403507 TAGGGGAACGACACAGCGGCAGG + Intergenic
1033096802 7:138439336-138439358 TAGGGGAATGACACAGCAGCAGG - Intergenic
1033737221 7:144234439-144234461 GAGGGGAACAACACAGTACTGGG + Intergenic
1033745836 7:144316507-144316529 GAGGGGAACAACACAGTACTGGG - Intergenic
1035140908 7:156759849-156759871 TAGGGGAACGACACACTAGTAGG - Intronic
1036051739 8:5206405-5206427 CAAGGGAGCCAGACAGTAGTAGG - Intergenic
1036210922 8:6840797-6840819 CAGGGCAAACACCCAGTAGGTGG + Intergenic
1036642573 8:10593344-10593366 CAGGGGAACCACACTGGACTGGG + Intergenic
1037196397 8:16196296-16196318 CAGTGGAACCACAAACTGGCAGG + Intronic
1037663360 8:20945298-20945320 CAGGGGAAGCACACAGAGCCAGG + Intergenic
1037711578 8:21359491-21359513 CAGAGGAGCCACCCAGGAGCTGG - Intergenic
1037814375 8:22103975-22103997 CAGCGGGACTACACAGTTGCTGG + Exonic
1039006096 8:33038788-33038810 CAGGGGAACTACACAGCAGCAGG + Intergenic
1041479159 8:58299003-58299025 CAGGGGAACGACACAGCAGCAGG - Intergenic
1041919317 8:63165182-63165204 TAGGGGAACAACACAGCAGAAGG + Intergenic
1042086995 8:65120382-65120404 TAGGGGAAGGACACAGCAGCAGG - Intergenic
1042088484 8:65133196-65133218 TAGGGGAAGGACACAGCAGCAGG - Intergenic
1043598370 8:81911392-81911414 TAGGGGAACAACACAGCAGTAGG - Intergenic
1044061084 8:87636520-87636542 TAGGGAAACGACACAGCAGCAGG + Intergenic
1044268059 8:90206392-90206414 TAGGAGAACGACACAGCAGCAGG + Intergenic
1044329234 8:90896944-90896966 TAGGGGAACGACACAGCAGCAGG + Intronic
1044831208 8:96251419-96251441 CAGATGAACCCCACAGTAACTGG + Intronic
1045104530 8:98878613-98878635 TAGGGGAAGAACACAGCAGCAGG + Intronic
1045186261 8:99841630-99841652 CTGGGAAACCACACAGTCCCAGG - Intronic
1046731290 8:117729006-117729028 CAAGTGAACCACACAATACCTGG - Intergenic
1046894980 8:119463005-119463027 CAGCGGAAACACACAGAAGCTGG + Intergenic
1047343970 8:124009586-124009608 CAGAAGAGCCACACAGGAGCTGG + Intronic
1047957227 8:129985110-129985132 CAGGGTTGCCACTCAGTAGCTGG + Intronic
1048388287 8:133934523-133934545 CAGGGGAATGACACAGCAGCAGG + Intergenic
1048606398 8:135972961-135972983 CAGGAGAACCATACATTAGAGGG - Intergenic
1048996107 8:139794593-139794615 CTGGGGGAGCACACAGTTGCTGG - Intronic
1049535844 8:143181366-143181388 CAGGGGGACCACGCAGCTGCGGG - Intergenic
1049609269 8:143545926-143545948 TAGGGGAACAACACAGCAACAGG + Intergenic
1050087439 9:1980631-1980653 CATCTGAACCACACAGTATCAGG - Intergenic
1050442069 9:5675119-5675141 GAGGGGAACGACACAGCAGCAGG - Intronic
1051090720 9:13404572-13404594 CAGGGCAATCACACAGGAGAAGG - Intergenic
1051273729 9:15379439-15379461 TAGGGGAACAACACAGCAGCAGG - Intergenic
1053110489 9:35455597-35455619 TAGGGGAACAACACAGCAGCAGG - Intergenic
1053111284 9:35461790-35461812 TAGGGGAATGACACAGCAGCAGG - Intergenic
1053651382 9:40173434-40173456 CAAGGAAAGCACACAGTATCAGG + Intergenic
1054533198 9:66202769-66202791 CAAGGAAAGCACACAGTATCAGG - Intergenic
1056642224 9:88381358-88381380 TAGGGGAATGACACAGCAGCAGG - Intergenic
1056646768 9:88419372-88419394 TAGGGGAATGACACAGCAGCAGG + Intronic
1056656143 9:88510858-88510880 TAGGGGAAGGACACAGCAGCAGG + Intergenic
1057226944 9:93297424-93297446 CAGGGGAAACAGACAGTGGAAGG - Intronic
1057788426 9:98105753-98105775 CAGGGGGAGCACAGAGTACCTGG + Intronic
1058635903 9:107038474-107038496 CAGGGGAATTACATAGTAGATGG - Intergenic
1061287605 9:129633057-129633079 CAGGGTTACCAGACAGGAGCTGG + Intronic
1062246635 9:135571760-135571782 TAGCGGAACGACACAGCAGCAGG - Intergenic
1185843320 X:3413756-3413778 CAGAGGAACCAAACAGGGGCTGG + Intergenic
1188743915 X:33817923-33817945 CAGAGGAAAGACACAGGAGCTGG - Intergenic
1189034081 X:37478618-37478640 TAGGGGAATGACACAGCAGCAGG + Intronic
1189034818 X:37484637-37484659 TAGGGGAATGACACAGCAGCAGG + Intronic
1189833079 X:44994759-44994781 TAGGGGAACGACACAGCAGCAGG - Intronic
1191147138 X:57178716-57178738 CATGGGAAGCAGAGAGTAGCAGG + Intergenic
1191889711 X:65927465-65927487 TAGGGGAATGACACAGCAGCAGG - Intergenic
1193145969 X:78076064-78076086 TAGGGGAATGACACAGCAGCAGG - Intronic
1194058334 X:89164602-89164624 TAGGGGAATGACACAGCAGCAGG - Intergenic
1195637634 X:107135493-107135515 CAGGGTAATCTCACAGTATCAGG - Intronic
1195846610 X:109236117-109236139 TAGGGGAACGACACAGTAGCAGG - Intergenic
1197213881 X:123850212-123850234 TAGGGGAACGACACAGCAGCAGG + Intergenic
1198117085 X:133554759-133554781 TAGGGGAACGACACAGCAGTAGG + Intronic
1198742681 X:139857631-139857653 TAGGGGAACAACGCAGCAGCAGG + Intronic
1198948518 X:142042083-142042105 TAGGGGAAAGACACAGCAGCAGG - Intergenic
1198965590 X:142226451-142226473 TAGGGGAACAACACAGCAGCAGG - Intergenic
1199278182 X:145970672-145970694 TAGGGGAATGACACAGCAGCAGG + Intergenic
1199670740 X:150146301-150146323 CAAGGGAACAACACAGATGCTGG - Intergenic
1199818378 X:151420621-151420643 GTTGGGAACCACACAGTAGAAGG + Intergenic
1200383761 X:155868105-155868127 TAGGGGAACGACACAGCAGTAGG - Intergenic
1200769494 Y:7110413-7110435 TAGGGGAACAACACAGCAGCAGG + Intergenic
1200801635 Y:7392515-7392537 CAGGGGAAGGACACAGAAGCAGG + Intergenic
1200802702 Y:7400859-7400881 TAGGGGAAGGACACAGAAGCAGG + Intergenic
1201231876 Y:11872823-11872845 CAGAGGAACCAAACAGGGGCTGG - Intergenic
1201297402 Y:12475853-12475875 TAGGGGTACAACACAGCAGCAGG - Intergenic
1201362547 Y:13168634-13168656 TAGGGGAACAACATAGCAGCAGG + Intergenic
1201474201 Y:14363273-14363295 TAGGGGAATGACACAGCAGCAGG - Intergenic
1201900847 Y:19045162-19045184 CAGGGGAATGACACAGCAGCAGG + Intergenic