ID: 1141300659

View in Genome Browser
Species Human (GRCh38)
Location 16:82812588-82812610
Sequence CCTCCGTGTCACTAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141300659_1141300667 21 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300667 16:82812632-82812654 TGTTGGTGGAGGAAACCAGATGG 0: 1
1: 0
2: 1
3: 40
4: 637
1141300659_1141300669 25 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300669 16:82812636-82812658 GGTGGAGGAAACCAGATGGGAGG 0: 1
1: 0
2: 3
3: 39
4: 308
1141300659_1141300666 10 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300666 16:82812621-82812643 TACACAGGCTGTGTTGGTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
1141300659_1141300668 22 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300668 16:82812633-82812655 GTTGGTGGAGGAAACCAGATGGG 0: 1
1: 0
2: 2
3: 14
4: 179
1141300659_1141300664 4 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300664 16:82812615-82812637 TAATTTTACACAGGCTGTGTTGG 0: 1
1: 0
2: 0
3: 20
4: 202
1141300659_1141300663 -5 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300663 16:82812606-82812628 GGAGGGTGTTAATTTTACACAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1141300659_1141300671 27 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300671 16:82812638-82812660 TGGAGGAAACCAGATGGGAGGGG 0: 1
1: 0
2: 1
3: 60
4: 437
1141300659_1141300665 7 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300665 16:82812618-82812640 TTTTACACAGGCTGTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 232
1141300659_1141300670 26 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300670 16:82812637-82812659 GTGGAGGAAACCAGATGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141300659 Original CRISPR CCTCCGTGTCACTAGATGCA GGG (reversed) Intronic