ID: 1141297898

View in Genome Browser
Species Human (GRCh38)
Location 16:82786895-82786917
Sequence GTTTTTAAGGGTATTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 7, 3: 41, 4: 275}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141297893_1141297898 10 Left 1141297893 16:82786862-82786884 CCATGGTGTGTATGTGCCACATA 0: 2
1: 701
2: 21792
3: 12933
4: 9907
Right 1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG 0: 1
1: 0
2: 7
3: 41
4: 275
1141297894_1141297898 -6 Left 1141297894 16:82786878-82786900 CCACATAGAAAACAGTTGTTTTT 0: 1
1: 0
2: 1
3: 45
4: 473
Right 1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG 0: 1
1: 0
2: 7
3: 41
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141297898 Original CRISPR GTTTTTAAGGGTATTGGACA AGG Intronic
900199121 1:1395172-1395194 ATTTTTAAGTGTTTTGGAAATGG - Intronic
901729349 1:11267600-11267622 GTTTTTAAGGGGATTGTAGAGGG + Intergenic
902978469 1:20106688-20106710 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
905382293 1:37571573-37571595 GGTTTTAAGGGTTTTGGAGTGGG - Intronic
906019522 1:42615111-42615133 GTTTTTAAGGATTTTGGATTGGG + Intronic
906860469 1:49353689-49353711 GTTTGTATGGGTACAGGACAGGG - Intronic
908485941 1:64593663-64593685 ATTTTTAAAGGCATTGGAAATGG - Intronic
909034932 1:70586273-70586295 GTTGTTAAGGGTTTTGGAGCTGG - Intergenic
909486563 1:76180557-76180579 GTTTATATGGGTATAGGATAGGG - Intronic
909884132 1:80919385-80919407 GATTTTAAGGATATAGGAGAAGG + Intergenic
910150276 1:84134214-84134236 GTTTTTATGGGTATAGGATTTGG + Intronic
911001792 1:93173874-93173896 GTTTTTATGAGTATGGGAAAAGG + Intronic
912311779 1:108629885-108629907 TTTTTAAAGGGTATTAGTCAAGG + Intronic
912911849 1:113769173-113769195 GTTTTTAAAGGTTTTGGAATGGG - Intronic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
916973145 1:170046097-170046119 GTTTTTAAGGGTTTTGGACTGGG - Intronic
918009852 1:180576698-180576720 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
918564935 1:185918178-185918200 GCTTTTGAGGGTTTTGGACTTGG - Intronic
920418100 1:205812341-205812363 GTGTTTAAGGAGATTGGAAAAGG - Intronic
922013883 1:221622974-221622996 GTTTTTAAGTGTTTTGGAAGTGG + Intergenic
923863273 1:237913941-237913963 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG + Intergenic
1063162474 10:3429305-3429327 GTTTTTAACGGTTTTGGAGTGGG - Intergenic
1064526230 10:16259646-16259668 GTAATTAAGAGTAGTGGACAGGG - Intergenic
1065216901 10:23457879-23457901 GTTTCTAAGGGTTTTGGAGTGGG + Intergenic
1065735233 10:28745394-28745416 GTTTTTAAAGGTTTTGGAGTGGG + Intergenic
1066270994 10:33823472-33823494 GTTTTTAAGGATTTTGGAGTGGG - Intergenic
1067168402 10:43883674-43883696 GTTTTTAAGGGCATTGTTCTGGG - Intergenic
1067999840 10:51319846-51319868 CTTTTTCAGAGTCTTGGACATGG - Intronic
1068023073 10:51608338-51608360 GTTTTTATGGGTTTTGGAGTGGG + Intronic
1068812229 10:61269118-61269140 GCTTTTAAGGGTTTTGGAGTGGG + Intergenic
1069225408 10:65937950-65937972 GTTTTTTTGGATATAGGACAGGG - Intronic
1069250624 10:66261905-66261927 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1069411914 10:68162822-68162844 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1071371897 10:84959927-84959949 GTTTTTAAGGGGTTTGGAGTGGG - Intergenic
1071778143 10:88812100-88812122 TTTTTGAAGAGTTTTGGACAGGG + Intronic
1072437922 10:95430622-95430644 GTTTGTAAGGTTATTTGACTGGG + Intronic
1073174119 10:101540975-101540997 ATTTTTAATGCTATTGGAAAAGG + Intronic
1076352723 10:129829284-129829306 GTTTTTAATGCTATTGTAAATGG + Intergenic
1077712414 11:4550652-4550674 GTTTATAAGGGTACAGGATAGGG - Intergenic
1078346286 11:10552253-10552275 GTTTTTAAGGGTTTCGGAGTGGG + Intergenic
1078643499 11:13117224-13117246 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1079763085 11:24355756-24355778 CTTTTAAAGGGTCTTGGAGATGG - Intergenic
1080971415 11:37281623-37281645 GTTTTTAAGAGAAATTGACATGG + Intergenic
1081295039 11:41375453-41375475 GTTTTTAAGGGTAAGGTATAAGG + Intronic
1081818577 11:45968615-45968637 ATTTTTAAGAGTATTAGAGAAGG - Intronic
1083724538 11:64621362-64621384 GATTTGGAGGGTATTGGGCATGG + Intronic
1084632082 11:70359472-70359494 TTTTTTATGGGTTTTGGAGAGGG + Intronic
1085540419 11:77262743-77262765 GTTTTTAATGGTTTTGGAGTGGG - Intronic
1085946989 11:81284287-81284309 GTTTTTATGGGTATAGGATGGGG - Intergenic
1087551402 11:99654976-99654998 GTTTATAAGGGTTTTGGAATGGG + Intronic
1087798443 11:102478535-102478557 GTTTTTAAGGATTTTGGAGTAGG + Intronic
1088330345 11:108644503-108644525 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1090031316 11:123209089-123209111 GCTATTAAGGGTTTTTGACATGG + Intergenic
1090708587 11:129363960-129363982 ATTAATAAGGGTATTGAACAAGG - Intergenic
1091082172 11:132681313-132681335 GATTTTATGGGTACAGGACAGGG - Intronic
1092057839 12:5522230-5522252 GTTTTTACGGGTAGGGGACTAGG - Intergenic
1093100577 12:15023971-15023993 GATTTTAGGGGTACTGGAAAGGG + Intergenic
1094412569 12:30182709-30182731 GTTTTTATGGGTATAGGATGGGG - Intergenic
1097451650 12:59744259-59744281 GTTTTTATGGGTATGGGATGGGG - Intronic
1098744121 12:74213773-74213795 GTTTATATGGGTATAGGATAAGG + Intergenic
1099861625 12:88230425-88230447 GTTTTTAAGGGTAATGCGGATGG - Intergenic
1100705265 12:97193967-97193989 ATTTTTAAGGGTTTTGGAGAGGG + Intergenic
1102016833 12:109653652-109653674 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1102447282 12:113013224-113013246 GTTTTTAAGGGTTTGGGAGTGGG + Intergenic
1102653511 12:114460861-114460883 GTTGTTATGGGGATTGAACAAGG + Intergenic
1102844417 12:116163662-116163684 ATTTTTAAGTGTATTGAAAAGGG + Intronic
1103147777 12:118610430-118610452 ATTTTTAAGGGTATTGGTGTGGG + Intergenic
1104497986 12:129258730-129258752 GGCTTGAAGGGTACTGGACATGG + Intronic
1106305986 13:28510061-28510083 GTTTTTAAGTATAGTGGAAAAGG + Intergenic
1106663468 13:31826824-31826846 GTTTTTAAGGGTTTTGGGGTGGG - Intergenic
1107330163 13:39291087-39291109 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1107542969 13:41410350-41410372 CTTCTTAAGGGTAGTGGAGATGG + Intergenic
1107975044 13:45680428-45680450 GTTTATATGGGTATAGGATAGGG + Intergenic
1108253511 13:48589477-48589499 GTTTTTAAGGGTTTTGGAGGGGG + Intergenic
1108737032 13:53294914-53294936 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
1110074642 13:71224301-71224323 GTTTTTAAGTATATTTGAAAGGG - Intergenic
1110409397 13:75187246-75187268 ATTTTTAAGGGTTTTGGAGTGGG - Intergenic
1111772361 13:92614175-92614197 ATTTTTAATGGTATTAGACAAGG - Intronic
1112069066 13:95828016-95828038 ATTTTTAAGGGTTTTGGAGGGGG - Intronic
1112247703 13:97749512-97749534 GTTTTCAAGGGTTTTGGAGCAGG + Intergenic
1112860245 13:103821615-103821637 AATTTTAAGAGTATTGGATAAGG - Intergenic
1112929784 13:104719395-104719417 GTTTTTAAGGGTTTTCGAGCAGG + Intergenic
1113179390 13:107608543-107608565 GTATTTTAGGGTTTTGGACATGG - Intronic
1113613459 13:111664410-111664432 GATGTTGAGGGTTTTGGACAGGG + Intronic
1114227405 14:20751820-20751842 GTTTATAAGGGGTTTGGACCCGG - Intergenic
1114230395 14:20776412-20776434 GTTTTTAAGGAGTCTGGACAAGG - Intergenic
1115838381 14:37436098-37436120 GTTTTTGAAGGTATTTTACATGG + Intronic
1116479687 14:45383398-45383420 GTTTATATGGGTATAGGATAGGG - Intergenic
1116679496 14:47947477-47947499 ATTTTTGAGGATATTGGAAATGG + Intergenic
1118354631 14:65002739-65002761 GCTTTTAAGGGTTTTGGAGTGGG + Intronic
1118432893 14:65739480-65739502 GTCTCTAAGGGTGTGGGACAGGG + Intronic
1121159635 14:91725875-91725897 GTTTATATGGGTATAGGATAGGG - Intronic
1121596069 14:95163697-95163719 GTTTTTTAGGGTTTTGGAGTGGG - Intergenic
1121737491 14:96228617-96228639 GTTTTTATGGGTATAGGATGGGG + Intronic
1123850934 15:24355853-24355875 CTTTTTCAGGGTATTGGAGGTGG + Intergenic
1123973898 15:25534692-25534714 GTTTTTGAGGCTTTTGGACTCGG - Intergenic
1124220843 15:27848404-27848426 GGTTTTAAGGGTATTCCACGTGG + Intronic
1126129484 15:45326406-45326428 GATTTTAAGGGTTTTGGAGTGGG + Intergenic
1126226926 15:46281588-46281610 GTTCTCAAGGGTATTGTACTCGG - Intergenic
1128002679 15:64208158-64208180 GTTTTTGAGGTTATAGGACATGG - Intronic
1128198615 15:65784177-65784199 GTTTTGAGGAGTATTGGTCAGGG - Intronic
1128440254 15:67700540-67700562 GTTTTTCAGGGGAGAGGACAGGG + Intronic
1128464595 15:67899494-67899516 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1130938060 15:88486809-88486831 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1131786118 15:95912757-95912779 GTTTTTAATGATATTAGCCAAGG - Intergenic
1131998260 15:98154419-98154441 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
1132001517 15:98185275-98185297 GTTTTGAAGAGTACTGGTCAGGG + Intergenic
1132192138 15:99874652-99874674 ATTTTTCATGGTATTAGACAAGG + Intergenic
1133493868 16:6297674-6297696 GTTTATATGGGTATAGGATAGGG - Intronic
1134855377 16:17514378-17514400 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1135165990 16:20139538-20139560 GGTTTTAAGGGTTTTGGAGTGGG + Intergenic
1135396765 16:22137654-22137676 GTTTTTAAGGGTTTTGCAGTGGG + Intronic
1135850517 16:25959103-25959125 ATTTTTAAGGGTTTTGGAGTGGG + Intronic
1135915200 16:26599365-26599387 GTTTTTAAGGGTTTTGGAGTAGG + Intergenic
1136048627 16:27634940-27634962 GTTTTTAAGGGTTTTGGAGTAGG + Intronic
1136507409 16:30713727-30713749 GTTTGTCAGGGTATTGGGAATGG + Intronic
1138096237 16:54214210-54214232 GTTTCTAAGGGGAGGGGACATGG + Intergenic
1138246797 16:55473228-55473250 GTTTTTAAGGGCATCTGAAACGG + Intronic
1138787466 16:59864396-59864418 GTTTTTAAGGATTTTGGAGTGGG - Intergenic
1138884173 16:61054845-61054867 TTTTTTCAGGGTGTAGGACAGGG - Intergenic
1139283004 16:65785806-65785828 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1139438562 16:66951323-66951345 GTTTTTCAGGGGATTAAACATGG - Intergenic
1140335343 16:74099709-74099731 GTTTTTAAGGTTTTTGGAGTGGG - Intergenic
1141275733 16:82586472-82586494 GTCTGTAAGGGTATTGGCAAAGG + Intergenic
1141297898 16:82786895-82786917 GTTTTTAAGGGTATTGGACAAGG + Intronic
1143710698 17:8733175-8733197 GTTCTTAAGGGTCTTAGACAGGG - Intronic
1146313822 17:31791801-31791823 AGTTTTCAGGGCATTGGACATGG + Intergenic
1146712645 17:35056010-35056032 GTTTTTAAGGATTTTGGAGTGGG - Intronic
1148627553 17:49081295-49081317 GGTTTTAAGGGTTTTGGAGCAGG - Intergenic
1151111588 17:71684308-71684330 CTTTTGAAGGGTCTTGAACAAGG - Intergenic
1151272310 17:73006427-73006449 TTTTTAAAGGGTCTTGGAGAAGG + Intronic
1153369227 18:4295035-4295057 GTTTATACGGGTACAGGACAGGG + Intronic
1155323086 18:24638134-24638156 TTTTTTATGGGTATGGGGCAGGG + Intergenic
1156245956 18:35298351-35298373 GCTTGTGAGGGTAGTGGACATGG - Intergenic
1157063169 18:44317174-44317196 GTTTTTGATGCTATTTGACATGG - Intergenic
1157258350 18:46157831-46157853 GTTCTTAAGGGTTTTGGAGTGGG + Intergenic
1157509038 18:48254720-48254742 GTTTTTAAGGGCTTTGGAATGGG - Intronic
1157719601 18:49913757-49913779 GTTTATATGGGTATAGGATAGGG - Intronic
1159726546 18:71967681-71967703 GTTTTTATGGGTATAGGATGGGG - Intergenic
1159869545 18:73744791-73744813 GTTTTTAAGGCTATTACAAAAGG - Intergenic
1162178210 19:8847429-8847451 GTTTATATGGGTATAGGATAGGG + Intergenic
1162884866 19:13689412-13689434 GTTTCCAAGGTTATTGGGCAGGG - Intergenic
1163939265 19:20477625-20477647 GTTTTTAAGGGTAATGTGAACGG + Intergenic
1163942623 19:20508988-20509010 GTTTCTAAGGGAACAGGACAAGG + Intergenic
1164473290 19:28553620-28553642 GTATTTAAGGGTTTTGAACTTGG + Intergenic
1165145884 19:33729778-33729800 GTTTTTAAGGGTTTTGGAGTGGG + Intronic
1166367647 19:42285413-42285435 GTTTTCAGGGGTAAGGGACAGGG + Intronic
1167058452 19:47128292-47128314 CTTTTTAAGGGTTTTGGAGTGGG + Intronic
1167481148 19:49732322-49732344 GATTCTAAGGGTTTTGGACCAGG + Intergenic
1167583955 19:50362540-50362562 TATTTTAAGGGATTTGGACATGG - Intronic
1167959185 19:53092289-53092311 GATTTTAAGCGTATTTGATAGGG + Intronic
1168462176 19:56568135-56568157 GTTTCTAAGGCTAGTGGACCTGG + Intronic
927891548 2:26753431-26753453 GTTTTTAAGGGTTTTGGAGAGGG + Intergenic
928813073 2:35253437-35253459 GTTTTTACGGGTACAGGATAAGG - Intergenic
929088088 2:38188503-38188525 GTTTTTGAGGGTATTTGGAAAGG - Intergenic
930099549 2:47592232-47592254 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
931448770 2:62350044-62350066 GTTTTTAAGGATTTTGGAGTGGG - Intergenic
931760515 2:65412784-65412806 ATTTTTAAGGGTTTTGGAGTGGG - Intronic
933180897 2:79226364-79226386 GATTTTGAGAGTATTGCACAAGG + Intronic
933424587 2:82093763-82093785 ATATTTAAAGTTATTGGACAAGG + Intergenic
933517843 2:83328803-83328825 GTTTTTACAGGTATTGTAAAAGG - Intergenic
934108147 2:88715186-88715208 GATTTTAAGGGTTTTGGAATGGG + Intronic
934910634 2:98251225-98251247 ATTTTTATGGATATTGGAAAGGG - Intronic
937003900 2:118493649-118493671 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
938729276 2:134133748-134133770 GTTTTTAAGGGTTTTGGAAAGGG + Intronic
939700632 2:145386655-145386677 GTTTTTAAGGGTATAGGATGGGG - Intergenic
942763499 2:179427657-179427679 GTTTTCTGTGGTATTGGACAGGG + Intergenic
943474810 2:188340996-188341018 GTTTTTATGGGTACAGGATAGGG + Intronic
943625786 2:190197937-190197959 ATGGTTAAGGGAATTGGACATGG - Intronic
944479097 2:200136752-200136774 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
944891103 2:204118020-204118042 GTTTTTATGGGTATGGGATGGGG + Intergenic
948008222 2:234628853-234628875 GTTTATATGGGTACAGGACAGGG - Intergenic
1170530328 20:17284792-17284814 GTTTTTAAGGGTTATGGAGTGGG + Intronic
1173294342 20:41742631-41742653 TTTTTTATGGCTATTGTACATGG + Intergenic
1173915427 20:46704722-46704744 GATTTTAAGGGTTTTGGAGTGGG + Intergenic
1174913478 20:54631563-54631585 GTTTTTCTGGGTAATGGATACGG + Intronic
1177497744 21:21910934-21910956 GTTTTTATGGGTACAGGATAGGG + Intergenic
1179599264 21:42465123-42465145 GTTTTTAAGGGTTTTGGCGTAGG + Intergenic
1179667373 21:42922174-42922196 GATTTTAAGGGTAATGCAGAAGG + Intergenic
1181004358 22:20004114-20004136 CTTTTTAATGGTATTGTAAATGG - Intronic
1181560102 22:23695077-23695099 GTTTGGAAGGGCATTGGACCAGG + Intronic
1181975589 22:26727039-26727061 GTTTGGAAGGGTCTTGGAAAGGG + Intergenic
1183283510 22:36947561-36947583 GTTTTTAAGGGGATTATAGAGGG - Intergenic
949358126 3:3203064-3203086 GTCTTTAAGGGTTTTGGAGTGGG - Intergenic
949789194 3:7774176-7774198 TTTTTTAAGGCTATTGGAGAGGG - Intergenic
950204412 3:11067746-11067768 GTTTTTATGGGTATAGGATGTGG - Intergenic
953155643 3:40370091-40370113 GTTTTTCAGGCTATTGTAAATGG - Intergenic
958467362 3:94473894-94473916 GTTTTTATGGGCACAGGACAGGG + Intergenic
959195517 3:103175629-103175651 GTGTTTAAGGGTTTTGGAGTGGG + Intergenic
960359826 3:116697810-116697832 GTTTATATGGGTACAGGACAGGG + Intronic
963500691 3:146121689-146121711 GTTTTTCAGGGAATTGCAGAGGG + Intronic
963513038 3:146273191-146273213 GTTTTTAAAGCTAATGGACATGG - Intergenic
965314333 3:167172582-167172604 GTTTTTAAGGGTTTTGGAATGGG - Intergenic
966318532 3:178675860-178675882 ATTATTAAGGTTATTGCACAGGG - Intronic
966434710 3:179870408-179870430 GTTTTTAAGGGTCTTGGAGTGGG - Intronic
970149818 4:13077335-13077357 GTTTTTAAGGGCATCTGAAATGG - Intergenic
970593014 4:17576063-17576085 GTTTTTAAGGGTTTTGGAGAGGG - Intergenic
971482055 4:27123811-27123833 GTTTTTAAGGGTTTTGGAGTGGG - Intergenic
973112660 4:46414482-46414504 GTTTCTAAGGGTGTTGGAGTGGG + Intronic
973141071 4:46768444-46768466 GTTTTTATGGGAACAGGACAGGG + Intronic
974318793 4:60316803-60316825 TTTATTAAGGGTATTGCATATGG + Intergenic
974404712 4:61450747-61450769 ATGTTTAAGGCTATTGTACATGG - Intronic
974650740 4:64750670-64750692 GTTTTTAAGGGTTTTAGAGTGGG + Intergenic
978579176 4:110215640-110215662 GTTTTTAAGGGGATCGTAGAGGG + Intergenic
978878713 4:113674090-113674112 CTTCCAAAGGGTATTGGACATGG - Intronic
979067860 4:116161138-116161160 GTTTTCCAGGGTTTGGGACAGGG - Intergenic
981103470 4:140855441-140855463 GTTTATATGGGTACAGGACAGGG + Intergenic
981438809 4:144758671-144758693 TTTTTTGAGGGTGTTGTACAAGG - Intergenic
983235721 4:165177181-165177203 GACTTCAAGGGTATTGGATAAGG + Intronic
983888685 4:173008623-173008645 ATTTTTAAGGGTTTTGGAGTAGG + Intronic
984905329 4:184621013-184621035 GCTTTTAAGGGTTTTGGAGTGGG - Intergenic
986038167 5:3960692-3960714 GATTTTGAGGGTGTTGGACTAGG + Intergenic
986089300 5:4488281-4488303 TATTTTTAGGGTACTGGACAAGG + Intergenic
986677297 5:10197209-10197231 GGTTTTAAGGGTTTTGGACTTGG + Intergenic
986967441 5:13291237-13291259 GTTTTTGGGGGTCTTGGTCATGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991076906 5:62550436-62550458 GTTTTCAAGGGTATTATAGAAGG + Exonic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991318961 5:65346938-65346960 TTTTTTAATGGTATTGTAAATGG - Intronic
992331896 5:75725555-75725577 GTTTTTAAAGGTCTTGGAGTGGG + Intergenic
992872580 5:81021858-81021880 GTTTTTAAAGGGTCTGGACAGGG + Intronic
992992523 5:82298640-82298662 GTTTATATGGGTACTGGATAGGG + Intronic
993221587 5:85105057-85105079 CTTTTTAAGGCAATGGGACAAGG + Intergenic
994702438 5:103152688-103152710 GCTTCTAAGGGTATTGACCATGG - Exonic
995253096 5:110016959-110016981 GTTTTTAAATGAATTTGACAAGG + Intergenic
995269808 5:110207423-110207445 ATTTTGAAAGGTATTGGTCAAGG + Intergenic
995533613 5:113114584-113114606 GTTTTTATGGGTATAGGATGGGG - Intronic
995790898 5:115885324-115885346 GTTTTTGAGGCTTTTGGACTCGG - Intronic
996671572 5:126123603-126123625 GTTTTTATGGGTAGAGGATAGGG + Intergenic
996999243 5:129739585-129739607 ATTTTTGAGGGTATTGGTCGAGG + Intergenic
998076291 5:139239446-139239468 GTTTTTAAAGGTTTTGGAGTGGG - Intronic
998633467 5:143926671-143926693 GTTTTTAAGTCTATTGGAAATGG - Intergenic
1000012557 5:157246179-157246201 GTTTTTAGAGATACTGGACATGG + Intronic
1000313888 5:160070579-160070601 GTTTTGCAGGGAATGGGACAAGG - Intronic
1001616637 5:173048155-173048177 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1003461112 6:6329271-6329293 GTGTTTTATGGAATTGGACATGG + Intergenic
1004289943 6:14357581-14357603 GATTTTAAGGGTTTTGGAATGGG + Intergenic
1007868038 6:44996008-44996030 GTTTTTCATAGTATTGGAAATGG - Intronic
1011510274 6:88093188-88093210 GTTTATATGGGTACAGGACAGGG - Intergenic
1013375907 6:109514017-109514039 GTTTTTAAGAGTTTTGGAGTGGG - Intronic
1013659122 6:112276582-112276604 CTTTTGAAGGGTAATGGAGATGG - Intergenic
1014508040 6:122282940-122282962 GTTTTAATGGATATTGGTCAGGG - Intergenic
1014635660 6:123843486-123843508 GTTTTTATGGGTACAGGGCAAGG + Intronic
1015288513 6:131511249-131511271 GTTTATATGGGTATTGGACAGGG - Intergenic
1015335730 6:132035826-132035848 GTTTTTTGTGGTATTGCACATGG + Intergenic
1015460506 6:133486161-133486183 GTTTTTCATGGAATTCGACAAGG - Intronic
1017386973 6:153897622-153897644 GTTTTTGAGGGAATAGGGCAGGG - Intergenic
1017497004 6:154992166-154992188 GTTGTTAAGCATAGTGGACATGG + Intronic
1017580895 6:155864319-155864341 GCTTTTAAGATTATTAGACAGGG + Intergenic
1017584825 6:155909208-155909230 GTTTTTATGGGCACAGGACAGGG - Intergenic
1018543514 6:164910552-164910574 TTTTTTAATGCTATTGTACATGG - Intergenic
1020402750 7:7796850-7796872 GTTTTTAAGGGTTTTGGAGTGGG - Intronic
1020586989 7:10080664-10080686 GTTTTTAAGGGTTCAGGGCAGGG - Intergenic
1021593224 7:22287559-22287581 GTTTTTGGGGGTATTGGAATGGG - Intronic
1025716822 7:63965107-63965129 GTTTTTATGGGCAATGTACAGGG + Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026642182 7:72137088-72137110 ATATTTAAGGGTTTTGGAAAGGG + Intronic
1027166690 7:75839604-75839626 GTTTTTTAGGGTTTTGGAGTAGG + Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027596939 7:80185544-80185566 GTTTTTAGGGGTTTTGGAGTGGG - Intronic
1028580781 7:92408027-92408049 GTTATCAAAAGTATTGGACATGG - Intergenic
1029006743 7:97218803-97218825 TTCTTTAAGGGTATTGCATAAGG - Intergenic
1029016084 7:97316584-97316606 GTTTTTATGGGTATAGGATGGGG - Intergenic
1030101759 7:105952985-105953007 GTTTTTATAGGCATAGGACAGGG - Intronic
1030805238 7:113909686-113909708 GTTATTGAGGTTATTTGACATGG + Intronic
1031228555 7:119074463-119074485 ATTTTCAAGGGTATGTGACATGG - Intergenic
1031438716 7:121765218-121765240 GATATTAAGAGTAATGGACAGGG + Intergenic
1031610623 7:123822390-123822412 ATTTTTAATGGTATTGTAAATGG + Intergenic
1031782374 7:125985054-125985076 GTTTTTATGGGTACAGGACAGGG - Intergenic
1032357018 7:131220572-131220594 GTTATTAAGGGTTTTGGAGTGGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1035430444 7:158816111-158816133 GTTTTTAAGGATACTGGAGATGG - Intronic
1036509976 8:9391173-9391195 GTTTTTAAGAGTTTTGGAGTGGG + Intergenic
1039271198 8:35882658-35882680 GTTTTTAAGGATTTTGGAGTGGG - Intergenic
1040680376 8:49801721-49801743 GTTTTTAAGAGTTTTGGAATGGG - Intergenic
1040768724 8:50947860-50947882 GTTTTTAAGGGAATTTGAAAGGG - Intergenic
1040856114 8:51949776-51949798 GTTTTTAAGAGTGTTGGAATGGG - Intergenic
1041320842 8:56610996-56611018 GTTTTTAAGCGTATAGCACAGGG + Intergenic
1042395618 8:68288540-68288562 GTTGTTAAGGGTTTTGGAGTAGG - Intergenic
1043240938 8:77935196-77935218 TTTTTTAAAAGTATTGGAAAAGG - Intergenic
1043498920 8:80833875-80833897 GTTTTTAGGGGTTTTGGAATGGG + Intronic
1043701974 8:83300618-83300640 GTTTATATGGGTACTGGATAGGG - Intergenic
1044384807 8:91575142-91575164 ATTTTTAATGATATTGGAAATGG + Intergenic
1044509996 8:93064777-93064799 CTTTTTAAGGCTATTGTAAATGG - Intergenic
1045295219 8:100866594-100866616 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1047601623 8:126431524-126431546 GTTTTTAAGAGTATTGAAATGGG - Intergenic
1050274394 9:3981684-3981706 GTTTTTAAAGGAATTTGAAAAGG - Intronic
1051492748 9:17685050-17685072 GTTTTTAAGGGTGGTGTACTTGG + Intronic
1051733737 9:20176135-20176157 GTTTTTCAGGTTTTTGGTCATGG + Intergenic
1052231910 9:26164535-26164557 GTTTTTATGGGTACAGGATAGGG - Intergenic
1052560490 9:30078103-30078125 CTTTTTCAGGCTAATGGACATGG + Intergenic
1053127927 9:35598137-35598159 GTTTTTGAGGGTTTGAGACAGGG + Intergenic
1053477008 9:38389660-38389682 CTTTGTAAGGATATTGGACCTGG - Intergenic
1055222711 9:73956507-73956529 GTTTTTGTGGCTATTGGAAATGG - Intergenic
1055449254 9:76416118-76416140 GTTTTTATGGGTATGGGATGGGG - Intergenic
1056731355 9:89169132-89169154 GTTTTTAATAGTATTAGTCAGGG - Intronic
1056902017 9:90608702-90608724 GATTTTAAGGGTTTTGGAGTGGG - Intergenic
1058159068 9:101548057-101548079 TTTTTTAATGGTATTGTAAATGG - Intronic
1059829522 9:118079131-118079153 GTTTTTAATGCTATTGTAAATGG - Intergenic
1060815389 9:126632518-126632540 CTATTGAAGGTTATTGGACAGGG + Intronic
1061965116 9:134009186-134009208 GATTTTAAGAGAATTGGACTAGG - Intergenic
1185796743 X:2972065-2972087 GTTTTTATGGGCACAGGACAGGG + Intergenic
1186230670 X:7450260-7450282 GTTTATAAGGGTTTTGGAGTGGG + Intergenic
1186676209 X:11820055-11820077 GGTTTTAAAGGTATTTGTCAAGG - Intergenic
1189962912 X:46341508-46341530 GTTTTTAAGGGTTTTGGAGTGGG + Intergenic
1191052989 X:56214153-56214175 GTTTTTATGGGTATAGGATGGGG + Intergenic
1192089701 X:68140725-68140747 GTTTTTATGGGCACTGGATAGGG - Intronic
1193149213 X:78107048-78107070 GTTTTTAATGGAACTGGACCTGG + Intronic
1193846581 X:86479241-86479263 GTTTTTATGGGTATAGGATGGGG + Intronic
1195527685 X:105910678-105910700 GTTTTTAAGGGGATTGTAGAGGG + Intronic
1195605423 X:106801200-106801222 ACCTTTAAGGGTATTGGAAAAGG + Intergenic
1195858739 X:109358330-109358352 GTTTTTATGGGTATGGGATGTGG - Intergenic
1196641228 X:118064012-118064034 CATTTTAATTGTATTGGACAAGG + Intronic
1196914019 X:120513409-120513431 GTTTTAAAGGGTTTTGGAGTGGG - Intergenic
1197146768 X:123180552-123180574 GTTTGTAAGGGTTTGGGATAAGG + Intergenic
1197354150 X:125415030-125415052 GTTTTTAATGTTATTGTAAAAGG + Intergenic
1199304541 X:146251932-146251954 GGTTTTGAGGATTTTGGACATGG + Intergenic
1199362241 X:146935463-146935485 AATGTGAAGGGTATTGGACAGGG - Intergenic
1199362247 X:146935499-146935521 GATTTGAAGGGTATTGGACAGGG - Intergenic
1201300702 Y:12502350-12502372 GTTTATATGGGTACAGGACAGGG - Intergenic
1201923749 Y:19262346-19262368 GTTTATTAGAGTATTGGAGAGGG + Intergenic