ID: 1141298453

View in Genome Browser
Species Human (GRCh38)
Location 16:82791595-82791617
Sequence CAGCAAACAACAGTGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 34, 2: 93, 3: 122, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141298453_1141298461 23 Left 1141298453 16:82791595-82791617 CCATCCACCACTGTTGTTTGCTG 0: 1
1: 34
2: 93
3: 122
4: 310
Right 1141298461 16:82791641-82791663 TCCACCCCTCTGGATCCAGCAGG 0: 7
1: 55
2: 94
3: 138
4: 303
1141298453_1141298456 -6 Left 1141298453 16:82791595-82791617 CCATCCACCACTGTTGTTTGCTG 0: 1
1: 34
2: 93
3: 122
4: 310
Right 1141298456 16:82791612-82791634 TTGCTGCCGTCGCAGACCCGTGG 0: 1
1: 1
2: 3
3: 2
4: 33
1141298453_1141298460 13 Left 1141298453 16:82791595-82791617 CCATCCACCACTGTTGTTTGCTG 0: 1
1: 34
2: 93
3: 122
4: 310
Right 1141298460 16:82791631-82791653 GTGGCTGACTTCCACCCCTCTGG 0: 1
1: 1
2: 38
3: 102
4: 253
1141298453_1141298463 24 Left 1141298453 16:82791595-82791617 CCATCCACCACTGTTGTTTGCTG 0: 1
1: 34
2: 93
3: 122
4: 310
Right 1141298463 16:82791642-82791664 CCACCCCTCTGGATCCAGCAGGG 0: 9
1: 51
2: 111
3: 141
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141298453 Original CRISPR CAGCAAACAACAGTGGTGGA TGG (reversed) Intronic
900730972 1:4259485-4259507 CAGGAAACAATCATGGTGGAAGG - Intergenic
902043890 1:13511568-13511590 CAACCAACAACAGGGGTGAATGG + Intronic
902287311 1:15414869-15414891 GAGCAAACAACAGCTCTGGAGGG + Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
904535949 1:31199510-31199532 CCGCAGACAACAGAGCTGGAAGG + Intronic
907096539 1:51786502-51786524 TAGAAAACAATAGAGGTGGATGG - Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
907602967 1:55788546-55788568 CAGCAAAAAGCCATGGTGGACGG + Intergenic
907716967 1:56934914-56934936 CAGCAAACCCCAGTGCTGGTAGG - Intronic
907829167 1:58048074-58048096 CAGCCAAACACAGTGGTGGCAGG - Intronic
908717659 1:67087517-67087539 CAGCAAACAGAAGTGGTGGACGG - Intergenic
908723227 1:67148228-67148250 CGGCAATCAGCAGTAGTGGACGG + Intronic
908892679 1:68863845-68863867 CGGCCAACAGCAGTGGTGGACGG - Intergenic
909850088 1:80450975-80450997 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
910116685 1:83739210-83739232 TGGCAAACAGCAATGGTGGACGG + Intergenic
910590511 1:88924646-88924668 CGGCAAACAGCAGTGGTAGACGG - Intergenic
911699915 1:100940909-100940931 CAGCCAAGCACAGTGGTGGCAGG - Intronic
913132730 1:115856801-115856823 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
917097538 1:171414075-171414097 CGGCATTCAGCAGTGGTGGACGG + Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918687303 1:187433731-187433753 GATCAAACAACAGTGTTGCAAGG + Intergenic
918951491 1:191145919-191145941 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
920016358 1:202912810-202912832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
922683933 1:227624877-227624899 CAGCGATCAGCAGTGGTGGACGG + Intronic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923708297 1:236363758-236363780 CAGGAAACAACCGTGGCAGAAGG - Intronic
924132097 1:240920691-240920713 CAGCCAAGCACAGTGGTGGCAGG + Intronic
924653185 1:245948932-245948954 CAGCTGCCCACAGTGGTGGATGG - Intronic
924875793 1:248102811-248102833 CAACAAACCACAGTTGTGAAAGG + Intergenic
1064222575 10:13454648-13454670 GAGCATACAACAGCAGTGGAGGG + Intronic
1064423403 10:15209715-15209737 CAGCTAGAAACAGTGGTGCACGG - Intergenic
1064980662 10:21163281-21163303 CAGAAAATAACTGTGGTGGCAGG + Intronic
1065122591 10:22543743-22543765 GAGAAATCTACAGTGGTGGAAGG + Intronic
1065199862 10:23302012-23302034 CGGCAAACAGCAGAGGTGGACGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1065678928 10:28209061-28209083 AAGCTTACAATAGTGGTGGAAGG - Intronic
1065961509 10:30737804-30737826 CAGCAAAAAAGACTGGTGAAGGG - Intergenic
1066246839 10:33591964-33591986 CGGCAGACAGCAGTGGTGGACGG + Intergenic
1067455509 10:46416496-46416518 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1067631695 10:47968139-47968161 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1067828584 10:49597089-49597111 CAGGAAAGCACAGAGGTGGAGGG - Intergenic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068988851 10:63131015-63131037 CAGCAAACAGCGGTGGTGGACGG + Intergenic
1069037966 10:63665000-63665022 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1070829751 10:79411093-79411115 CAGCAGGCAACAGTGATGGATGG + Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071193392 10:83128329-83128351 CAGCAAGCGAGAGAGGTGGAAGG - Intergenic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071467768 10:85956965-85956987 CAGGAAACAATCATGGTGGAAGG + Intronic
1071556992 10:86612081-86612103 CGGCAAACAGCCGTGGTGGACGG - Intergenic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072650305 10:97290219-97290241 CGGCAAACAGCAGTGGTAGAGGG - Intronic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1075220919 10:120583872-120583894 CAGGAAACACCACTGGTGGTAGG + Intronic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1077651016 11:3972700-3972722 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1077803933 11:5571146-5571168 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1078307859 11:10208567-10208589 CAGGAAAGAACACAGGTGGAGGG + Intronic
1078630337 11:12997302-12997324 CAGCAAACAATAGAGCTGGAGGG - Intergenic
1078692812 11:13598784-13598806 CAGCAAACCCCAGTGGGAGATGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1079933258 11:26590806-26590828 CTGCAAATGGCAGTGGTGGACGG + Intronic
1080881486 11:36325361-36325383 TAGCAAACGGCAGTGGTGGACGG + Intronic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1082616078 11:55361270-55361292 CAACTAACCAGAGTGGTGGAAGG + Intergenic
1082767690 11:57181991-57182013 CAGGCAACAGCAGTGCTGGAGGG - Exonic
1083695313 11:64438628-64438650 CAGAAAACAACAAAGGTGGCCGG - Intergenic
1084462518 11:69303814-69303836 CAGCGAAGACCAGTGGTGGTCGG + Intronic
1084696423 11:70758339-70758361 CGGTGAACAGCAGTGGTGGATGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085147010 11:74209652-74209674 CAGGAAACCACAGTGGAGGCAGG + Intronic
1085161966 11:74355810-74355832 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1085601994 11:77863342-77863364 CGGCAAAGAGCAGTGGTGGACGG + Intronic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1086064362 11:82731297-82731319 CAGAAACCAACAGAGGTGGAAGG + Exonic
1086209292 11:84298865-84298887 CAGAACACAACAGTAGTGGTTGG + Intronic
1086591442 11:88519718-88519740 GAGCAAACAACCATGGTGGCAGG + Intronic
1087503501 11:98990834-98990856 CAGCAAAGAACAGTGCTAAAGGG - Intergenic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088533418 11:110835176-110835198 CAGTAAGAAATAGTGGTGGAGGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1089872203 11:121685601-121685623 CAGAGAACATCAGAGGTGGAAGG + Intergenic
1089985656 11:122810431-122810453 CAGCCAGCAACACTGGTGTATGG - Exonic
1090369543 11:126238821-126238843 CAGCAGACAACAGAGGTCAAAGG - Intronic
1090615164 11:128507587-128507609 CAGCAAACCCCAGAGGTGCATGG + Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091987124 12:4919820-4919842 CAGGAAACAAAAGCGGGGGAGGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1093173246 12:15882491-15882513 CAGCAAGCAACAGTCGACGAGGG - Exonic
1093899043 12:24608554-24608576 CAATAAAGAACAGTGGTGTAGGG + Intergenic
1094008116 12:25777230-25777252 CAGCAAAGCACAGTGGAAGATGG + Intergenic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1095552470 12:43459166-43459188 CAGCAAACAGCAGTGGTAGGCGG - Intronic
1095893114 12:47253062-47253084 TGGCAGACAGCAGTGGTGGATGG + Intergenic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096408982 12:51363899-51363921 CAGCTAGCAACAGTGGAGCAAGG - Intronic
1096754668 12:53789066-53789088 CAGCCAAGATCAGGGGTGGAAGG - Intergenic
1096826735 12:54284623-54284645 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1097318188 12:58195945-58195967 CAGCTAACCACAGAGGTGAAAGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097743481 12:63272421-63272443 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1097840840 12:64319958-64319980 CGGCAAACAGGAGTGGTGGACGG - Intronic
1098176352 12:67795601-67795623 CAGAAAAAAACAGTGCTGTAGGG + Intergenic
1098639878 12:72825637-72825659 CAGCAAACAGCAGTGGTAGACGG + Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1100256113 12:92884782-92884804 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1100816913 12:98395662-98395684 CACCAAAGAAGAGTGGTGGAGGG + Intergenic
1101064049 12:101001295-101001317 TAGGAAACAACAGTGGTGAGAGG + Intronic
1101555299 12:105803059-105803081 CGGCAAGTAACAGTGGTGGATGG + Intergenic
1103108847 12:118256297-118256319 CAGCTACCAGCAGTGTTGGAGGG - Intronic
1103168221 12:118789290-118789312 CAGGAAACAGCAGTGGGTGATGG - Intergenic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103873182 12:124106016-124106038 CGGCGATCAGCAGTGGTGGAGGG + Intronic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1105822111 13:24088908-24088930 CAGCAGGCAAAAGAGGTGGAAGG + Intronic
1106895845 13:34301552-34301574 CAAGAAACATCAGTGGAGGAAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1108090666 13:46846400-46846422 CACCAAACAAGAGTGGTTGGAGG - Intronic
1108667107 13:52643534-52643556 CAGCCAAGCACAGTGGTGGCAGG + Exonic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108922949 13:55698896-55698918 CAGCAAAAAACAGTTATTGATGG - Intergenic
1109034689 13:57241477-57241499 CAGCAAACAACAGTGTGGCTAGG - Intergenic
1109292837 13:60497167-60497189 CGGTGAACAGCAGTGGTGGATGG + Intronic
1109380903 13:61558304-61558326 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1109523589 13:63545146-63545168 CGGCCAACAGCACTGGTGGATGG + Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109931290 13:69221993-69222015 CAGCAAACAGTAGTGGTGGACGG - Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1110987077 13:81984444-81984466 TAGCAAACAGCAGTGGTGGATGG + Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111536801 13:89612121-89612143 CGGCAAACGGCAGTGGTGGACGG + Intergenic
1111699461 13:91667889-91667911 CAGCACACAACACTGCTGCAGGG - Intronic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1113318758 13:109211998-109212020 CAACAAACAAAAGGGTTGGAGGG + Intergenic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1114896256 14:26994545-26994567 CAGAAAACAACAGAGGTGGCTGG + Intergenic
1115151661 14:30293263-30293285 TGGCGAACAGCAGTGGTGGAAGG - Intergenic
1115451240 14:33550150-33550172 AAGAAAACAACAGTGGTGCTTGG - Intronic
1115485701 14:33909325-33909347 CAACAAAAAACAGTGTTGGCTGG - Intergenic
1116118809 14:40694756-40694778 CGCCAAACAGCAGTGGTGGATGG + Intergenic
1116740324 14:48746699-48746721 CAACAAACAACAGTGGTGGATGG - Intergenic
1116804156 14:49475358-49475380 AAGCAAAGAACAGTGGCAGAGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1118678443 14:68214100-68214122 CTGCAAACAACAGTTGTCCAGGG - Intronic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1120097376 14:80403859-80403881 CAGTGATCAGCAGTGGTGGACGG - Intergenic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120317318 14:82912174-82912196 TAGCAAACAGCAGTAGTGCAGGG + Intergenic
1120397381 14:83985581-83985603 GCGCAAACAGCAGTGGTGGATGG - Intergenic
1120741931 14:88118104-88118126 TATCAAACAACAGTGGGGAAAGG - Intergenic
1121732914 14:96198634-96198656 CAGCAACCCCCAGAGGTGGAGGG + Intergenic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123987289 15:25657029-25657051 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1124473975 15:30015144-30015166 CAGCTAACCACAGAGGTGAAAGG - Intergenic
1126153889 15:45547395-45547417 CAGCGAACAGCAGTGGTGGATGG + Intergenic
1126482444 15:49140964-49140986 AAGAAAACAGCAGAGGTGGATGG + Intronic
1126728345 15:51655636-51655658 CGGCAAACAGCAATGGTGGACGG + Intergenic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1126929057 15:53626463-53626485 CGGCAAAGAACAGTGGTGGACGG + Intronic
1127074522 15:55312237-55312259 CGGCAAACAACAGGGGTGGACGG + Intronic
1127647618 15:60974114-60974136 CTGCAGACAACAGAGGAGGAGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130265255 15:82395511-82395533 AAGCAAACAAAAGTGGAGGTTGG - Intergenic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1131493146 15:92880428-92880450 GAGCAAACAAGAGAGCTGGAGGG + Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132131474 15:99284513-99284535 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1133254603 16:4508972-4508994 CAGCAAGCAGCACTGGTGGGCGG - Intronic
1135017211 16:18933849-18933871 CAGCAAACATCAGGGATGGAAGG + Intergenic
1135388744 16:22070189-22070211 CAGCAAAGAACAGTGAAGCACGG + Intronic
1136670745 16:31854882-31854904 CAGATGACAGCAGTGGTGGATGG - Intergenic
1137836662 16:51598539-51598561 CAGAAACCAACAGTGGAGCATGG + Intergenic
1137841721 16:51646859-51646881 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1138097958 16:54228382-54228404 TAGAACACAACAGTGGGGGAAGG - Intergenic
1138274255 16:55720345-55720367 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1138943869 16:61823589-61823611 CAGAAAAAAACATTGGAGGAAGG + Intronic
1140346848 16:74221480-74221502 CTGCAAACAAATGGGGTGGAGGG - Intergenic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1141649238 16:85384366-85384388 CAGTAAACAGCAGAGGTGGGAGG - Intergenic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142735935 17:1899597-1899619 CAGGAAACAGAAGTGGGGGAGGG - Intronic
1145978214 17:28996444-28996466 CAGCAAACCTGAGTGGGGGAGGG + Intronic
1148371996 17:47106761-47106783 CGGCAAACAGCACTGGTGGACGG + Intergenic
1148736123 17:49865876-49865898 CTGCAGTCAACAGTGGGGGAGGG - Intergenic
1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG + Intergenic
1148924210 17:51067968-51067990 CAGAAGACAACAGAGATGGAAGG - Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1151017843 17:70577585-70577607 CGGCGAACAGCAGTGGTGAACGG - Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151897680 17:76991311-76991333 CAGGAAACAATCATGGTGGAAGG - Intergenic
1152242120 17:79166212-79166234 AAGCAAACACCAGTGTGGGAGGG + Intronic
1153389529 18:4538597-4538619 CAGGAAACAATCATGGTGGAAGG - Intergenic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153434663 18:5056687-5056709 CAGAGAAAAACAGTGGTAGAGGG + Intergenic
1155370828 18:25098463-25098485 CTGCAAACACCAGTTTTGGAAGG + Intronic
1155749242 18:29399246-29399268 CGGCAAACGGCAGTGGTGGATGG + Intergenic
1156003429 18:32412113-32412135 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1159430417 18:68345075-68345097 CAGAAAACAACAGTTATTGAAGG + Intergenic
1159777386 18:72619308-72619330 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1160102769 18:75938543-75938565 CGGCAAACAGCAATGGTGGACGG + Intergenic
1162600662 19:11665968-11665990 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1163901126 19:20101075-20101097 CGGCAAACAGCAGTGGTCGACGG - Intronic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1165093342 19:33397678-33397700 CAGCAAAGCCCAGTGGTGGGTGG + Intronic
1165560161 19:36672124-36672146 CCCCAAAGAACAGTGGTGAAGGG + Intergenic
1166027177 19:40097577-40097599 CAGAAGACACCAGTGGTTGATGG + Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
1168663754 19:58186788-58186810 AAGCCAACAACAGGGATGGATGG + Intronic
924973622 2:153902-153924 CGACAAACAGCACTGGTGGACGG + Intergenic
924974508 2:160386-160408 CGACAAACAGCCGTGGTGGATGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925517130 2:4695402-4695424 CAGGAAACAAAAGTGGGAGAAGG + Intergenic
926966714 2:18423093-18423115 AAGCATAAAACAGTGGTGGGAGG + Intergenic
927339300 2:21963332-21963354 CAGCAACCAACAGAGATGGAAGG + Intergenic
927820330 2:26258604-26258626 TGGCGAACAGCAGTGGTGGAAGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
928676629 2:33657541-33657563 CGGCAAACAGCAGTGGTAGATGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
932509253 2:72268825-72268847 AAGCATACAACCATGGTGGAAGG - Intronic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
932918178 2:75879091-75879113 CGGCAAACAGCAGTGGTAGACGG - Intergenic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933515841 2:83300501-83300523 CAGCAAACTACAGGTGTTGAGGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
935842597 2:107129512-107129534 CAGAAGACAACAGTGATGCAGGG + Intergenic
936249802 2:110859682-110859704 CTGCAAACAAGAGGGTTGGATGG + Intronic
936573548 2:113635462-113635484 CAGCAGGCAACAGTGGAGGGAGG - Intronic
936868889 2:117109655-117109677 CGGCAAACAGCAGTGTTGGATGG - Intergenic
937594968 2:123661568-123661590 CGGCAAACAGCTGTGGTGGACGG - Intergenic
937862646 2:126723000-126723022 CAGCAGACAGCAGTGGCAGAGGG + Intergenic
938479352 2:131646790-131646812 CAGCAAACACCAGCGGTTTATGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
940567673 2:155388670-155388692 CAGCAAACAAAAGAAGGGGAAGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
942265306 2:174218750-174218772 CAGCAAACCCCAGGGGTGGGAGG + Intronic
942580696 2:177413017-177413039 CGGCAAACAACAGTGGTGGATGG + Intronic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
942921750 2:181382803-181382825 CAGCAACCCAAAGTGGTGGCAGG + Intergenic
943019252 2:182552900-182552922 CGGCAAACAGCTGTGGTGGATGG - Intergenic
943955869 2:194188397-194188419 CAGCCAAACACAGTGGTGGCAGG + Intergenic
944177069 2:196842449-196842471 AAGCAAACAAGAGAAGTGGATGG - Intronic
944573100 2:201064130-201064152 CAGCCAAGCACAGTGGTGGCAGG + Intronic
945064768 2:205939542-205939564 TGGCAAATAGCAGTGGTGGACGG - Intergenic
945834118 2:214818945-214818967 TAGCACACACCACTGGTGGATGG - Intergenic
946903334 2:224393493-224393515 CATCAAACAATGGTGGTGGGAGG + Intronic
948574730 2:238942347-238942369 CAGGAAACAACCAAGGTGGAGGG + Intergenic
948685693 2:239668335-239668357 CTGCTGACAACAGTGGTGAATGG + Intergenic
948725854 2:239933453-239933475 CAGCCTACAGCAGTGGTGGCAGG - Intronic
948981143 2:241495480-241495502 CAGCACACTGCAGGGGTGGAAGG + Exonic
1168840772 20:908673-908695 CCTCAATAAACAGTGGTGGAAGG + Intronic
1169984734 20:11431235-11431257 AAGCAGAGAACAGTAGTGGATGG - Intergenic
1170354873 20:15480815-15480837 CAGCTAACCACAGTCATGGAGGG - Intronic
1170766968 20:19298548-19298570 CAGGAAACAACAGTAGAGGATGG + Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171187892 20:23136614-23136636 CAGCAAGCCGCAGAGGTGGACGG + Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1172781662 20:37440101-37440123 AAGCAAACAGCAGAGGTGGCAGG - Intergenic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173028689 20:39334183-39334205 AAGCAAATAACAGTTGTGTAGGG + Intergenic
1173779766 20:45745630-45745652 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178123362 21:29492004-29492026 AAGCCAACAACAGTGGTGTTTGG - Intronic
1178123470 21:29493137-29493159 AAGCCAACAACAGTGGTGTTTGG - Intronic
1178664842 21:34537592-34537614 CAGCAGCCATCATTGGTGGAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1179537337 21:42061046-42061068 CATGAGACAACAGAGGTGGAGGG - Intergenic
1181626924 22:24128663-24128685 GAGGAAACAGGAGTGGTGGAGGG - Intronic
1182248349 22:28978997-28979019 CAGCAAACTAAAGTAATGGAGGG - Intronic
1183649739 22:39147004-39147026 CAGCAAACAAGTGTGGCAGAGGG - Intronic
1184072506 22:42154769-42154791 CAGCAAACATGGGTGGTGGGTGG - Intergenic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1185426633 22:50775418-50775440 CAGCAGGCAACAGTGGAGGGAGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949907723 3:8872707-8872729 CACCAGGCAAAAGTGGTGGAGGG + Intronic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951107874 3:18766890-18766912 CAGAAAACAACGGTGCTTGAAGG - Intergenic
951201178 3:19876492-19876514 TGGCAAACAGCAGTGGTAGACGG + Intergenic
951326078 3:21303135-21303157 CGGAAAACAGCAGTGGTGGATGG + Intergenic
951880476 3:27476726-27476748 CAGGAAACAAATATGGTGGAAGG - Intronic
952921717 3:38289782-38289804 CGACAAACAGCAGTGGTGGACGG + Intronic
952922699 3:38296929-38296951 CGACAAACAGCAGTGGTGGACGG + Intronic
953515821 3:43591187-43591209 CGGCGAACAGCAGTGGTGGATGG - Intronic
954753332 3:52825941-52825963 CAGCAAGAAACAGTCCTGGACGG - Exonic
955064701 3:55524337-55524359 CAGGAAGGAACAGTGGTAGAAGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956612327 3:71136669-71136691 CAGCAAAAAACAGTTGTTGATGG - Intronic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957296912 3:78344277-78344299 CGGCAAACCCCAGTGGTGGATGG + Intergenic
957557721 3:81782297-81782319 CAGCAAACAACAATGGTGGATGG - Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958424501 3:93965270-93965292 CGGCAAACAGCAGTTGTGGACGG - Intronic
958457051 3:94345318-94345340 CAGTGAACAGCAGTGGTGGACGG + Intergenic
958547877 3:95578818-95578840 CAGCAAACTACATTGCTGGGAGG + Intergenic
959161776 3:102732820-102732842 CGGCAAACAACAGTGGTGGATGG + Intergenic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
962809497 3:138948729-138948751 CAGCAGACAACACTTGTAGATGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
963492266 3:146016733-146016755 CGCAAAACAGCAGTGGTGGAGGG - Intergenic
963575885 3:147060149-147060171 CGGCAAACAGCAGTGTTGGACGG - Intergenic
963664509 3:148166236-148166258 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
963915312 3:150854370-150854392 CAGCAAACAGCAGTAGCAGACGG - Intergenic
963964568 3:151351450-151351472 AAGCAACCAAGAGTTGTGGAAGG + Intronic
964099717 3:152974281-152974303 CAAAAAACAACAGTTGGGGATGG - Intergenic
964356511 3:155855970-155855992 CAGAAAAGAACAGTGTTGGCCGG + Intergenic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966994303 3:185265012-185265034 CGGCACTCAGCAGTGGTGGATGG - Intronic
967563088 3:190940034-190940056 CAACAAAAAACAGTGCTGAAAGG - Intergenic
968971039 4:3794019-3794041 CAGCAAGCAACAGAGGTGTTGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969645654 4:8427399-8427421 CAGCCATCAGCAGTGGTGGATGG - Intronic
969710913 4:8842902-8842924 CAGCAAACAACAATGTTGCTGGG - Intergenic
970050568 4:11909872-11909894 CAGAAAACAACAGTCGTTTAGGG + Intergenic
970206494 4:13660624-13660646 CACCAAACAATCGTGGTGCAGGG - Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971076770 4:23158374-23158396 CAGCGTACAGCAGGGGTGGATGG - Intergenic
971597770 4:28553910-28553932 AAACATACAACTGTGGTGGAAGG + Intergenic
971861144 4:32107630-32107652 CAGCAAACAATTGAGGTGAAAGG + Intergenic
972007760 4:34132474-34132496 CAGGAAACAATCATGGTGGAAGG - Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974477163 4:62398188-62398210 CAGCAAATTACATTGGTGAAAGG - Intergenic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974841794 4:67307594-67307616 CAGAGAACAGCAGTGGTGGATGG - Intergenic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976189289 4:82473690-82473712 CAGCAATCAGCAGTGGTAGATGG - Intergenic
976190167 4:82479711-82479733 CAGCAATCAGCAGTGGTGGATGG - Intergenic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
977926497 4:102705829-102705851 GAGGTACCAACAGTGGTGGATGG - Intronic
978046040 4:104128924-104128946 AGGCAAACAACTGTGGAGGATGG + Intergenic
978126150 4:105137509-105137531 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
978909017 4:114044497-114044519 TAGCCAGCAGCAGTGGTGGACGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980386303 4:132090774-132090796 CAGCAAACAGCAGTGATGGATGG + Intergenic
980476834 4:133329150-133329172 AAGCACACAATTGTGGTGGAAGG + Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
982765081 4:159337236-159337258 CATAAAAAAACAGTGGTGCATGG - Intronic
982886242 4:160786398-160786420 CTACAAAAAACAGTTGTGGATGG - Intergenic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG + Intergenic
984365393 4:178792990-178793012 GAGCAAAAAGCAGAGGTGGAGGG - Intergenic
985226354 4:187765516-187765538 CAGCTAACAGTAGTGGTGGATGG - Intergenic
985350731 4:189058645-189058667 CAGACAACAGCGGTGGTGGACGG - Intergenic
986283830 5:6345590-6345612 CAGCAGAGAACAGAGGAGGAGGG + Intergenic
986435036 5:7721046-7721068 CAGGAAACAACAGGTGTTGAAGG - Intronic
987738468 5:21874686-21874708 CTGTGAACAGCAGTGGTGGATGG - Intronic
987855123 5:23411299-23411321 CGGCGATCAGCAGTGGTGGACGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
987934150 5:24442494-24442516 CAGCAAACCACCATGGTGCATGG - Intergenic
987934919 5:24451359-24451381 CAGCATTCAGCAGTGATGGACGG + Intergenic
988619231 5:32805339-32805361 CAGCAGGCAACAGGGGTGAAAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988806144 5:34742622-34742644 CAGCAAACTGCAGTAGTGTATGG - Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
990729014 5:58787889-58787911 TAGCCAACAACAGTGGAGGGAGG - Intronic
990736611 5:58870745-58870767 CAGGAAACAAAAATGGTGTAAGG - Intergenic
990891806 5:60658870-60658892 TGGTAAACAGCAGTGGTGGATGG - Intronic
990892804 5:60666076-60666098 TGGCAAACAACAGTGGTGGACGG - Intronic
991290608 5:65030855-65030877 CCGGAAACGGCAGTGGTGGATGG - Intergenic
991542920 5:67749333-67749355 CTACAAAGAACAGTGCTGGATGG - Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992808120 5:80358976-80358998 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993590947 5:89794630-89794652 CGGCCAACAGCAGTGGTGGATGG - Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
995187265 5:109285033-109285055 CAGCAAAAAGCAGTGCTAGAAGG + Intergenic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995717278 5:115092614-115092636 CAGCTATCAGCAGTGGTGGATGG - Intergenic
997028151 5:130090521-130090543 AAGCAAGCAACAGTGGTGAGAGG - Intronic
997759350 5:136429940-136429962 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
998467952 5:142360953-142360975 CAGCAAACAAGAGCGGAGGAGGG + Intergenic
998939787 5:147268990-147269012 CAGTAAAGAACAGTGTTGGAGGG + Intronic
1000187014 5:158869041-158869063 CAGAAAACACCAGTCCTGGACGG - Intronic
1001170081 5:169410960-169410982 CTGAAAACAAGAGTGGAGGAAGG - Intergenic
1002919203 6:1554365-1554387 CAGCAGACACCAGTGGCGTAGGG - Intergenic
1003300419 6:4876120-4876142 CAACAAACAACAAGGGTGGGAGG - Intronic
1003379335 6:5609126-5609148 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1004354636 6:14920427-14920449 CAGCAGACACCAGAGCTGGAAGG + Intergenic
1005255896 6:24002508-24002530 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1005454859 6:26009552-26009574 CACCATACAACAATGGTGAAAGG + Intergenic
1005610934 6:27524424-27524446 CAGCCAAGCCCAGTGGTGGAAGG + Intergenic
1005640543 6:27792163-27792185 CAGCAATCAGCTGTGGTGTAGGG - Intergenic
1005816651 6:29558585-29558607 TGGCAAACGGCAGTGGTGGATGG - Intronic
1006204265 6:32326257-32326279 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1006276020 6:33006315-33006337 CAGCTAACAACAGTTCTGAAGGG - Exonic
1006538511 6:34720423-34720445 CAGCCACCAACAGTGGTTGTGGG - Intergenic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1009351426 6:62684253-62684275 CAGTGATCAGCAGTGGTGGACGG + Intergenic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009702457 6:67201713-67201735 CGGCAAACAGCAGTGTTGGATGG - Intergenic
1011190324 6:84720755-84720777 CAGCGAACAGCAGTGGTGGATGG + Intronic
1011241822 6:85279799-85279821 CAGGAAAAAACAGGGGAGGAGGG - Intergenic
1011540395 6:88421360-88421382 CGGCAAACAACAGTGGTGGACGG + Intergenic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014685171 6:124488586-124488608 AAGCAAAGCACAATGGTGGAGGG + Intronic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018481995 6:164200297-164200319 CAGAAAACTGCATTGGTGGATGG + Intergenic
1019716187 7:2540544-2540566 CAGCAGACAACTTTGGAGGAAGG - Intronic
1019843777 7:3476279-3476301 CAGCAAACAGCTGTGGGTGATGG - Intronic
1020906203 7:14067210-14067232 CGGCAAACAGCAGTGGTGGGCGG - Intergenic
1021144253 7:17065920-17065942 CAGCGAACAGCAGTGGTGGACGG - Intergenic
1021545984 7:21813182-21813204 CAGCAAACAACAACTTTGGATGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022989913 7:35696639-35696661 CGGCAGACAGCAGTGGTGGACGG - Intergenic
1023282935 7:38590385-38590407 CGGCATTCAGCAGTGGTGGATGG + Intronic
1023319592 7:38978981-38979003 CAGATAACTAAAGTGGTGGAAGG + Intronic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024285348 7:47752273-47752295 CAGCAAACCACAGAGGTGCCAGG + Intronic
1025041388 7:55648986-55649008 CAGTAAACATCAGTAGTGAAGGG - Intergenic
1026346967 7:69482805-69482827 CGGCAAACAGCGGTGGTGGACGG - Intergenic
1027964210 7:84984588-84984610 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028469954 7:91195025-91195047 GAGCAAAGAACAGTGGTTGCAGG - Intronic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030431253 7:109452177-109452199 CGGCAAACTGCAGTGGTGGACGG - Intergenic
1030699935 7:112627155-112627177 CAGGAAACAATCATGGTGGAAGG + Intergenic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1032425796 7:131821204-131821226 CGGCATTCAGCAGTGGTGGAGGG + Intergenic
1032447557 7:131997660-131997682 GAGCAAACAGGAGTGATGGATGG - Intergenic
1032558469 7:132862508-132862530 CAGCAAGTCACACTGGTGGAGGG + Intronic
1032725108 7:134583880-134583902 CAACCAACAAAAGTGCTGGAAGG - Intergenic
1033505403 7:141994827-141994849 CAGGAAACAATCATGGTGGAAGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1036137884 8:6179073-6179095 CAGCAAACAGAAGGGGTTGAAGG - Intergenic
1036456472 8:8913287-8913309 CAGGAAACAATCATGGTGGAAGG - Intergenic
1037123421 8:15317001-15317023 CGGCAAAGAGCAGTGGTGGATGG + Intergenic
1038576342 8:28706762-28706784 AAGCAATCAACAGTGGTCAACGG - Intronic
1038683697 8:29695192-29695214 GAGAAAACAAAAGTGGTAGAAGG - Intergenic
1038750874 8:30294620-30294642 CAGGAAACAATCATGGTGGAAGG - Intergenic
1038858433 8:31359084-31359106 GAGCAAACCACAGTGGTGACTGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039711764 8:40062145-40062167 CAGGTGCCAACAGTGGTGGACGG - Intergenic
1039711777 8:40062189-40062211 CAGGTGCCAACAGTGGTGGATGG - Intergenic
1040082399 8:43300523-43300545 CAGCAAGCAAAAGTGGTGTGAGG - Intergenic
1040829464 8:51661270-51661292 CAGCAATCAACAGCGGAAGATGG - Intronic
1041196939 8:55410206-55410228 CAGCGAGCAGCAGTGGAGGATGG - Intronic
1041729315 8:61048830-61048852 CAGAAAAAAACAGTGAGGGAGGG - Intergenic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1042715282 8:71765667-71765689 AAGCAAACAATCATGGTGGAAGG + Intergenic
1043589284 8:81808812-81808834 CAGCCAAGCACAGTGGTGGCAGG + Intronic
1043628236 8:82291523-82291545 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1044988295 8:97774203-97774225 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046424572 8:114030113-114030135 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1047500301 8:125435309-125435331 GAGCAAACAAAAGTGGCTGATGG - Intronic
1048631490 8:136247645-136247667 CAGCAAACAGCAGTGGTGAATGG - Intergenic
1048890913 8:138945658-138945680 CAGAAAAAAACAGTAGTGCAAGG + Intergenic
1050373229 9:4944569-4944591 CAGCCAAGCACAGTGGTGGCAGG - Intergenic
1050593498 9:7183541-7183563 TAGCAAACAGCAATGGTAGACGG - Intergenic
1050863757 9:10470800-10470822 AAGGAAACAGGAGTGGTGGAGGG + Intronic
1051546693 9:18283567-18283589 CTGCAAACCACAGTGGTTGAAGG + Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1051970178 9:22878077-22878099 CAGCCAACAGCAGTGGTGGACGG + Intergenic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1055789844 9:79911963-79911985 CGGTAAACAGCAGTGGTGGACGG + Intergenic
1055988016 9:82073086-82073108 CAACAGACACCAATGGTGGAGGG + Intergenic
1056645759 9:88410428-88410450 CAGCCAAGCACAGTGGTGGCAGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058041975 9:100312595-100312617 CTGCAAAAAACAGTGGAGAATGG - Intronic
1058560648 9:106225543-106225565 TAGCAAACTACATTGGAGGATGG + Intergenic
1059367781 9:113800177-113800199 CAGAAAACAGCAGCTGTGGAGGG + Intergenic
1059404269 9:114090243-114090265 CAACAAACAACACTGATGGCTGG - Intronic
1203495320 Un_GL000224v1:145850-145872 CAGAAAACAACAGTAGTGTTTGG - Intergenic
1203507945 Un_KI270741v1:87773-87795 CAGAAAACAACAGTAGTGTTTGG - Intergenic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1188285579 X:28322485-28322507 CGGCGAACAGCAGTGGTGGACGG - Intergenic
1189152100 X:38719513-38719535 CGGCGAACAGCAGTGGTGGACGG + Intergenic
1189954280 X:46262003-46262025 CAGCAAACAGCAGCGGTGGGCGG + Intergenic
1191001356 X:55663016-55663038 CAGCATAGAACAGCGGTGCAGGG - Intergenic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192801799 X:74472914-74472936 TAGCAAAGCACAGTGGTGGCAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192910695 X:75601512-75601534 CAGCAATGAACACAGGTGGATGG - Intergenic
1192940372 X:75904933-75904955 TGACAAACAGCAGTGGTGGATGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1193295496 X:79827570-79827592 CTGCAAACAGCAGTGGTGGAAGG + Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1194641312 X:96406779-96406801 CAGCATACATGAGTGGTGAAAGG - Intergenic
1195023753 X:100855187-100855209 CAGCCAAACACAGTGGTGGCAGG - Intronic
1195137239 X:101921168-101921190 TTGAAAACAACCGTGGTGGAAGG - Intronic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1196056677 X:111363446-111363468 GAGCAACCAACAGTGCTGCAGGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1196763475 X:119221823-119221845 CAGCCAAGCACAGTGGTGGCAGG + Intergenic
1196772529 X:119309158-119309180 CGGCAAACACCAGTGGTGGATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1199368802 X:147020883-147020905 CGGCAAACAGCAGTGGTCGACGG - Intergenic
1199536297 X:148906769-148906791 CGGCATTCAGCAGTGGTGGACGG - Intronic
1200327742 X:155260313-155260335 CAGCAAACACCTTTGGTGCAGGG + Exonic
1200758510 Y:7014337-7014359 CACGAAACAACCATGGTGGAAGG - Intronic
1200953452 Y:8922839-8922861 CAGCAACCAACCATGGTTGATGG + Intergenic
1201329227 Y:12800001-12800023 CGGCATTCAGCAGTGGTGGAAGG - Intronic
1201421473 Y:13804542-13804564 CAGCAAACAGCAGTAGTGGAGGG - Intergenic
1201724349 Y:17136736-17136758 TAGCATTCAGCAGTGGTGGATGG + Intergenic