ID: 1141300659

View in Genome Browser
Species Human (GRCh38)
Location 16:82812588-82812610
Sequence CCTCCGTGTCACTAGATGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141300659_1141300665 7 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300665 16:82812618-82812640 TTTTACACAGGCTGTGTTGGTGG 0: 1
1: 0
2: 3
3: 25
4: 232
1141300659_1141300670 26 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300670 16:82812637-82812659 GTGGAGGAAACCAGATGGGAGGG No data
1141300659_1141300671 27 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300671 16:82812638-82812660 TGGAGGAAACCAGATGGGAGGGG 0: 1
1: 0
2: 1
3: 60
4: 437
1141300659_1141300667 21 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300667 16:82812632-82812654 TGTTGGTGGAGGAAACCAGATGG 0: 1
1: 0
2: 1
3: 40
4: 637
1141300659_1141300664 4 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300664 16:82812615-82812637 TAATTTTACACAGGCTGTGTTGG 0: 1
1: 0
2: 0
3: 20
4: 202
1141300659_1141300666 10 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300666 16:82812621-82812643 TACACAGGCTGTGTTGGTGGAGG 0: 1
1: 0
2: 1
3: 26
4: 225
1141300659_1141300663 -5 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300663 16:82812606-82812628 GGAGGGTGTTAATTTTACACAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1141300659_1141300668 22 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300668 16:82812633-82812655 GTTGGTGGAGGAAACCAGATGGG 0: 1
1: 0
2: 2
3: 14
4: 179
1141300659_1141300669 25 Left 1141300659 16:82812588-82812610 CCCTGCATCTAGTGACACGGAGG 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1141300669 16:82812636-82812658 GGTGGAGGAAACCAGATGGGAGG 0: 1
1: 0
2: 3
3: 39
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141300659 Original CRISPR CCTCCGTGTCACTAGATGCA GGG (reversed) Intronic
901081677 1:6587285-6587307 CCTCCCTGTCACTTACTGCATGG - Exonic
901625023 1:10619008-10619030 CCTCAGTGTCATCAGATGTATGG + Intronic
902630393 1:17701314-17701336 CCTCCGTGTGGCTAAATCCAAGG - Intergenic
904167704 1:28568758-28568780 CCTCCACGTCAATAGATCCAGGG + Intronic
905943996 1:41886460-41886482 CCTCGGTGTCACAAAATGCTGGG - Intronic
909696562 1:78474107-78474129 CCTCAGGGTCACAAAATGCAGGG - Intronic
917971310 1:180209858-180209880 CCTCAGTGTCCCAAGATGCTGGG + Intergenic
919147844 1:193657555-193657577 CCTCAGTGTCACAAGAAGTAAGG + Intergenic
924170747 1:241337602-241337624 GCTCCATCTCACTAAATGCACGG + Intronic
1076258319 10:129045934-129045956 CCTCCGTGCCACGAGATACCGGG + Intergenic
1077052412 11:573259-573281 CCTGCTGGACACTAGATGCAGGG - Intergenic
1089192478 11:116663008-116663030 CCTCTGTGTCACTTGCTTCAGGG + Intergenic
1091957631 12:4660785-4660807 CCTCCATGTCAGTAGATCCAAGG - Intronic
1097784026 12:63738843-63738865 CCTCCCTGTTACTAGCTCCAGGG + Intergenic
1102699136 12:114823940-114823962 CCTCCGGGTCACTGGTTCCAAGG - Intergenic
1107934753 13:45336180-45336202 CCTCAGTCTCACTAGTTGCTGGG - Exonic
1118317834 14:64736660-64736682 CCTCCCTGTCCGTAGGTGCAAGG + Intronic
1121966957 14:98318140-98318162 CCTCAGTGTCACAAAATGCTGGG + Intergenic
1122052328 14:99068233-99068255 CCTCTGTGTCCACAGATGCAAGG + Intergenic
1128475739 15:67995618-67995640 CCTCAGTGTCACTACCAGCAAGG - Intergenic
1133400022 16:5478931-5478953 CCTCACTATCACTAGCTGCAGGG + Intergenic
1141300659 16:82812588-82812610 CCTCCGTGTCACTAGATGCAGGG - Intronic
1144234473 17:13244442-13244464 CTTTCATGTCACTAGCTGCAGGG + Intergenic
1145066728 17:19766443-19766465 CCCCCCTGTCACTAGATGTTGGG - Intergenic
1149312939 17:55413316-55413338 CCTCAATGTCACTAAATGCAAGG + Intronic
1149467882 17:56893855-56893877 ACTCCGTGTCACAAAATCCAGGG - Intronic
1163758274 19:19119831-19119853 CCCCCGTGTCCCCAGCTGCAAGG - Exonic
1167336703 19:48890797-48890819 CCTCCCTGTCCTTAGATCCAGGG - Intronic
1168032128 19:53688870-53688892 CCTCCGTGTCACTAGTAGCTGGG + Intergenic
927651917 2:24918480-24918502 CCACCGTGTCACTAGCCGCGTGG + Exonic
932113319 2:69021683-69021705 CCTCCATGTGCCTAGATGGAAGG + Intronic
937595301 2:123664973-123664995 CCTCTGAATCACTAGAGGCAGGG + Intergenic
938047909 2:128139811-128139833 CTGCCGTGTCACTTGTTGCATGG + Intronic
947589934 2:231379743-231379765 CCTCCCTGTCACTATTTCCAGGG - Intergenic
1169510459 20:6258563-6258585 CCTCCTTGTCCCTAGTTGCAGGG - Intergenic
1170004466 20:11650657-11650679 CCTCCATCTGACTATATGCAAGG - Intergenic
1172453044 20:35042197-35042219 CTCCTGTGTCACTAGATACAAGG - Intronic
1176055524 20:63144476-63144498 CCTCCGTGTCACGAAGGGCATGG - Intergenic
1181507421 22:23369301-23369323 CTTCAGTGTCAGTAGAGGCAGGG + Intergenic
1181683106 22:24509568-24509590 CCTCCTTGTCACTAGGAGGAGGG + Intronic
1184152333 22:42646343-42646365 CCTCTGTGTTATTAGAGGCAAGG - Intronic
950702382 3:14759425-14759447 CCTCCCAGTCACTATATCCAGGG - Intronic
962377030 3:134867004-134867026 CCATCGTGTCACTAGATACCTGG + Intronic
966732867 3:183164745-183164767 CCTCCTTATCACTAGATTGAGGG + Intergenic
967106040 3:186255741-186255763 CCTGCATGTCACTGGGTGCATGG - Intronic
968050178 3:195648670-195648692 CCACCGGGTCTCCAGATGCATGG - Intergenic
968303928 3:197637171-197637193 CCACCGGGTCTCCAGATGCATGG + Intergenic
968304084 3:197637953-197637975 CCACCGGGTCTCCAGATGCATGG + Intergenic
973229985 4:47829718-47829740 CCTTCCTGACACCAGATGCATGG - Intronic
974456141 4:62131131-62131153 CCTGCATGTCAGTAGTTGCAGGG - Intergenic
976098826 4:81538601-81538623 CCTCAGTTTCTCTAGCTGCAAGG + Intronic
979608210 4:122661859-122661881 CCTACGTGTCACTAGATAAGGGG + Intergenic
980254554 4:130361731-130361753 ACGGCGTGTCACTAGATGCTAGG - Intergenic
981833901 4:149032281-149032303 ACTCCATGTAACTAGATGAAAGG - Intergenic
983317537 4:166151242-166151264 CCTCACTTTCACTAGATGTAAGG + Intergenic
984087804 4:175333791-175333813 CTTCCGTGTCACTTGATAGATGG - Intergenic
985741062 5:1617752-1617774 CCACCGGGTCTCCAGATGCATGG + Intergenic
985741277 5:1618764-1618786 CCACCGGGTCTCCAGATGCACGG + Intergenic
985741308 5:1618906-1618928 CCGTCGTGTCTCCAGATGCACGG + Intergenic
987590018 5:19912369-19912391 CCTCTGTGTCACTAAATCCATGG - Intronic
998476888 5:142429475-142429497 CCTCCCTGTTGCTAGAGGCATGG + Intergenic
1003133731 6:3417136-3417158 GCTCTGTGTCAGTGGATGCAGGG + Intronic
1003166157 6:3680189-3680211 CCTCCGTGTCACCAGTTGAGAGG + Intergenic
1005393181 6:25354585-25354607 CCTCTTGGTCACAAGATGCATGG - Intronic
1010247500 6:73675220-73675242 CCTCAGTGTCCCAAAATGCAGGG + Intergenic
1026171096 7:67954588-67954610 CCTCCGTGTTGCTAAATGTATGG - Intergenic
1028511411 7:91629052-91629074 CCTCCCTGTGACAAGACGCATGG + Intergenic
1031644199 7:124203227-124203249 CCTTCCTGTCAGAAGATGCAGGG + Intergenic
1032450546 7:132026691-132026713 CCTCCTTGCTACCAGATGCATGG + Intergenic
1033359207 7:140626261-140626283 CCTCGGTGTCACAGCATGCATGG - Intronic
1035096473 7:156360121-156360143 CCTCTGTGTCCCCAGGTGCAGGG - Intergenic
1036639017 8:10570529-10570551 CCTTCCTGTCACTGGATGCTGGG + Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1040080447 8:43279005-43279027 CCTACGTGGCACTAGGTGCCAGG - Intergenic
1042093769 8:65189300-65189322 CCACCCTGGCCCTAGATGCATGG - Intergenic
1049330153 8:142046127-142046149 CCTCCGTGGCACTAATTGCTGGG + Intergenic
1054867316 9:70015690-70015712 CCTCTGTGTCTCTAGAGGCAAGG - Intergenic
1057113079 9:92492769-92492791 CCTCAGAGTCAGAAGATGCAGGG + Intronic
1062411902 9:136429954-136429976 CCTCCGTGTGCTTAGAGGCAGGG - Intronic
1190465253 X:50719801-50719823 CCTCAGGGTCACTAGATGAGTGG - Intronic
1197636877 X:128925245-128925267 CCATCTTGTCACTATATGCATGG + Intergenic