ID: 1141299552

View in Genome Browser
Species Human (GRCh38)
Location 16:82801268-82801290
Sequence CCAGCCAGGTTAACAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 238}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141299552_1141299559 25 Left 1141299552 16:82801268-82801290 CCTGTTTCTGTTAACCTGGCTGG 0: 1
1: 0
2: 0
3: 10
4: 238
Right 1141299559 16:82801316-82801338 TGAAGATCTATCTAACCTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141299552 Original CRISPR CCAGCCAGGTTAACAGAAAC AGG (reversed) Intronic
901446586 1:9312011-9312033 CCAGCCTGGGTGACAGAGACAGG - Intronic
901773218 1:11541577-11541599 CCACACAGGGTAACAGAAAGAGG + Intergenic
902356750 1:15908257-15908279 CCAGCCTGGGTAACAGAGTCAGG - Intronic
903991204 1:27271242-27271264 CCAGCCTGGGCAACAGAGACAGG - Intronic
906649313 1:47501319-47501341 CCAGCCAGGGTGACAGAGCCAGG - Intergenic
906846820 1:49201278-49201300 CCAGCCAAGTTAAGAGAATATGG - Intronic
907848760 1:58234327-58234349 CCAGACAGGTAAACAGGCACTGG + Intronic
912402193 1:109403598-109403620 CCAGCCTGGGTGACAGAAAGAGG + Intronic
912990011 1:114475968-114475990 CCAGCCAGGGTGACAGAGAAAGG + Intronic
913508497 1:119541132-119541154 TAAGCCAGTTTAACTGAAACTGG - Intergenic
915252026 1:154597425-154597447 TCAGCCAGGCTAAGAGACACTGG - Intronic
918084851 1:181236927-181236949 CCAGTCAGGAAAACAGAAACAGG + Intergenic
918250358 1:182698015-182698037 CCAGGCAGGATGACACAAACAGG + Intergenic
918512834 1:185330086-185330108 CCAGCCTGGGTAACAGAGCCAGG - Intergenic
918899902 1:190401326-190401348 CCAGCCTGGGCAACAGAACCAGG + Intronic
919099911 1:193082792-193082814 CCAGCCAGGGCAACAGAATGAGG - Intronic
919449310 1:197751812-197751834 CCAGCCTGGGAAACAGAGACAGG + Intronic
919879597 1:201892978-201893000 CCAGCCTGGGCAACAGAACCAGG + Intergenic
919982943 1:202653655-202653677 CCAGACAGGGAAACAGAGACTGG + Intronic
920461528 1:206144315-206144337 ACAGCCAGGGAAACAGAAATGGG + Intergenic
920492853 1:206431302-206431324 CCATGCAGGAAAACAGAAACAGG + Intronic
921024973 1:211270090-211270112 CCAGCCTGGGTAACAGAGCCAGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
1062773482 10:124455-124477 CCAGCCAGGGCAACAGAGAGAGG + Intergenic
1063132363 10:3189201-3189223 CCAGCCAGGGCAACAGAGAGAGG - Intergenic
1063470450 10:6280401-6280423 CGAGCCAGGTTCACAAACACTGG - Intergenic
1063537245 10:6895894-6895916 CCACCCATATTAACAGAATCAGG + Intergenic
1065175466 10:23071002-23071024 CTAGCCAGGTTAGCAAATACAGG - Intergenic
1065344873 10:24739067-24739089 CCAGCCAGGGAAACAGAATGAGG - Intergenic
1065382921 10:25108105-25108127 CCAGGGAGGTTAACAGGTACAGG - Intergenic
1065995319 10:31054515-31054537 CCAGCCTGGGTAACAGAATGAGG - Intergenic
1066385906 10:34940975-34940997 CCAGCCAGGGTGACAGAGCCAGG + Intergenic
1067100954 10:43334125-43334147 CCAGCCTGGTTGACAGAGCCTGG - Intergenic
1069843193 10:71352811-71352833 CCAGCCAGGTAAAAAGGAGCGGG + Intronic
1070494488 10:77009330-77009352 CCAGACAGGTAAACAGCAGCAGG - Intronic
1070897384 10:79996351-79996373 CCTGCCTGGTTATCAGCAACAGG + Intergenic
1072525357 10:96266525-96266547 GGAGCCACGTTATCAGAAACTGG - Intronic
1073756495 10:106586497-106586519 ACAGTCAGATGAACAGAAACAGG - Intronic
1075464084 10:122638362-122638384 TCAGCCAAGTTAGAAGAAACAGG - Intronic
1081452001 11:43180018-43180040 GGAGCAAGTTTAACAGAAACTGG + Intergenic
1082996719 11:59261289-59261311 CCAGCCAGGTGAGCAGAGGCTGG - Intergenic
1085622798 11:78050126-78050148 CCAGCCAGGTTCACAGTGACGGG - Intronic
1088115737 11:106310501-106310523 CCAGCCTGGGTAACAGAGAGAGG + Intergenic
1088139808 11:106602525-106602547 CCAGCCTGGTCAACAGAGCCAGG - Intergenic
1088741695 11:112772856-112772878 AGAGCCAGGTTAACTGAAAATGG + Intergenic
1089195250 11:116690593-116690615 CCAGCCTGGACAACAGAACCAGG + Intergenic
1092395897 12:8126232-8126254 CCAGCCTGGGTGACAGAACCAGG - Intronic
1092681952 12:10993042-10993064 CCAGATAGGTTAACAGAATAGGG - Intronic
1093550223 12:20401039-20401061 CCATCTAGTGTAACAGAAACAGG - Intronic
1096150595 12:49308771-49308793 CCAGCCTGGGTGACAGAAAGAGG + Intergenic
1099914317 12:88873050-88873072 ACAACCAGGTAAACGGAAACTGG + Intergenic
1100612171 12:96200525-96200547 CCAGCCTGGGTGACAGAACCAGG - Intronic
1101811122 12:108108739-108108761 TCAGCCAGGATAACTGTAACAGG + Intergenic
1101908853 12:108847976-108847998 ACAGCCAGGTGAAAAGGAACTGG + Intronic
1101953927 12:109197359-109197381 CCAACCAGGTTACTAGAAAAGGG - Intronic
1102096048 12:110242241-110242263 CCAGCCTGGGTGACAGAAAGAGG + Intergenic
1104048621 12:125181654-125181676 CCATCTTGGTTAACAGACACTGG + Intergenic
1107867040 13:44713138-44713160 CCAGCCTGGGTGACAGAAAAAGG + Intergenic
1108407668 13:50121915-50121937 CTAGTCAGGTTAACTGTAACGGG + Intronic
1108524544 13:51275346-51275368 CCAGCCTGGGTAACAGAAGGAGG + Intronic
1109827688 13:67743986-67744008 CCAGCCAGGGTAACAGAGTGAGG - Intergenic
1111803827 13:93013306-93013328 CCAGCCTGGTTGACAGAATGAGG + Intergenic
1112077953 13:95933450-95933472 CTAGCTAGATTAACAGAAAAAGG - Intronic
1112152232 13:96776440-96776462 CTAGCCAGGCTAACAAAAAAAGG + Intronic
1114229959 14:20772289-20772311 CCAGCCTGGGTGACAGAACCAGG + Intergenic
1117803874 14:59470195-59470217 CCAGCCAGGATTACCCAAACAGG + Intronic
1120388418 14:83875099-83875121 ATAGCCATGTTTACAGAAACTGG - Intergenic
1120456702 14:84739702-84739724 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1121658923 14:95620301-95620323 CCAGCCTGGGTAACAGAATGAGG + Intergenic
1122851837 14:104537692-104537714 GCAGCCAAGTAAACAGAAACAGG + Intronic
1125563955 15:40660931-40660953 CCAGCCTGGGTGACAGAACCAGG + Intronic
1126045353 15:44634746-44634768 TCAGCTAATTTAACAGAAACGGG + Intronic
1127560120 15:60127881-60127903 CCAGACAGCTGAACCGAAACAGG + Intergenic
1127725953 15:61750442-61750464 CAAGCAAGGTAAACAGAACCTGG + Intergenic
1128532870 15:68466511-68466533 CCAGCCTGGGTAACATAACCTGG + Intergenic
1128792932 15:70446472-70446494 CCAGCCTGGGTAACAGAGCCAGG + Intergenic
1128793979 15:70451512-70451534 CCACCCAAGCTGACAGAAACAGG + Intergenic
1129422282 15:75438333-75438355 CCAGCCTGGTTGACAGAACAAGG + Intronic
1131124002 15:89842941-89842963 CCAGCAAGGGTAACAGAATGGGG + Intronic
1131220459 15:90579669-90579691 CCAGCCTGGGTAACAGAACAAGG - Intronic
1131748805 15:95482582-95482604 CCAGGCAGGTTAAAAGAGATGGG - Intergenic
1132228527 15:100164059-100164081 CCAGACAAGTTAACAGTATCAGG + Intronic
1134461988 16:14437427-14437449 CCAGCCAGCTTCACCGAAGCTGG - Intronic
1134808818 16:17149461-17149483 CCAGACAGGAAAACAGAAAAGGG - Intronic
1135008286 16:18848475-18848497 CCAGCTAATTTAACAGAAACAGG + Intronic
1135461992 16:22652361-22652383 CCAGCCTGGGTAACAGAGAGAGG + Intergenic
1135495113 16:22944601-22944623 CAAGCCAGGTAATAAGAAACTGG - Intergenic
1137036026 16:35570667-35570689 CGAGCCAGGCTTAGAGAAACAGG - Intergenic
1137608324 16:49801876-49801898 CCAGCCTGGGTAACAGAACAAGG - Intronic
1138202987 16:55103920-55103942 ACAGCCAGGTTTACAGGTACGGG - Intergenic
1139425073 16:66874107-66874129 CCAGCCTGGGCAACAGAGACAGG - Intergenic
1139708345 16:68757820-68757842 CCAGCCTGGGTGACAGAAAAAGG - Intronic
1141095717 16:81161440-81161462 CCAGCCTGGGTAACAGAGCCAGG - Intergenic
1141299552 16:82801268-82801290 CCAGCCAGGTTAACAGAAACAGG - Intronic
1145286417 17:21509400-21509422 CCAGCCAAGGGACCAGAAACAGG + Intergenic
1146118858 17:30171333-30171355 CCAGCCTGGGCAACAGAACCAGG - Intronic
1146119306 17:30176700-30176722 CCAGCCTGGATAACACAAAGAGG - Intronic
1146312323 17:31778928-31778950 GCAGCCAGGGTAAGAGAAGCTGG - Intergenic
1147346622 17:39801334-39801356 TCAGCCAGGCTAAAAGAAAGGGG + Intronic
1149818778 17:59753387-59753409 TTAACCAGGTTAACAAAAACAGG + Intronic
1149938212 17:60831204-60831226 CCAGCCTGGTTGACAGAATGAGG - Intronic
1151844902 17:76645922-76645944 CCAGCCTGGATGACAGAAAGAGG - Intergenic
1153068283 18:1073913-1073935 CCAGTCAGGTAAAAACAAACTGG + Intergenic
1155449346 18:25947063-25947085 CCAGCCAGGTTTAAAGATAGGGG + Intergenic
1156621341 18:38855636-38855658 CCAGCCAGGGTGACAGAGAGAGG + Intergenic
1159092826 18:63868940-63868962 CCAGCCTGGGTGACAGAGACAGG + Intergenic
1159859933 18:73635973-73635995 GCAGCCAGATAAACAGAAAAAGG + Intergenic
1161983264 19:7641494-7641516 CCAGCCAGCTTAAGGGACACGGG + Intronic
1163719011 19:18889444-18889466 CCAGCCAGGTTGACAGAGTGAGG - Intronic
1163748264 19:19060628-19060650 CCAGCCTGGGTGACAGAAAAGGG - Intergenic
1164170853 19:22724016-22724038 CTAGCCAGGCTGAGAGAAACAGG + Intergenic
1164181241 19:22820620-22820642 CTAGCTAGGTTTAGAGAAACAGG + Intergenic
1165059187 19:33196514-33196536 CCAGCCTGGATAACAGAACATGG + Intronic
1165235814 19:34420760-34420782 CCAGCCTGGGCAACAGAAAAAGG + Intronic
1165991930 19:39820508-39820530 CCAGCCAGGGTGACAGAGTCAGG + Intergenic
1166177126 19:41082057-41082079 GCAGCCAGGTCAACTCAAACTGG + Intergenic
1166202129 19:41244683-41244705 CCAGCCTGGCTAACAAAGACAGG - Intronic
1166845457 19:45725093-45725115 CCAGCCTGGGCAACAGAGACAGG + Intronic
1168034524 19:53708937-53708959 CCAGCCTGGGCAACAGAGACTGG - Intergenic
1168584021 19:57578463-57578485 CCAGCAAGATTCACAGAAACCGG + Intronic
927536343 2:23863281-23863303 CCAGCCTGGGTAACAGAGAGAGG + Intronic
927901522 2:26822838-26822860 CCAGCCTGGGTGACAGAAGCAGG - Intergenic
928522813 2:32106835-32106857 ACAGCCACGCTAAAAGAAACAGG - Intronic
930704375 2:54489667-54489689 CCAGCCAGGCTGACAGAGAGAGG + Intronic
932199308 2:69811721-69811743 ACAGCAATATTAACAGAAACAGG - Intronic
932501151 2:72183719-72183741 CCAGCCTGGTGAACAGAATGAGG - Intronic
933694846 2:85210152-85210174 CCAGCCATGTTACCATTAACTGG + Intronic
934554650 2:95281004-95281026 CCAGCCAGGGAACCAGGAACAGG + Intronic
936483018 2:112903009-112903031 CCAGCCAAGTTGACACAAGCTGG - Intergenic
937445342 2:121952741-121952763 CCAGCCAGAGTCACAGAACCTGG + Intergenic
938179891 2:129170927-129170949 CCAGCAACTTTAAAAGAAACAGG - Intergenic
938692934 2:133808881-133808903 CCAGCCTGGTCAACAAGAACAGG + Intergenic
939056951 2:137377654-137377676 CCAGCCTGGGTAACAGAAGGAGG - Intronic
940275197 2:151932798-151932820 CCAGCCTGGGCAACAGAGACTGG + Intronic
940386342 2:153077515-153077537 CCAACAAGGTAAACAGAAAAAGG - Intergenic
942718174 2:178918376-178918398 CCAGCCAGGGTGACAGAGCCAGG + Intronic
945555816 2:211274377-211274399 CCAGCCTGGGTAACAGAATTAGG + Intergenic
947164926 2:227252037-227252059 CCAGCCTGGGTGACAGAAAGAGG + Intronic
947624986 2:231613670-231613692 CCAGCCAGGTTTACAGCACCAGG + Intergenic
948940107 2:241191190-241191212 CCAGCCAGGTGGACAGCAAGCGG + Exonic
1170439229 20:16361329-16361351 TCAGCCAGGTTGTAAGAAACAGG + Intronic
1172789835 20:37495343-37495365 CCAGCCTGGTCAGCAGAACCAGG - Intronic
1176519639 21:7814928-7814950 CCAGCCATGTTGGCAGGAACAGG - Intergenic
1177655895 21:24016797-24016819 ACAGCCACATTAACAAAAACAGG + Intergenic
1178653667 21:34444941-34444963 CCAGCCATGTTGGCAGGAACAGG - Intergenic
1180605847 22:17058164-17058186 GCAGCCATGGAAACAGAAACAGG - Intergenic
1180610183 22:17091268-17091290 CCAGCCAAATTATCAGAAAAAGG - Intronic
1180627857 22:17206617-17206639 CCTGCAAGGTTAAAAGAAAAAGG + Intronic
1181898064 22:26128763-26128785 GCACCCACCTTAACAGAAACAGG + Intergenic
1182660091 22:31919038-31919060 CCAGCCAGGTTAACGCAGCCTGG + Intergenic
1184699027 22:46157099-46157121 ACAGTCAGACTAACAGAAACAGG - Intronic
1185143963 22:49119335-49119357 CCAGCCTGGTTACCTGAGACAGG + Intergenic
949937659 3:9129123-9129145 CCAGCCTGGGTAACATAAAGAGG - Intronic
950273196 3:11635705-11635727 CCAGCCTGGTCTCCAGAAACTGG + Intronic
952391746 3:32886404-32886426 CCAGCCAGGTCACCAAAAATAGG - Intronic
953011809 3:39033121-39033143 CCAGCCTGGGTAACAGAAGGAGG + Intergenic
955246761 3:57231776-57231798 CCAGCCTGGGTAACAGAACGAGG + Intronic
955490441 3:59476895-59476917 CTAACCAGGTTAACTGAAAAGGG - Intergenic
960233304 3:115254268-115254290 CCAGTCGGGTTAAGAAAAACGGG + Intergenic
962631036 3:137275754-137275776 CCAGGCATGTAAACAGAAAAGGG - Intergenic
963099846 3:141589809-141589831 CCAGCCTGGGTAACAGAATGAGG + Intronic
963675738 3:148308484-148308506 CCAACCAAGATAACAGAAAATGG - Intergenic
964053682 3:152425576-152425598 CCAGCCTGGGTAACAGAGAGAGG + Intronic
966934565 3:184697512-184697534 CCAGCCTAGGCAACAGAAACAGG - Intergenic
968565578 4:1310889-1310911 ACAGCCAGGGCAACAGAGACAGG - Intronic
969372909 4:6745547-6745569 CCAGCCTGGGTGACAGAAAGAGG + Intergenic
969663384 4:8543405-8543427 ACATCCAGGTTAACAGGAGCCGG - Intergenic
971960893 4:33485840-33485862 TCAGTCAGATTATCAGAAACTGG - Intergenic
972482890 4:39514710-39514732 CCAGCCTGGGTGACAGAAAGAGG - Intronic
973221643 4:47733050-47733072 CCAGGCAGTTTACCAGGAACTGG - Intronic
973545348 4:51975743-51975765 CCAGCCTGGATAACAGACAGAGG - Intergenic
973853367 4:54984939-54984961 CCAGCCTGGGTGACAGAACCAGG - Intergenic
978114118 4:104998765-104998787 CCAGACATGTAAAGAGAAACTGG - Intergenic
980517132 4:133877940-133877962 CCTGCCAAGTGAAGAGAAACAGG + Intergenic
981304754 4:143235309-143235331 CCAGCCTGGGTAACAGAACAAGG - Intergenic
981621184 4:146700563-146700585 TCAGCAAGGTCAACAGAAACTGG - Intergenic
983197842 4:164827025-164827047 CCAGCCAGGGCAACAGAGAAAGG + Intergenic
985223876 4:187738293-187738315 CCAGCTTGGTGACCAGAAACTGG + Intergenic
986797810 5:11229491-11229513 CCAGCCTGGGTGACAGAAACAGG + Intronic
987924800 5:24326619-24326641 CCAACCTGGGTAACATAAACAGG - Intergenic
988561611 5:32286711-32286733 TAAGCCAGGTTAAAAGAAATGGG + Intronic
988863277 5:35306928-35306950 CCAGGCAGGTTGTCAGAAGCTGG - Intergenic
989601509 5:43204673-43204695 CCAGCCTGGGCAACAGAAAGAGG + Intronic
990991141 5:61685117-61685139 CCAGCCAGTTTAAGAAAAGCAGG - Intronic
991664451 5:68984353-68984375 CCAGCCTGGTCAACAGAGAAAGG + Intergenic
993337821 5:86683121-86683143 TCAGGCAGATAAACAGAAACAGG + Intergenic
993994750 5:94709456-94709478 TCTCCCAGGTTTACAGAAACTGG - Intronic
995760122 5:115553701-115553723 CCCTCCAGGTTAGCAGAAGCTGG - Intergenic
997409352 5:133679337-133679359 CCAGCCAAGTTCCCAGACACTGG + Intergenic
997529934 5:134575861-134575883 CCAGCCTGGGTAACAGAGCCAGG + Intronic
997536262 5:134624489-134624511 CCAGCCAGGGTGACAGTAAATGG + Intronic
997551308 5:134755552-134755574 CCAGCCTGGGCAACAGAACCAGG + Intergenic
999089987 5:148927521-148927543 CCACCCAGCTTAAGAGAAACAGG + Intronic
999145555 5:149390998-149391020 CCAGCCTGGGTGACAGAATCAGG - Intronic
999628874 5:153549159-153549181 CCAGCCTGGTTGAAAGAACCAGG - Intronic
999692966 5:154164894-154164916 CCAGCCTGGGCAACAGAAAGAGG - Intronic
1002125741 5:177042758-177042780 CCAGCCTGGGTAACAGAGCCAGG - Intronic
1003611931 6:7621616-7621638 CCAGCCTGGATAACGGAAGCTGG + Intergenic
1004579986 6:16940700-16940722 CCAGGCAGGTTAAAATACACAGG + Intergenic
1006171805 6:32097367-32097389 CCAGCCTGGCTCACAGGAACAGG + Intronic
1006236583 6:32638645-32638667 CCAGCCAGGGCAACAGAGAGAGG + Intronic
1006965520 6:37980255-37980277 CGAGGCAGGTTAACAGGGACTGG - Intronic
1007045754 6:38772849-38772871 CCAGCCTGAGTAACACAAACAGG - Intronic
1008450274 6:51642808-51642830 CCAGCCTGGGTAACAGAGCCAGG + Intronic
1012090553 6:94889025-94889047 CTAGTTAGGTTAACAAAAACAGG - Intergenic
1016603374 6:145889320-145889342 CCAGACAGGTTGACAGAGAATGG + Intronic
1017909052 6:158777272-158777294 CCAGCCAGGAGAACACACACTGG - Intronic
1018018320 6:159732792-159732814 CCAGCCTGGGCAACAGAGACCGG + Intronic
1019005355 6:168792218-168792240 TCAGCCAGGCTACCAGAAGCTGG - Intergenic
1026250892 7:68669772-68669794 CCAGCCTGGGCAACAGAACCAGG - Intergenic
1026298426 7:69076713-69076735 CCAGCCAGGTTAATAGCAGAAGG + Intergenic
1027715958 7:81669891-81669913 CTAACCAGGAAAACAGAAACTGG - Intergenic
1029604309 7:101589431-101589453 CCAGCCTGGGTGACAGAAAGAGG - Intergenic
1029688380 7:102164482-102164504 CCAGGCAGGTGAACAGGAAGAGG - Intronic
1033790172 7:144783091-144783113 CCTGACAGGTTCACAGAATCAGG - Intronic
1034635376 7:152563290-152563312 CCAGCCTGGGTAACAGAATGAGG - Intergenic
1035080904 7:156215278-156215300 CCAGCCAGTTTAAGTGACACGGG + Intergenic
1035208943 7:157313583-157313605 CCAGCCTGGGTGACAGAATCAGG + Intergenic
1035978450 8:4339992-4340014 CCAGCCTGGACAACAGAACCAGG + Intronic
1044407409 8:91844381-91844403 CCAGCCTGGGTAACAGAATGAGG + Intergenic
1044959698 8:97518216-97518238 ACAGCCAGGTTGACAGCCACTGG - Intergenic
1047271258 8:123361285-123361307 CCAGCCTGGGCAACAGAACCAGG + Intronic
1047546085 8:125818552-125818574 CCAGCCAGGCTAACTCCAACAGG - Intergenic
1047974570 8:130116733-130116755 CCAGCCTGGTTAACTGAAATAGG + Exonic
1048296480 8:133218366-133218388 GCAGCAAGGTTCACACAAACCGG + Intronic
1049960197 9:730661-730683 CCAGCCTGGGTGACAGAAAGAGG + Intronic
1050104735 9:2153504-2153526 CCAGCCTGGGTAACAGAATGAGG + Intronic
1050279748 9:4038081-4038103 CAAGCCAGGTGAACAGGAAGAGG - Intronic
1050765321 9:9125918-9125940 CCAGCCAAGTGAACAGCAAGGGG + Intronic
1056473259 9:86926543-86926565 CCAGCCTGGGTGACAGAAAGAGG - Intergenic
1057437531 9:95056112-95056134 CCAGCCAGGATAAAAGGAAATGG + Intronic
1058794074 9:108480545-108480567 CCAGCCAGATAAACAGAGATAGG - Intergenic
1060374178 9:123103770-123103792 CCATACAGTTTAACAGAACCAGG - Exonic
1060766993 9:126301906-126301928 CCAGCCTGGGCAACAGAGACAGG + Intergenic
1186299664 X:8186147-8186169 ACAGACAGGAAAACAGAAACTGG - Intergenic
1189289552 X:39875610-39875632 CCAGAGAGGTTCACAGGAACAGG + Intergenic
1189765188 X:44364732-44364754 CTAGCCAAGTGAACAAAAACAGG + Intergenic
1190566303 X:51733216-51733238 CCAGCCTGGGTGACAGAAAGAGG + Intergenic
1190909535 X:54758525-54758547 GCAGCCAGGCAAACAGGAACTGG - Exonic
1190970098 X:55340382-55340404 GCAGCCATGTTAACTGCAACAGG + Intergenic
1192154550 X:68734165-68734187 CCATCCTAGTGAACAGAAACTGG + Intergenic
1192212731 X:69137846-69137868 TCAGCCAGGCTTCCAGAAACCGG - Intergenic
1192623354 X:72702418-72702440 CCAGCCTGGGTGACAGAAAGAGG + Intronic
1194716366 X:97291059-97291081 CCAGCCTGGGTAACAGAGCCAGG + Intronic
1194863357 X:99032899-99032921 GCAGCCAGGTACAGAGAAACAGG + Intergenic
1195345328 X:103944821-103944843 CCAGCCTGGGTAACAGAGAGAGG - Intronic
1196990690 X:121325845-121325867 CCAGCCTGGGCAACAGAAAGGGG - Intergenic
1198323248 X:135540784-135540806 CCAGCCTGGGTGACAGAACCAGG - Intronic
1201748476 Y:17406066-17406088 CCAGCCTGGGCAACAGAACCAGG - Intergenic