ID: 1141301030

View in Genome Browser
Species Human (GRCh38)
Location 16:82815754-82815776
Sequence TGTCCACCCATTATACTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141301027_1141301030 15 Left 1141301027 16:82815716-82815738 CCTAATCGTAGACTATCACTTTG 0: 1
1: 0
2: 0
3: 2
4: 58
Right 1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 91
1141301025_1141301030 17 Left 1141301025 16:82815714-82815736 CCCCTAATCGTAGACTATCACTT 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 91
1141301026_1141301030 16 Left 1141301026 16:82815715-82815737 CCCTAATCGTAGACTATCACTTT 0: 1
1: 0
2: 0
3: 1
4: 82
Right 1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141301030 Original CRISPR TGTCCACCCATTATACTGTG AGG Intronic
902768711 1:18633341-18633363 TGTCCCCCCAATCTTCTGTGAGG + Intronic
910761633 1:90738336-90738358 TATCCACTCACTGTACTGTGAGG - Intergenic
911769935 1:101727809-101727831 TGTCGAACCATTATTCTGAGGGG + Intergenic
912586479 1:110771589-110771611 TGTCCATCCCTGAGACTGTGAGG + Intergenic
912664525 1:111567212-111567234 TCTGCACCCACTATACTCTGTGG - Intronic
917863650 1:179172816-179172838 TGTCCACCCAGAATATTATGTGG + Intronic
918949741 1:191121929-191121951 AGTCAACCCATTATATTTTGAGG - Intergenic
922905485 1:229170601-229170623 AGTCCACCCTTGATCCTGTGTGG + Intergenic
922929384 1:229376963-229376985 TGTCCACCCCTTCTGCTGTGTGG + Intergenic
924176812 1:241399902-241399924 TGTCCACCCATGATCCTAAGAGG + Intergenic
1080040175 11:27751833-27751855 TGTCTTTCCATTATACTCTGAGG - Intergenic
1086052605 11:82611280-82611302 TATCTTCACATTATACTGTGAGG - Intergenic
1088547534 11:110974837-110974859 TGTACAGCCATTATCCTGTTAGG - Intergenic
1089327937 11:117670124-117670146 TGCCCCCACAGTATACTGTGAGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1093311163 12:17587252-17587274 TGTCTACCCATTATAGTATCAGG + Intergenic
1094362877 12:29649162-29649184 TGTCCATCAGTTTTACTGTGTGG + Intronic
1095310177 12:40689273-40689295 ATTCCACTCATTATTCTGTGAGG - Intergenic
1101513566 12:105414052-105414074 GATCCACCAATTATACTGTTGGG - Intergenic
1103199958 12:119079767-119079789 TTTCCACCCATGAAACTGTTGGG + Intronic
1107887330 13:44884665-44884687 AGTCCAGCCACTATGCTGTGGGG - Intergenic
1108945989 13:56024684-56024706 TGTCCACAAATTATATTTTGAGG - Intergenic
1111389237 13:87569854-87569876 TGTTCTCCCATTATTCTATGAGG - Intergenic
1111839692 13:93434421-93434443 TCTCCCCCAATTATATTGTGGGG + Intronic
1113496219 13:110731319-110731341 TGTTAAGCCATTACACTGTGGGG + Intergenic
1114392322 14:22323232-22323254 TGTCCACACAGTAAACTCTGAGG - Intergenic
1115153308 14:30310343-30310365 TGTCCACCCACCATATTGTTGGG - Intergenic
1117489414 14:56231141-56231163 TGTCCCCCCACTTTACTGTGTGG - Intronic
1118412095 14:65491117-65491139 TGTCTACCCACTGTACTTTGAGG - Intronic
1118468226 14:66051106-66051128 TGTTTCCCCATTATGCTGTGGGG - Intergenic
1120669242 14:87345135-87345157 TGTGCACCCATTGTTGTGTGTGG - Intergenic
1121282507 14:92709557-92709579 TGTCCCCCCATACTCCTGTGTGG + Intronic
1122685025 14:103499751-103499773 TGGAAACCCATTATACTGTGTGG + Intronic
1126330096 15:47522645-47522667 AGTCCGCCCACTATACTGAGAGG + Intronic
1133527425 16:6619204-6619226 TGTCCCCCCCTTAAACAGTGAGG + Intronic
1133954642 16:10431125-10431147 TGTCCACCCAGTGTATTGAGTGG + Exonic
1134466711 16:14485359-14485381 TGTCCACCCATTCTTCCATGTGG + Intronic
1140119432 16:72070856-72070878 TGTCCACCCTCCATACTGAGTGG - Intronic
1140737612 16:77912018-77912040 GGCCCACCCCTTATATTGTGGGG - Intronic
1141301030 16:82815754-82815776 TGTCCACCCATTATACTGTGAGG + Intronic
1148115017 17:45170413-45170435 AGTCCAGCCTTTAAACTGTGGGG - Intergenic
1148169704 17:45508748-45508770 AGTCCCCCCATTATATTGTGGGG - Intergenic
1148279502 17:46337066-46337088 AGTCCCCCCAGTATATTGTGGGG + Intronic
1148301719 17:46554922-46554944 AGTCCCCCCAGTATATTGTGGGG + Exonic
1148365652 17:47053912-47053934 AGTCCCCCCAGTATATTGTGGGG + Intergenic
1153247425 18:3086871-3086893 TTTTCACCCATTATTCAGTGGGG - Intronic
1155921638 18:31609525-31609547 TGTCGACACATTATATTCTGTGG + Intergenic
1167969401 19:53177851-53177873 TCTGCTCCCATTTTACTGTGGGG + Intronic
925810281 2:7693574-7693596 TGTCCAACCCTTGCACTGTGGGG + Intergenic
928776869 2:34776114-34776136 TTTCCACATTTTATACTGTGTGG + Intergenic
929091435 2:38221554-38221576 GGTCCACCCATTATACTCATTGG + Intergenic
929719620 2:44354382-44354404 TGTCTCCCCATTATATTGGGAGG - Intronic
936503854 2:113088818-113088840 TGCCCTCCCATTGCACTGTGTGG - Intergenic
938635283 2:133218974-133218996 TGTCCACACATTATATTCTTTGG + Intronic
939155102 2:138515351-138515373 TGTTCATTCATTATTCTGTGGGG + Intronic
939675740 2:145069912-145069934 AGTCCACCCCTTTTTCTGTGCGG + Intergenic
941435240 2:165462377-165462399 TGCCTACCCATAATACTGTCTGG + Intergenic
942534030 2:176944165-176944187 TGTCCCTCCTTTATCCTGTGAGG + Intergenic
1176200800 20:63859457-63859479 TGTCCACCCCTGACCCTGTGGGG - Intergenic
951541137 3:23783208-23783230 TCTCCACACATTCTACTGTCGGG - Intergenic
952706460 3:36382008-36382030 TGTCCACCTGGTATACTGTAAGG + Intronic
953014339 3:39058686-39058708 TGTGCCCCCATTATAGTGTCTGG - Intronic
961606732 3:128101103-128101125 TGCCCATCCATTAAACAGTGAGG + Intronic
965029703 3:163349950-163349972 TGTTCAAACATTATTCTGTGAGG + Intergenic
967319990 3:188185555-188185577 TATCCACGCAATAAACTGTGGGG - Intronic
970298346 4:14655635-14655657 AGTCCACACAGTGTACTGTGAGG + Intergenic
975954349 4:79820278-79820300 TGTCCCACCATTATATTTTGTGG - Intergenic
978311161 4:107386338-107386360 TGTCCACCCTTTGTACTTAGTGG - Intergenic
979369332 4:119864720-119864742 TGTCCCATCATTTTACTGTGAGG + Intergenic
984469840 4:180154565-180154587 TGTGCACCCAGTCTATTGTGGGG + Intergenic
985487026 5:157681-157703 TGTGCACCCCTTAAACTGTCAGG - Intronic
992657400 5:78923858-78923880 TGCCCACACATAATACTGTAGGG - Intronic
992901261 5:81299423-81299445 AGTCCACTCAGTATTCTGTGAGG - Intergenic
998107635 5:139478407-139478429 TCTCCTCCCATTGGACTGTGGGG - Exonic
998677291 5:144423999-144424021 TGTCCAACCCTTTTAATGTGAGG - Intronic
1004427199 6:15514397-15514419 TGCCCACCCCATATGCTGTGTGG + Intronic
1007200080 6:40099975-40099997 GGTCCACATTTTATACTGTGGGG - Intergenic
1012745534 6:103082504-103082526 TGTCTACCCATGTTGCTGTGTGG + Intergenic
1021415757 7:20382265-20382287 TTTCTACCTATTGTACTGTGAGG - Intronic
1022203077 7:28136869-28136891 TGTCCACCCATCGCACTCTGTGG - Intronic
1022983692 7:35628655-35628677 TGTCCTCCCATTACACTTTGGGG - Intergenic
1024445336 7:49471119-49471141 TGGCCACCCATTTTACTGAGTGG - Intergenic
1028004469 7:85546114-85546136 ATTCCACCCATAATACTGGGTGG - Intergenic
1029127196 7:98302727-98302749 TATCCACCAATTATAATGTATGG + Intronic
1030618525 7:111764058-111764080 TGACCGCCCACTACACTGTGTGG + Intronic
1033812791 7:145036168-145036190 TGTACATCCTTTATGCTGTGTGG - Intergenic
1035893924 8:3375742-3375764 TGTCCAGCGATCACACTGTGAGG - Intronic
1042366167 8:67939362-67939384 AGCCCACACATTATTCTGTGTGG + Intergenic
1045069534 8:98487233-98487255 TCTCCTTCCTTTATACTGTGTGG - Intronic
1046855961 8:119032383-119032405 TGTCCTCTCAGTACACTGTGTGG - Intronic
1050480851 9:6085624-6085646 TGTCCACCCTTTGTACTTAGTGG - Intergenic
1052532538 9:29706333-29706355 TGTCCACCCATTCCCCTGTGTGG + Intergenic
1053306674 9:36989182-36989204 TGTTCCCCCATTATCCTGTCTGG - Intronic
1056408416 9:86299375-86299397 TGTCCACACAATATACTGAGTGG - Intronic
1060460738 9:123852115-123852137 TGTCCCGCCATTACACTCTGGGG + Intronic
1185908826 X:3963649-3963671 TGTGCACCCATTTTACTGTTGGG + Intergenic
1188873561 X:35402673-35402695 AGTCAACCCATAAAACTGTGAGG + Intergenic
1194680861 X:96850973-96850995 TTTCCCCCCATTCTACAGTGAGG + Intronic
1196615595 X:117763697-117763719 ACTCCTCCCATTATCCTGTGAGG + Intergenic
1196627867 X:117898361-117898383 TGTCAACCCACTTGACTGTGTGG - Exonic
1199972646 X:152872301-152872323 TGAGCACCCACTATGCTGTGGGG - Intergenic
1200762894 Y:7056327-7056349 TGTCCACCCATTATACGGGAGGG - Intronic