ID: 1141299929

View in Genome Browser
Species Human (GRCh38)
Location 16:82805068-82805090
Sequence CTTCTACTGTTAACAAACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141299929_1141299932 21 Left 1141299929 16:82805068-82805090 CCCGGGTTTGTTAACAGTAGAAG 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1141299932 16:82805112-82805134 CTTTCATTGTGTGTGTTTCTAGG 0: 1
1: 0
2: 3
3: 70
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141299929 Original CRISPR CTTCTACTGTTAACAAACCC GGG (reversed) Intronic
902070503 1:13731091-13731113 CTTCTGCTGTTGACAAGACCCGG + Exonic
904978512 1:34477117-34477139 CTTCTGCTGTCAACAAGGCCAGG + Intergenic
905385587 1:37601530-37601552 ATTCTACTGGAAACAAACCAAGG - Intergenic
910046263 1:82921035-82921057 CTCCTAGCGTTAACAAGCCCTGG + Intergenic
911659459 1:100484891-100484913 GCTCTACTGTAAACAAACCACGG + Intronic
913206834 1:116546687-116546709 CTTCTACTGTTCTCAAGCCCAGG - Intronic
913283043 1:117203604-117203626 TTTCTACAGGTAAGAAACCCAGG - Intronic
916061900 1:161104815-161104837 CTTCTACTGCCAATAAACCAAGG + Intronic
917331656 1:173886372-173886394 CTTATAAAGTTAACAAACCAAGG - Exonic
917620089 1:176786694-176786716 CTTCTGCTGTGAGCAAACCTGGG + Intronic
918758535 1:188370496-188370518 CTTCCACTGATCACAAAACCAGG + Intergenic
918996370 1:191765577-191765599 CTACTTCTATTAACAAACACAGG - Intergenic
919709969 1:200716618-200716640 CTTCTGCAGTAAACAAACACTGG - Intergenic
922246481 1:223803375-223803397 CTTCTACTTTTGACACAGCCAGG + Exonic
1063581282 10:7309920-7309942 CTGATACTATTAAAAAACCCTGG - Intronic
1064780682 10:18834983-18835005 CTTTCACTTTTGACAAACCCAGG - Intergenic
1067551529 10:47239842-47239864 TTTCTGCTGTTAATAAGCCCAGG + Intergenic
1070709238 10:78666242-78666264 CTGCTGCTGTTCACAAACCTGGG + Intergenic
1070887117 10:79911452-79911474 TTTCTACTGTTAACACCCTCTGG + Intergenic
1071022216 10:81070879-81070901 CTTCTACTGCAAGCAAACCTGGG - Intergenic
1074230282 10:111527024-111527046 CTTATACTGTTAACATCTCCTGG - Intergenic
1077363392 11:2151199-2151221 CTTCTCCTGTTTACACACCCTGG - Intronic
1078277942 11:9868948-9868970 CTTCTAATATTAACAAATCTGGG - Intronic
1078432178 11:11296544-11296566 CTTCTTCTGTCATCAAAGCCTGG + Intronic
1080194501 11:29593070-29593092 CTTTTACTGTTAACTATCACTGG - Intergenic
1084251905 11:67906030-67906052 CTTATGCTGTTAAGAAAACCCGG - Intergenic
1084553172 11:69861074-69861096 CTTCTTCTATTCACAAGCCCAGG - Intergenic
1084655050 11:70510231-70510253 CTGCTGCTGTTAGCAAACCTGGG + Intronic
1084820939 11:71689998-71690020 CTTATGCTGTTAAGAAAACCTGG + Intergenic
1090144597 11:124307827-124307849 CTTATACATTTAACAAATCCAGG - Intergenic
1093776526 12:23081967-23081989 CTTGTACAGCTAACAAAACCAGG + Intergenic
1096953260 12:55498528-55498550 CTTCTATTGTTAATAACCCTAGG - Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1101559529 12:105843146-105843168 CTTCTTCTGCTTACAAACCTGGG - Intergenic
1109331997 13:60941886-60941908 CTTCCACGGGTAACAAACTCAGG + Intergenic
1117725421 14:58668409-58668431 CTTCTACTTTTAACCAATTCAGG - Intergenic
1118437585 14:65785594-65785616 ATTCTAATGTGAACACACCCAGG - Intergenic
1126795839 15:52260006-52260028 CTTCTCCTGTTAAGAAACCAGGG + Intronic
1129998743 15:80029025-80029047 CTTCCAATGCCAACAAACCCTGG - Intergenic
1131346489 15:91654089-91654111 ATTATACTGTTAACTACCCCTGG - Intergenic
1139718805 16:68836330-68836352 CAGCCACTGTTAAGAAACCCTGG + Intergenic
1140013343 16:71158294-71158316 TGTCTACTGTTGACAAATCCTGG + Intronic
1140182914 16:72737926-72737948 CATCTAAAGTTAACAAACCCTGG - Intergenic
1141299929 16:82805068-82805090 CTTCTACTGTTAACAAACCCGGG - Intronic
1146353329 17:32114062-32114084 CTTCTTCTGTTCACTAACCTTGG + Intergenic
1147023766 17:37562408-37562430 CTTCTTCTCTTATCAGACCCAGG + Intronic
1148682960 17:49485249-49485271 ATTCTACTTTTAGAAAACCCAGG - Intergenic
1151022971 17:70640626-70640648 CTTTTAATCTTATCAAACCCAGG - Intergenic
1151081120 17:71329958-71329980 CTTCTACTGAAAACAGAACCTGG - Intergenic
1153809238 18:8737429-8737451 CTTATATCTTTAACAAACCCTGG + Intronic
1156154245 18:34282714-34282736 CTTCCACTTATAACAAACGCAGG + Intergenic
1156847501 18:41684157-41684179 CCTCTACTGTTACAAAACCACGG + Intergenic
1161347636 19:3776185-3776207 CCTCTCCTCTTAACAAAGCCAGG - Intergenic
1162694403 19:12461554-12461576 CTGGTACTGTTAACAAAACATGG + Exonic
1163141813 19:15354835-15354857 CTTGTACTGCTTACAAACCAAGG + Exonic
1163779493 19:19239185-19239207 CTTCTCCTGGCCACAAACCCTGG + Intronic
925751880 2:7096437-7096459 CTTCCGCTGCTAACAAAACCTGG - Intergenic
932459735 2:71874535-71874557 CTTCTACTATAAATAACCCCCGG - Intergenic
940146381 2:150548976-150548998 CTTCTATGGTAAACCAACCCAGG + Intergenic
940189182 2:151020723-151020745 CTTCTGCTGTCAACCAACCAAGG + Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
947122611 2:226833437-226833459 CTTGTACAGTTCACAAATCCAGG - Intergenic
947979178 2:234394823-234394845 CTTCTACTTGTAATAAACACTGG - Intergenic
1176262876 20:64192139-64192161 CTGCTTCTGTGAACAAAGCCAGG + Intronic
1177112661 21:17047654-17047676 CTTCTTATGTGAACAAATCCTGG - Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
949633215 3:5952132-5952154 CTTCTTCTGCTCACAAACACTGG - Intergenic
950042733 3:9930559-9930581 CTTCTACTCTTAACTTTCCCAGG - Intronic
951431896 3:22617662-22617684 CTTCTACTGGTAATAAAACATGG + Intergenic
952294976 3:32053599-32053621 GTACTACTGATATCAAACCCAGG - Intronic
955017281 3:55084324-55084346 CTGAGACTGTTAGCAAACCCAGG - Intergenic
958076368 3:88685192-88685214 CTCCTAAGGTTAACAAACCTGGG + Intergenic
959275693 3:104274649-104274671 GTACTACTGTTAACAAAATCTGG - Intergenic
959281154 3:104342851-104342873 CTTCTACTGCTAACAATGTCAGG - Intergenic
959816134 3:110675236-110675258 CTCCTACTGATACCAAAACCTGG + Intergenic
961899913 3:130200344-130200366 CTTATGCTGTTAAGAAAACCCGG - Intergenic
962230614 3:133662179-133662201 CCTTTACTGTTAAAAAAGCCAGG + Intergenic
969384449 4:6834802-6834824 CTTTTACAGTGAACAAATCCAGG - Intronic
972213870 4:36872780-36872802 CTTCTACCCTTTACAAAACCTGG + Intergenic
978230124 4:106387343-106387365 CTGCTACTCTTATCAAACCAGGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
985392194 4:189501566-189501588 CTTCCACTGTTAACAAGGCCAGG + Intergenic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
988355617 5:30170257-30170279 CTTATACTGTTAAAACACCGTGG - Intergenic
994254078 5:97571928-97571950 CTTCTACTGCAAACAAACCCAGG + Intergenic
996649168 5:125852579-125852601 TTTCTATTCTTAACATACCCTGG + Intergenic
996742290 5:126811807-126811829 CTTCTACTGTCAACAGTGCCAGG + Exonic
1000366223 5:160493826-160493848 CTTCTACAGTTAGAAAACCTTGG - Intergenic
1000408096 5:160909997-160910019 CCCCTACTTTTAACAAACTCAGG - Intergenic
1001581327 5:172800451-172800473 CATCTTCTGGTAACAAACCCAGG - Intergenic
1004980219 6:21015069-21015091 CTGCTTCTATTAACAATCCCAGG + Intronic
1007939524 6:45766328-45766350 AATCTACTGTTGCCAAACCCAGG + Intergenic
1009784981 6:68324777-68324799 ATTCTACTGTTGACATACACTGG - Intergenic
1010121124 6:72377196-72377218 CTTCTTCTGTTCCCAAACCTTGG + Intronic
1014909385 6:127071947-127071969 CTTCTACTCATCACAAACCAAGG + Intergenic
1027460465 7:78446584-78446606 TTTCTACTGGTAACAAAATCTGG - Intronic
1028858152 7:95615716-95615738 CTTCAACAATTAACAAATCCAGG + Intergenic
1032210361 7:129908801-129908823 CCTTTACTGGTAAGAAACCCAGG - Intronic
1036248700 8:7143186-7143208 CTTATGCTGTTAAGAAAACCCGG + Intergenic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1041944335 8:63424560-63424582 CTTCCAGTGTAAACAAAGCCGGG + Intergenic
1043169632 8:76949369-76949391 ATTACCCTGTTAACAAACCCTGG - Intergenic
1044359405 8:91263964-91263986 CTTCTACTGTTAAAAAAAAATGG - Intronic
1044954833 8:97469171-97469193 CATCTGCAGTTAACCAACCCTGG - Intergenic
1048074134 8:131050632-131050654 CTTCTGCTGTTACCAAGCACTGG - Intergenic
1050499899 9:6286541-6286563 CTTCTACTATTAAACAACTCTGG + Intergenic
1051308638 9:15744542-15744564 CCTCTACAGTTGACAAAGCCTGG - Exonic
1058744699 9:107978918-107978940 CTCTTACTGTTAAGAAACCAAGG + Intergenic
1061141817 9:128771908-128771930 CCTCCGCTGTCAACAAACCCGGG + Intronic
1186979083 X:14939747-14939769 CTTCTGCAGTTAAGGAACCCCGG - Intergenic
1189668981 X:43387661-43387683 CTTCCACTGTTAACAAGAGCAGG - Intergenic
1191243363 X:58206718-58206740 ATTCTAATGTTAAAGAACCCAGG + Intergenic
1191880434 X:65839549-65839571 CTTATTCTGTTAACACCCCCAGG + Intergenic
1193120715 X:77820248-77820270 CATCTACTGGTCACAAAGCCAGG + Intergenic
1193767862 X:85553546-85553568 CTTATCCTGATAACAAAGCCAGG - Intergenic
1195197219 X:102510811-102510833 TTTGTACTGCTAACAAGCCCAGG + Intergenic
1198037421 X:132814852-132814874 CTTCTACTGTTACCTCAGCCTGG + Intronic
1199424238 X:147682182-147682204 CTCCTGCTGCTAACAAACTCAGG + Intergenic