ID: 1141301987

View in Genome Browser
Species Human (GRCh38)
Location 16:82825559-82825581
Sequence CAACAGAGGGAGACTCTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 958
Summary {0: 1, 1: 5, 2: 62, 3: 243, 4: 647}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141301987_1141301994 1 Left 1141301987 16:82825559-82825581 CCAAACAGAGTCTCCCTCTGTTG 0: 1
1: 5
2: 62
3: 243
4: 647
Right 1141301994 16:82825583-82825605 CCCGGCTGGAGTGACTGCAGTGG 0: 1
1: 2
2: 101
3: 218
4: 886
1141301987_1141301996 12 Left 1141301987 16:82825559-82825581 CCAAACAGAGTCTCCCTCTGTTG 0: 1
1: 5
2: 62
3: 243
4: 647
Right 1141301996 16:82825594-82825616 TGACTGCAGTGGCACGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141301987 Original CRISPR CAACAGAGGGAGACTCTGTT TGG (reversed) Intronic
900544514 1:3220992-3221014 CAAGAGAGGGAGACCCTGTCTGG + Intronic
900653686 1:3744438-3744460 CGACAGAGTGAGACTCCGTCAGG + Intergenic
901385313 1:8904424-8904446 CAACAGAGCGAGACCCTGTGAGG - Intergenic
901693936 1:10992479-10992501 CAACAGAGTGAGACTTCGTGGGG + Intergenic
902507527 1:16947856-16947878 CAACAGAGCAAGACTCTGTCTGG - Intronic
902910226 1:19590587-19590609 CAACAGAGTGATACTCTGTCTGG + Intergenic
903100929 1:21029047-21029069 CCCCAGAGCGAGACTTTGTTTGG - Intronic
903202545 1:21754139-21754161 CAACAGAGTGAGACTCCATCTGG + Intronic
903520395 1:23943070-23943092 TGACAGAGTGAGACTCTGTCTGG + Intergenic
903873639 1:26456350-26456372 CAACAGAGGGAGACCCTGTCTGG + Intronic
903979031 1:27171827-27171849 CGACAGAGCAAGACTCTGTCTGG + Intergenic
904065122 1:27743743-27743765 CAACAGAGCAAGACCCTGTTTGG + Intronic
904137859 1:28327991-28328013 CAACAGAGGGAGATCCTGTCTGG - Intergenic
904641441 1:31933701-31933723 CAACAGAGTAAGACTCTGTCTGG + Intronic
905211313 1:36376162-36376184 CAACAGAGGGGCACTCTGAAGGG - Intronic
905218275 1:36425711-36425733 CAACAGAGCAAGACTCTATCTGG + Intronic
905844153 1:41212854-41212876 CAACAAAGTGAGACTCTGTCTGG + Intronic
906645200 1:47469865-47469887 CAGCCCAGGGTGACTCTGTTGGG - Intergenic
907049409 1:51319708-51319730 TGACAGAGTGAGACTCTGTCTGG - Intronic
907103935 1:51862988-51863010 TGACAGAGTGAGACTCTGTGTGG + Intronic
907268060 1:53274806-53274828 CCTCACAGGGTGACTCTGTTGGG + Intronic
907526094 1:55054983-55055005 CAATAGAGCGAGACTCCGTCTGG + Intronic
907536242 1:55161350-55161372 CAACAGAGCGAGACTCTGTCTGG + Intronic
908326141 1:63025638-63025660 CAACAGAGTGAGACCCTTGTTGG - Intergenic
908360370 1:63363450-63363472 CGACAGAGCGAGACTCCATTGGG - Intergenic
908777135 1:67650921-67650943 CGACAGAGTAAGACTCTGTCTGG + Intergenic
909000410 1:70210693-70210715 CAACAGAGCGAGACCCTGTAGGG + Intronic
909101722 1:71357383-71357405 CACCAGAGGGAGACCCAGTTAGG - Intergenic
910770161 1:90822885-90822907 CGACAGAGGGAGGCTCTGACTGG + Intergenic
912316541 1:108671683-108671705 GGACAGGGAGAGACTCTGTTTGG + Intergenic
912372323 1:109183636-109183658 CAATGGAGAGAGACTCTGTTAGG - Intronic
912422762 1:109556953-109556975 CAACAGAGTGAGACTGTCTCGGG - Intronic
912845970 1:113074886-113074908 AAACAGAGCGAGACTCCGTCTGG + Intronic
912882265 1:113427330-113427352 CCACAAAGGGAGACTGGGTTAGG - Intronic
913997371 1:143662200-143662222 CAACAGAGCGAGACTCCGTCTGG - Intergenic
914251103 1:145922202-145922224 CGGCAGAGCCAGACTCTGTTGGG + Intergenic
914407386 1:147389633-147389655 CATCTGAGGGAGGCTCAGTTGGG + Intergenic
914673602 1:149890614-149890636 TGACAGAGTGAGACTCTGTCTGG - Intronic
914817568 1:151074328-151074350 CGACAGAGCGAGACTCCGTCTGG - Intronic
914943486 1:152043208-152043230 CAACAGAGGGAAACCCTGTCTGG + Intronic
915139633 1:153759252-153759274 CAACAGAGCAAGACCCTGTCTGG + Intronic
915150256 1:153825066-153825088 CAACAGAGTGAGACCTTGTCAGG + Intronic
915186797 1:154112834-154112856 CAACAGAATGAGACCCTGTCTGG + Intronic
915338477 1:155162507-155162529 CTACAGAGGAAGACTCTGTCTGG - Intergenic
915426290 1:155829968-155829990 CCACAGAGCGAGACTCTGTCTGG - Intronic
915492171 1:156256944-156256966 CGACAGAGCGAGACTCTGTCTGG - Intronic
916077112 1:161207830-161207852 CGACAGAGCGAGACTCCGTAGGG - Intronic
916141440 1:161702690-161702712 TGACAGAGTGAGACTCTGTCTGG + Intergenic
916321935 1:163513639-163513661 AGAGAGAGGGAGACTCTGTTTGG + Intergenic
916710811 1:167405665-167405687 GAACAGAGCGAGACCCTGTTTGG + Intronic
916876338 1:168973513-168973535 CAACACAGGCTGACACTGTTGGG + Intergenic
917104965 1:171483201-171483223 CAACAGAGTGAGACTCCATGGGG + Intergenic
917276198 1:173334473-173334495 GAACATAAGGAAACTCTGTTAGG - Intergenic
917304449 1:173612614-173612636 CATCAGAGGGAGACTGTGGAAGG - Intronic
918670025 1:187203335-187203357 CAACAGAGCAAGACTGTGTCTGG - Intergenic
918788414 1:188794252-188794274 GTACAGAGCGAGACTCTGTCTGG + Intergenic
918943431 1:191029517-191029539 TGACAGAGGGAGACTCTGTCAGG + Intergenic
919288527 1:195598426-195598448 CAACAGAGCAAGACTCTGTCAGG - Intergenic
919336747 1:196244997-196245019 GCACAGAGAGAGACTCTGCTTGG + Intronic
919508492 1:198430399-198430421 CGACAGAGCAAGACTCTGTCCGG - Intergenic
919975984 1:202613098-202613120 CGACAGAGCGAGACTCTGTCTGG - Intronic
920044251 1:203123380-203123402 CAGCAGAGGGAGGCAGTGTTAGG - Intronic
920962789 1:210679236-210679258 CAACAGAGGGAGGCTGTCTGGGG + Exonic
921782323 1:219180014-219180036 CAACAGAGTGAGACTCTGTCTGG - Intronic
922657073 1:227394611-227394633 TGACAGAGCGAGACTCTGTCTGG + Intergenic
922731663 1:227951743-227951765 CAACAGAGTGAGACTCTGTCTGG + Intergenic
922831312 1:228555945-228555967 TCACAGAGCGAGACTCTGTCTGG - Intergenic
923157828 1:231293969-231293991 CAACAGAGTGAGACTCTGTCTGG + Intergenic
924090949 1:240500316-240500338 CAACAGAGCAAGACTCTGTCTGG - Intronic
924184343 1:241471998-241472020 TGACAGAGGGAGACTCCGTCTGG - Intergenic
924237887 1:242014431-242014453 CAACAGAGCAAGACCCTGTCTGG - Intergenic
924704337 1:246487438-246487460 CAACAGAGCAAGACTCTGTCTGG + Intronic
924918430 1:248599168-248599190 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1062947625 10:1473400-1473422 CAACAGAGTGAGGCCCTGTCAGG - Intronic
1063108799 10:3017383-3017405 CAGCAGAGTGAGACTCTGTTTGG + Intergenic
1063118675 10:3088949-3088971 CAACAGAGCAAAACTCTGTATGG - Intronic
1063132361 10:3189191-3189213 CAACAGAGAGAGGCCCTGTCAGG - Intergenic
1063158434 10:3401019-3401041 CAACAAAGTGAGACTCTGTCTGG + Intergenic
1063237015 10:4127459-4127481 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1063344680 10:5300137-5300159 CAATAGAGGGAGAGTCTATTTGG - Intergenic
1063794276 10:9493376-9493398 CAACAGAGCAAGACTCCTTTGGG + Intergenic
1064112958 10:12554175-12554197 CAACAGAGCGAGATTCTGTCAGG - Intronic
1064180642 10:13111674-13111696 CGACAGAGTGAGACTCTGTCTGG + Intronic
1064706048 10:18073730-18073752 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1065164496 10:22960900-22960922 CAACAGAGGGAGAGCTTGCTGGG - Intronic
1065467650 10:26043140-26043162 AGAGAGAGAGAGACTCTGTTTGG - Intronic
1065542678 10:26785703-26785725 CGACAGAGTCAGACTCTGTCTGG + Intronic
1065574106 10:27101135-27101157 CGACAAAGCGAGACTCTGTTGGG - Intergenic
1065620126 10:27572333-27572355 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1065691328 10:28336741-28336763 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1065777071 10:29130932-29130954 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1065914742 10:30344722-30344744 CAATAGAGTGAGACTCTGTCTGG - Intronic
1065915974 10:30355325-30355347 GGAGAGAGGGAGACTGTGTTGGG + Intronic
1065925283 10:30429626-30429648 CGACAGAGTGAGACTGTGTCTGG + Intergenic
1066360254 10:34723272-34723294 CAACAGAGCGAGGCTCTGTCTGG + Intronic
1066423649 10:35285033-35285055 CAACAGAGCAAGACTCTGTCTGG - Intronic
1066514376 10:36140666-36140688 ACACAGAATGAGACTCTGTTTGG - Intergenic
1067260946 10:44690940-44690962 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1067306769 10:45071628-45071650 CAACAGAGCAAGAGCCTGTTGGG - Intergenic
1068411275 10:56659557-56659579 AGAGAGAGAGAGACTCTGTTTGG - Intergenic
1068924119 10:62517085-62517107 AAAAAGAGGGAAACTCTTTTAGG + Intronic
1068972725 10:62976567-62976589 TAACAGAGCGATATTCTGTTTGG + Intergenic
1069017417 10:63445892-63445914 AACCAGAGTGAGACTCTGTCTGG - Intronic
1069099397 10:64299589-64299611 CAACAGCGTGAGACCCTGTCTGG + Intergenic
1070033358 10:72698522-72698544 CGACAGAGTAAGACTCTGTGAGG - Intronic
1070306576 10:75243165-75243187 CAACAGAGGGAGACTCCATCTGG - Intergenic
1071114312 10:82199150-82199172 TGACAGAGTGAGACTCTGTCCGG + Intronic
1071386176 10:85123626-85123648 CAACAAAGGGAGACCATGTTGGG + Intergenic
1071548232 10:86545015-86545037 CAACACAGTGAGACCCTGTCTGG - Intergenic
1071882963 10:89919175-89919197 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1072028876 10:91497308-91497330 CAACAGAGCAAGACTGTCTTGGG - Intronic
1072095214 10:92171632-92171654 CAACAGAGTGAGACTCTCTCTGG - Intronic
1072606715 10:96990185-96990207 CGACAGAGTGAGACCCTGTCTGG - Intergenic
1072770945 10:98136815-98136837 CGATAGATTGAGACTCTGTTGGG + Intronic
1073141375 10:101250551-101250573 CAACAGAGTGAGACTGTCTCAGG - Intergenic
1073337670 10:102722552-102722574 CGACAGAGTGAGACCCTGTCTGG - Intronic
1073872533 10:107881106-107881128 CAGAAAAGAGAGACTCTGTTTGG + Intergenic
1074215340 10:111378749-111378771 CAACAGAGTGAGACTCCATCTGG - Intergenic
1074226801 10:111493081-111493103 AGAAAGAGAGAGACTCTGTTTGG - Intergenic
1074543160 10:114383093-114383115 CAACAGTGGTATGCTCTGTTTGG + Intronic
1074956823 10:118399138-118399160 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1075169573 10:120101150-120101172 CAACATAGTGAGACCCTGTGTGG - Intergenic
1075320340 10:121486460-121486482 CAACAGAGCGAGACTCTGTCTGG - Intronic
1076403669 10:130198547-130198569 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1078125451 11:8557229-8557251 CAACAGAGGGGGACCTTGTGGGG + Intronic
1078297429 11:10088041-10088063 CAACAGAGTGAGACCTTGTCTGG - Intronic
1078676158 11:13416332-13416354 CAACACAGTGAGACCCTGTCTGG + Intronic
1078791422 11:14546455-14546477 CAACAGAGCGAGACTCTGTCTGG - Intronic
1078935048 11:15942468-15942490 TCACAGAGGGAGGGTCTGTTAGG - Intergenic
1079029277 11:16973770-16973792 CTCCAGAGGGAGACTCAGGTTGG - Intronic
1079255770 11:18828398-18828420 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1079431749 11:20396616-20396638 CAACAGAGCAAGACTTTGTCGGG + Intronic
1080799726 11:35598995-35599017 TGACACAGGGAGATTCTGTTTGG - Intergenic
1082808509 11:57464527-57464549 GATCAGAGGGTGACTCTGATAGG + Intronic
1083649014 11:64190018-64190040 GGACAGAGTGAGACTCTATTTGG - Intronic
1083840171 11:65299709-65299731 CGACAGAGTGAGACTCTGTCGGG - Intronic
1083847141 11:65342424-65342446 TAACAGAGGGAGACCCTGTCTGG + Intronic
1084763727 11:71294006-71294028 AGAGAGAGAGAGACTCTGTTTGG - Intergenic
1085087647 11:73681787-73681809 CGACAGAGCAAGACTCTGTCTGG + Intronic
1085093677 11:73741154-73741176 CGACAGAGCAAGACTCTGTTGGG - Intronic
1085289885 11:75390339-75390361 CGACAGAGCGAGACTCCTTTTGG - Intergenic
1085650502 11:78263611-78263633 CGACAGAGTGAGACTCTGTCTGG + Intronic
1086057110 11:82659505-82659527 CAACAGAGTGAGACTCTGTCAGG + Intergenic
1086249640 11:84798019-84798041 GCAAAGAGAGAGACTCTGTTTGG - Intronic
1086472048 11:87124391-87124413 CTTTAGAGGGAGAATCTGTTTGG + Intronic
1087403432 11:97697604-97697626 TGACAGAGCGAGACTCTGTCAGG - Intergenic
1087532828 11:99406390-99406412 AGAGAGAGAGAGACTCTGTTTGG - Intronic
1087638839 11:100733803-100733825 CAACAGAGCAAGATTCTGTCTGG + Intronic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088546103 11:110960733-110960755 CAACAGAGAGAGACTCTGTCTGG - Intergenic
1088707049 11:112473163-112473185 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1089727562 11:120495992-120496014 CAACAGAGTGAGACTCAGTCAGG - Intergenic
1090018209 11:123104402-123104424 CAACAGGGCGAGACTCCGTCTGG - Intronic
1090122772 11:124050247-124050269 CGACAGAGCGAGATTCTGTCTGG - Intergenic
1090134537 11:124183575-124183597 CAACAGAGTGAGACTCAGGGAGG - Intergenic
1090811152 11:130244645-130244667 CGACAGAGAGAGACTCTGTCTGG + Intronic
1091852606 12:3712472-3712494 CAACAGAGAGAGACACAGTTGGG + Intronic
1092124946 12:6068487-6068509 CAACAGAGCGAGACTGTCTCAGG - Intronic
1092172364 12:6381950-6381972 CGACAAAGCGAGACTCTGTATGG + Intronic
1092213653 12:6665274-6665296 CCACAGAGCGAGATTCTGTCTGG - Intergenic
1092510868 12:9154759-9154781 CAGCAGAGGGAGCCTGGGTTTGG + Exonic
1092522323 12:9287633-9287655 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1092544960 12:9444229-9444251 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1092675937 12:10919922-10919944 CTACAGAGCAAGACTCTGTCAGG - Intronic
1092793094 12:12086296-12086318 TGACAGAGTGAGACTCTGTCTGG + Intronic
1093400098 12:18735423-18735445 TAACATAGTGAGACCCTGTTTGG - Intronic
1093849533 12:24018776-24018798 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1094048549 12:26194968-26194990 CAACACAGTGAGCCCCTGTTTGG + Intronic
1094268281 12:28583556-28583578 CAAATGAGGGAAACTCTGATAGG - Intergenic
1094427895 12:30334740-30334762 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1094534713 12:31310888-31310910 CGACAGAGTGAGACTCTCTCAGG - Intronic
1094564065 12:31583656-31583678 CAACAGAGCAAGACTGTGTCTGG + Intronic
1095224232 12:39660312-39660334 CAACAAAGGGAGCCTCAGTTGGG + Intronic
1095473472 12:42561929-42561951 CAACAGAGCAAAACTCTGTCTGG - Intronic
1095964110 12:47855306-47855328 CATCAGAGCGAGAATCTGTCTGG + Intronic
1096347119 12:50859233-50859255 CAACAGAGCAAGACTCTGTCTGG - Intronic
1096394024 12:51252111-51252133 TGACAGAGCGAGACTCTGTCTGG - Intronic
1096623376 12:52878389-52878411 CAACAGAACGAGACCCTGTCTGG + Intergenic
1096828030 12:54294390-54294412 CAGCAGAGGGAGCCGCTGTGTGG + Intronic
1096998408 12:55855042-55855064 CGACAGAGCGAGACTCCGTTAGG + Intergenic
1097124781 12:56765515-56765537 CAACAGAGCAACACCCTGTTTGG - Intronic
1097677914 12:62622958-62622980 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1098142793 12:67468567-67468589 AGAAAGAGAGAGACTCTGTTTGG - Intergenic
1098849698 12:75580813-75580835 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1099355585 12:81630914-81630936 CAACAGAGCTAGACTCTGTCTGG - Intronic
1099433897 12:82620358-82620380 TAACAGAGGCAGACTCTGTTTGG + Intergenic
1100294205 12:93245672-93245694 TCACAGAGGGACTCTCTGTTGGG + Intergenic
1100983368 12:100181766-100181788 CAACAGGATGAGACTCTGTCTGG + Intergenic
1101162503 12:101993674-101993696 AGAGAGAGAGAGACTCTGTTTGG - Intronic
1101179682 12:102201449-102201471 CGACAGAGCGAGACTCTGTCTGG + Intergenic
1101502489 12:105317008-105317030 CAACATAGGAAGACCCTGTGAGG + Intronic
1101916978 12:108903456-108903478 CGACAGAGCAAGACTCTGTCGGG - Intergenic
1101925567 12:108968811-108968833 CAACAGAGCGAGACTCTGTCTGG - Intronic
1102069806 12:110008863-110008885 CGACAGAGCGAGACTCAGTCTGG + Intronic
1102070599 12:110015969-110015991 CAACAGAGCGAGATACTGTATGG - Intronic
1102267685 12:111501909-111501931 CAACGGAGTCAGACCCTGTTTGG - Intronic
1102686014 12:114725273-114725295 CAACAAAGAGAGACCCTGTCTGG - Intergenic
1103406587 12:120680151-120680173 CAACAGAGTAAGACTCTGTATGG + Intergenic
1103537053 12:121640349-121640371 CAAAAGAGCACGACTCTGTTTGG + Intronic
1103640355 12:122346520-122346542 TGACAGAGTGAGACTCTGTCTGG - Intronic
1103694236 12:122801287-122801309 CAACAGATCGATACTGTGTTTGG + Exonic
1104453403 12:128889792-128889814 CAACGGAATGAGACTCTGTCAGG - Intronic
1104829700 12:131741721-131741743 CAACAGAGGGGGAGGCTGTGAGG - Intronic
1104869971 12:131988012-131988034 CAACAGAGCAAGACCCTGTCTGG - Intronic
1105435039 13:20369381-20369403 CAACAGAGCGAGACCCTGTCTGG - Intergenic
1105496180 13:20932929-20932951 CAACAGAGCAAGACTCTGTTGGG - Intergenic
1106189199 13:27436257-27436279 TCACTGAGAGAGACTCTGTTAGG - Intronic
1106275590 13:28202980-28203002 CAACAGAGTGAGACCCTGTCTGG - Intronic
1106601990 13:31196219-31196241 CGACAGAGTGAGATTCTGTCTGG - Intergenic
1106648733 13:31666068-31666090 CAACAGAGTGAGAATCCGTCTGG - Intergenic
1106799850 13:33244735-33244757 CATCTGAGGGAGACACTATTAGG + Intronic
1106898271 13:34328737-34328759 CACCAGAGGGAGATTCTATGAGG - Intergenic
1107184194 13:37497849-37497871 CAACAGAGTAAGACTATGTCCGG + Intergenic
1107524088 13:41213386-41213408 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1107702455 13:43061643-43061665 CAAGAGAGGGAGAGTGTGGTGGG + Intronic
1108138120 13:47386792-47386814 ACAGAGAGAGAGACTCTGTTTGG + Intergenic
1108953467 13:56119859-56119881 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1109222261 13:59652091-59652113 AAACAGAGGCACACTCTGTGGGG + Intergenic
1109244629 13:59938587-59938609 CAACAGAGGCAGACCTTGTTTGG + Intronic
1109534472 13:63698449-63698471 CAACAGAGTGAAACCCTGTCAGG + Intergenic
1109554528 13:63955006-63955028 CAGCACAGAGAGACTCTGTTTGG - Intergenic
1110431267 13:75426854-75426876 CAACATGGGGAGACCCTGTCTGG + Intronic
1110505334 13:76279289-76279311 CAACAGAGCAAGACTCTACTCGG + Intergenic
1111216455 13:85149138-85149160 CAACAGAGCGAGACCCTGACTGG - Intergenic
1112451953 13:99520586-99520608 CGACAGAGCAAGACTCTGTCTGG - Intronic
1112763856 13:102719856-102719878 CAACAGAGTAAGACCCTGTCTGG + Intergenic
1113189374 13:107726627-107726649 CAACAGAGTGAGACTCCATCTGG - Intronic
1113225144 13:108151616-108151638 CAGCAGAGTGAGACCCTGTCTGG + Intergenic
1113286463 13:108854241-108854263 CAGCACAGGGAGACTGTGGTGGG - Intronic
1113735913 13:112679011-112679033 CATCAGAGGGAGACTGTGGAGGG + Intronic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1114446021 14:22788682-22788704 CGACAGAGTGAGACTCTGTCTGG + Intronic
1114470600 14:22958342-22958364 CAACAGAGCAAGACTCCGTCTGG - Intronic
1116919532 14:50558337-50558359 CAACAGAGGGAGACTGTGTCTGG + Intronic
1116983106 14:51191789-51191811 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1117016133 14:51519182-51519204 CGACAGAGTGAGACTCCGTTGGG - Intronic
1117160441 14:52984369-52984391 CAACAGAGGTTGAGTTTGTTGGG - Intergenic
1118206159 14:63725352-63725374 CAACAGAGCGAGACTCCGTCAGG + Intronic
1118263107 14:64266899-64266921 TGACAGAGTGAGACTCTGTCTGG - Intronic
1118834306 14:69465459-69465481 CAACAGAACAAGACTCTGTCTGG + Intergenic
1119458668 14:74779659-74779681 CAACAGAGTGAGACCCTGTCTGG - Intronic
1119548407 14:75490441-75490463 CAACATAGTGAGACTCTGTCTGG - Intergenic
1119815626 14:77564210-77564232 CAACAGAGGGAGACTCTGTCTGG + Intronic
1119951723 14:78752219-78752241 CAACAGGGTGAAACCCTGTTTGG + Intronic
1120907298 14:89631545-89631567 CGACAGAGCGAGACTCCGTCTGG + Exonic
1121036729 14:90711439-90711461 CAACAGAGCGAGACTCCATCGGG - Intronic
1121734881 14:96211269-96211291 CCACAGAGGGAGGCTCTCTGGGG + Intronic
1121746832 14:96302554-96302576 TCACAGAGTGAGACACTGTTGGG + Intronic
1121853825 14:97248205-97248227 CAACAGAGAGAGAATCTGATTGG - Intergenic
1122233076 14:100316918-100316940 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1122581613 14:102775401-102775423 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1122686770 14:103512253-103512275 CGACAGAGTGACACTCTGTCTGG - Intergenic
1123911112 15:24967786-24967808 CAACAGAATGAGACCCTGTCTGG + Intronic
1123966933 15:25468541-25468563 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1124033214 15:26030003-26030025 CAACAGAGTGAGACACTCTTGGG + Intergenic
1124379997 15:29157075-29157097 CGACAAAGCGAGACTCTGTCTGG + Intronic
1124844158 15:33274679-33274701 ACACAGAGGGAGACTTTGTTTGG - Intergenic
1124908087 15:33891081-33891103 CAACAGAGTGAGACTCTGTCTGG + Intronic
1125276876 15:38003213-38003235 AGAGAGAGAGAGACTCTGTTTGG - Intergenic
1125662808 15:41407630-41407652 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1125758296 15:42080913-42080935 CACCAGAGGGACACTTTGTGTGG - Intronic
1126285689 15:47008562-47008584 CAGTAGAGTGAGACTCTGTTTGG - Intergenic
1126605561 15:50472575-50472597 AGACAGAGCGAGACTCTGTCTGG + Intronic
1127145881 15:56023245-56023267 CAACAGAGAGAGACTCCGTGTGG - Intergenic
1127287509 15:57544444-57544466 CAACACAGGGAGACTGTGAGGGG - Intronic
1127358696 15:58226318-58226340 CAAGAGAGGCAGACACTGTGTGG - Intronic
1127570156 15:60233863-60233885 CAACAGAGGGAGACTGTCTCAGG + Intergenic
1127693502 15:61420827-61420849 CTACAGAGGCAAACTCTGGTGGG + Intergenic
1127785483 15:62351367-62351389 CCACAGAGTGAGACTCCGTCTGG + Intergenic
1127965341 15:63918823-63918845 CGGCAGAGTGAGACTCTGTGCGG + Intronic
1128180649 15:65600600-65600622 TAACAAAGTGAGACCCTGTTTGG + Intronic
1128305696 15:66597671-66597693 TGACAGAGCGAGACTCTGTCTGG - Intronic
1128364600 15:66988801-66988823 CAACACAGAGAGACTCTGTTTGG + Intergenic
1128388658 15:67167971-67167993 CAACAGAGGGAGACTCTGTCTGG - Intronic
1128581156 15:68811040-68811062 CCACAGAGTGAGACTCTGTCTGG + Intronic
1129024253 15:72554403-72554425 CAACAAAGTGAGACTCTATTTGG - Intronic
1129145001 15:73639115-73639137 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1129479364 15:75810822-75810844 CAAGAGAGGGAGACTGTGCTGGG - Intergenic
1129890789 15:79070398-79070420 AAATAAAGGGAGACTCTATTTGG + Intronic
1130030841 15:80312103-80312125 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1130078193 15:80708333-80708355 CGACAGAGCAAGACTCTGTCTGG - Intronic
1130165120 15:81448100-81448122 CAACAGAGCGAGACTCTGTCTGG - Intergenic
1131187405 15:90286466-90286488 CAACAGAGTAAGACCATGTTTGG + Intronic
1131281264 15:91023305-91023327 CAAAAGGGCGAGACTCTGTCAGG - Intergenic
1131486825 15:92827934-92827956 CGACAGATAGAGACTCTGTCGGG - Intergenic
1131912177 15:97219437-97219459 CAACAGAGTGAGACTCTATAGGG - Intergenic
1132104064 15:99050251-99050273 CAACAGAGCCAGACCCTGTTTGG + Intergenic
1132391415 15:101441359-101441381 CAGCAGAGACAGACTCTGTGGGG - Intronic
1132837267 16:1960237-1960259 CAACAGAGTGAGACTGTCTCAGG - Intronic
1132895341 16:2226447-2226469 CAGGAGAGGACGACTCTGTTGGG + Intronic
1133124447 16:3636798-3636820 CAACAGAGTGAGACTCTGTCTGG + Intronic
1133329240 16:4961346-4961368 CAACAGAGTGAGACTCAGTCTGG - Intronic
1133369468 16:5237125-5237147 CAAGAGAGTGAGACCCTGTCTGG + Intergenic
1133561559 16:6955219-6955241 CAACAGAGTGAGACCTTGTCTGG + Intronic
1133819834 16:9226346-9226368 CAACAGAGCCAGACCCTGTCAGG - Intergenic
1133987892 16:10682345-10682367 TGACAGAGTGAGACTCTGTCTGG - Intronic
1134068691 16:11247105-11247127 TGACAGAGTGAGACTCTGTCGGG - Intergenic
1134118524 16:11567398-11567420 CAACAGAGCAAGACTCCGTCTGG + Intronic
1134130416 16:11645867-11645889 TGACAGAGTGAGACTCTGTCTGG - Intergenic
1134241625 16:12510974-12510996 CGACAGAGTGAGACTCTGTGGGG - Intronic
1134375975 16:13673619-13673641 CATCAGAGTGAGACCCTGTCAGG + Intergenic
1134448929 16:14351597-14351619 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1134464703 16:14464734-14464756 CAACAGAGGAAGATTCTGTTTGG + Intronic
1134493950 16:14717424-14717446 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134499330 16:14756548-14756570 CAACAGAGGGAGACTCGTCTTGG - Intronic
1134525881 16:14943174-14943196 CAACAGAGGGAGACTCCTTTTGG - Intronic
1134546526 16:15113188-15113210 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134547011 16:15117671-15117693 CAACAGAGGGAGACTCGTCTTGG + Intronic
1134581239 16:15372463-15372485 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134585609 16:15407907-15407929 GAACAGAGAGAGAGTCCGTTAGG - Intronic
1134713461 16:16341662-16341684 CAACAGAGGGAGACTCCTCTTGG - Intergenic
1134721331 16:16385020-16385042 CAACAGAGGGAGACTCCTCTTGG - Intronic
1134946095 16:18326864-18326886 CAACAGAGGGAGACTCCTCTTGG + Intronic
1134953358 16:18367008-18367030 CAACAGAGGGAGACTCCTCTTGG + Intergenic
1135019825 16:18954211-18954233 CAACAGAGCCAGACTCTCTCGGG - Intergenic
1135079627 16:19422926-19422948 CCACAGAGCGAGACTCAGTCTGG + Intronic
1135697307 16:24601216-24601238 CAACAGAGCTAGACTCTGTCTGG - Intergenic
1135706185 16:24677180-24677202 CAACAGAGCGAGACTCTGTCAGG - Intergenic
1135760791 16:25136567-25136589 CAACAGAGTGAGACTCTGACGGG - Intronic
1136039115 16:27564042-27564064 CAACAGAGCAAGACCCTGTCTGG + Intronic
1136151318 16:28351623-28351645 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136167550 16:28465463-28465485 CAACAGAGGGAGACTCGTCTCGG + Intronic
1136195427 16:28649555-28649577 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136211765 16:28763671-28763693 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136256485 16:29043617-29043639 CAACAGAGGGAGACTCGTCTCGG - Intronic
1136465731 16:30442357-30442379 CAACAGAGTGAGACTTTGTCCGG + Intergenic
1136484909 16:30565449-30565471 CAACATAGTGAGACCCTGTCTGG + Intergenic
1136579028 16:31140942-31140964 CGACAGAGCAAGACTCTGTCTGG - Intronic
1137424860 16:48369700-48369722 CAACAGAGTGAGACCCTGTCTGG + Intronic
1137797659 16:51235885-51235907 CGACAGAGGGAGACCCTGTCCGG - Intergenic
1138472234 16:57246782-57246804 CGACAGAGCGAGACTCCGTCTGG + Intronic
1138494785 16:57401502-57401524 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1138638175 16:58361134-58361156 AGAGAGAGAGAGACTCTGTTTGG - Intronic
1138687548 16:58738942-58738964 CAACAGAGTGAGACGCTGTCAGG + Intergenic
1138693102 16:58787146-58787168 CAATAGAGCGAGACTCTGTCGGG - Intergenic
1139200814 16:64974999-64975021 CCACATAGTGAGATTCTGTTTGG - Intronic
1139709794 16:68767212-68767234 CAACAGAGCGAGACTGTCTCAGG - Intronic
1139856555 16:69985123-69985145 CAACAGAGGGAGACTTGTCTCGG + Intergenic
1139902676 16:70340698-70340720 CGACAGAGCGAGACTCCGTCTGG - Intronic
1140366176 16:74382940-74382962 CAACAGAGGGAGACTCGTTTCGG - Intronic
1140460466 16:75135586-75135608 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1140465632 16:75179769-75179791 CAATAGAGTGAGACTCGGGTAGG + Intergenic
1140571629 16:76113214-76113236 CTACAGAGCAAGACTCTGTCTGG + Intergenic
1140692577 16:77498711-77498733 TAACAGAGCGAGACCCTGTCTGG + Intergenic
1141097465 16:81172948-81172970 CCACAGAGGGACTCTCTGGTAGG - Intergenic
1141251592 16:82363815-82363837 TAACAGTGGGAGAGTCTGTCTGG + Intergenic
1141301987 16:82825559-82825581 CAACAGAGGGAGACTCTGTTTGG - Intronic
1141485345 16:84335082-84335104 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1142570539 17:870733-870755 CAACAGAGTGAGACTCTGTCTGG + Intronic
1142643380 17:1297621-1297643 CGACAGAGCAAGACTCTGTCTGG - Intronic
1142781446 17:2184341-2184363 CAACAGAGCAAGACTCTGGGGGG + Intronic
1143092740 17:4458702-4458724 CAACACAGGGAGACCCTGTCTGG - Intronic
1143133390 17:4695300-4695322 CAACAGAGTGAGACTCCGTCTGG + Intronic
1143361679 17:6376271-6376293 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1143502842 17:7348987-7349009 CCTCAGAGGGGGGCTCTGTTCGG - Exonic
1146068082 17:29653604-29653626 CAACAGAGTGAGACTCTGTCTGG - Intronic
1146392511 17:32435760-32435782 CAACAGAGCGAGACTCTGTCTGG + Intergenic
1146801994 17:35832056-35832078 CAACAGAGCAAGACTCCGTCTGG + Intronic
1146862680 17:36318154-36318176 CAACAGAATGAGACCCTGTCTGG + Intronic
1146973453 17:37091597-37091619 CAACAGGAGGAGACCCTGTCTGG - Intronic
1147021045 17:37533379-37533401 TGACAGAGTGAGACTCTGTCTGG + Intronic
1147093008 17:38122250-38122272 CAACAGAATGAGACCCTGTCTGG + Intergenic
1147104200 17:38198238-38198260 CAACAGAATGAGACCCTGTCTGG - Intergenic
1147201361 17:38804023-38804045 CAACAGAGTGAGACCTTGTAGGG + Intronic
1147203046 17:38816702-38816724 CAACAGAGTGAAACTCTGTCTGG - Intronic
1147280109 17:39352659-39352681 CAACAGAGTGAAGCTCTGTCTGG + Intronic
1147288931 17:39425780-39425802 CGACAGAGTGAGACTCTGTCTGG + Intronic
1147638894 17:41981764-41981786 CTCCAGAGGGAGAGTCTATTTGG - Intronic
1147658819 17:42106137-42106159 TAACAGAGTGAGACTCTGTCTGG + Intronic
1147781831 17:42948658-42948680 CAACAGAGTGAGACTATATCTGG + Intergenic
1147827116 17:43276808-43276830 CGACAGAGCGAGAGTTTGTTTGG - Intergenic
1147833382 17:43312897-43312919 CAATAGAGTGAGACTGTGTTGGG + Intergenic
1148112848 17:45156261-45156283 CAACAGAGCAAGACTTTGCTTGG + Intergenic
1148425293 17:47590175-47590197 CAACAGAATGAGACCCTGTCTGG + Intronic
1149748691 17:59124410-59124432 CAACAGAGTGAGACTCTGTCTGG + Intronic
1150972038 17:70039802-70039824 CAACAGAGCAAGAATCTGTCTGG - Intergenic
1151011592 17:70504152-70504174 CAACAGAGCAAGACTCTATCTGG + Intergenic
1151237862 17:72734566-72734588 TAACTGAGAGAGAATCTGTTTGG + Intronic
1151289496 17:73139251-73139273 CAACAGAGTGAGACTCCGCATGG + Intergenic
1151452429 17:74206507-74206529 TAACAGAGGGAGTTTCAGTTTGG - Intronic
1151605594 17:75133382-75133404 TGACAGAGGGAGTCCCTGTTGGG + Intergenic
1151735892 17:75940260-75940282 CAACAGAGCGAGACCCTGTCTGG - Intronic
1151861834 17:76770049-76770071 CGACAGAGCGAGACTCTGTCTGG - Intronic
1151862296 17:76773627-76773649 CAACTGAGCGAGACTCCGTCTGG - Intronic
1151882423 17:76903529-76903551 CACCTGAGGGAGACTCTTTCTGG - Intronic
1152106795 17:78334897-78334919 CAGCAGAGTGAGACGCTGTCTGG - Intergenic
1152127301 17:78454927-78454949 TGACAGAGTGAGACTCTGTCAGG - Intronic
1152177096 17:78794986-78795008 CGACAGAGGGAGACTCTGTTCGG + Intronic
1152192738 17:78898403-78898425 CAGCACAAGGAGACTCTGCTTGG + Intronic
1152398232 17:80048238-80048260 CAACAGAGCAAGACTCTGTCTGG + Intronic
1152497235 17:80682121-80682143 TGACAGAGCGAGACTTTGTTTGG - Intronic
1153009305 18:523373-523395 CCACAGAGTGAGACTCTGTCTGG + Intergenic
1153187097 18:2498185-2498207 CTCCAGAGTGAGACTCTGTCTGG - Intergenic
1153259805 18:3213032-3213054 TAACAGAGCCAGACTCTGCTGGG - Intronic
1154118028 18:11628385-11628407 CAACAGAGGGAGACTTGTCTCGG + Intergenic
1154346343 18:13546386-13546408 CAACAGGGCAAGACTCTGTCAGG - Intronic
1154946841 18:21170229-21170251 CAACAGTGCGAGACTCTGTCTGG + Intergenic
1154960613 18:21304997-21305019 CAACAGAGCGACACTCTGTCTGG - Intronic
1154992087 18:21607050-21607072 CAACAGAGCGAGACTCCATCTGG - Intergenic
1155266899 18:24103080-24103102 CAACAGAGTGAGACCGTGTCTGG + Intronic
1155443541 18:25885845-25885867 AAAGAGAGAGAGACTCTGTTGGG + Intergenic
1155860495 18:30891559-30891581 AGACAGAGCGAGACTCTGTCTGG + Intergenic
1156082446 18:33354628-33354650 CGACAGAGTGAGACTCTGTCTGG - Intronic
1156296597 18:35797400-35797422 CCTTAGAGGGAGACTGTGTTGGG + Intergenic
1157358142 18:46953995-46954017 GAACAGAGGAAGACTTTGTGGGG + Intronic
1157462424 18:47911329-47911351 CAACAGAGCGAGACTCCATCTGG + Intronic
1157997713 18:52578958-52578980 CAACAGAGTGAGACTCCGTCTGG + Intronic
1158575702 18:58635769-58635791 CAACAAAGTGAGACTTTGTCTGG + Intergenic
1159052305 18:63432494-63432516 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1159916779 18:74195019-74195041 CGACAGAGCAAGACCCTGTTGGG - Intergenic
1160779221 19:870539-870561 CAACAGAGTGAGACCCTGTCGGG + Intronic
1160793089 19:932013-932035 CCACAGAGCAAGACTCTCTTGGG - Intronic
1161124570 19:2548459-2548481 CGACAGAGCGAGGCTCTGTCTGG + Intronic
1161188931 19:2942392-2942414 CAACAGAGCTAGACCCTGTCTGG - Intronic
1161424245 19:4193815-4193837 CGACAGAGCGAGACTCCGTCGGG + Intronic
1161616754 19:5275088-5275110 CGACAGAGTGAGACACTGTCTGG - Intronic
1161666257 19:5578812-5578834 CGACAGAGTGAGAGTCCGTTGGG - Intergenic
1161716439 19:5878708-5878730 CGACAGAGGGAGACTCCGTCTGG - Intronic
1161758646 19:6153826-6153848 CAACAGAGTGAGACCCTGTCTGG + Intronic
1161898540 19:7100414-7100436 CAACAGAGCAAGAGACTGTTGGG + Intergenic
1162214612 19:9123013-9123035 CAACAGAGTGAGACTTTGTCTGG - Intergenic
1162280825 19:9696567-9696589 CAACAGAGTGAGACCCTGTCTGG - Intronic
1162451714 19:10758959-10758981 CAATAGAGCGAGACTCTGTGTGG - Intronic
1162455996 19:10785135-10785157 CAACAGAGCGAGACTCCATCTGG - Intronic
1162761706 19:12892309-12892331 CAACAGAGCCAGACTCTGTTGGG - Intronic
1163261340 19:16192073-16192095 CAAGAGAGTGAAACTCTGTCTGG - Intergenic
1163514977 19:17757312-17757334 CAAGAGAGGCAGACGCTGCTGGG + Intronic
1163589576 19:18184719-18184741 CAACAGAGCAAGACTCTTTCAGG - Intergenic
1163719417 19:18891595-18891617 CAACAGAGCGAGACCCTGCCTGG - Intronic
1163805214 19:19392410-19392432 TGACAGAGCGAGACTCTGTCTGG - Intronic
1163879411 19:19904037-19904059 CAACAGAGCGAGATTCTGGCTGG + Intronic
1164196820 19:22974877-22974899 CAACAGAGGGAGACTGTCTAGGG - Intergenic
1164979910 19:32606170-32606192 CGACAGAGCGAGACTCTGTCTGG - Intronic
1165131031 19:33632157-33632179 TGACAGAGGGAGACCCTGTCTGG - Intronic
1165323274 19:35099369-35099391 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1165383682 19:35497973-35497995 CAACAGAGGGAGACCCTGTCTGG - Intronic
1165771463 19:38382890-38382912 TGACAGAGCGAGACTCTGTCTGG + Intronic
1166547330 19:43640986-43641008 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1166664066 19:44666648-44666670 CGACAGAGTGAGAATCTGTCAGG + Intronic
1166698647 19:44868890-44868912 CGACAGAGTGAGACTCTGTCTGG + Intronic
1166894070 19:46012625-46012647 TGACAGAGGGAGACTCTATGTGG + Intronic
1166941604 19:46369904-46369926 CAGCAGAGCGAGACTCCGTCTGG + Intronic
1166946328 19:46399152-46399174 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1167067293 19:47196063-47196085 CAACAGAGCGAGACTCCGTCTGG - Intronic
1167076186 19:47250923-47250945 CAACAGAGCCAGGCTCTGTGGGG - Intergenic
1167765005 19:51476253-51476275 GGACAGAGTGAGACTCTGTCTGG + Intergenic
1167924342 19:52810913-52810935 CATCAGAGGGAGACTGTGGAGGG - Intronic
1168218471 19:54943579-54943601 CGACAGAGCGAGACTCCGTCTGG + Intronic
1168596305 19:57680546-57680568 CAACAGAGTGAGACTCCGTCTGG + Intergenic
1168672035 19:58247932-58247954 TGACAGAGTGAGACTCTGTCTGG - Intronic
925371031 2:3345603-3345625 CAATAGAGCGAGACTCTGTCTGG + Intronic
925429853 2:3781843-3781865 TGACAGAGAGAGACTCTGTCTGG + Intronic
926249331 2:11145001-11145023 CGACAGTGCGAGACTCTGTCTGG - Exonic
926379780 2:12275379-12275401 CAACAAAGCGAGACTCCGTCTGG + Intergenic
927557484 2:24046092-24046114 TGACAGAGTGAGACCCTGTTGGG + Intronic
927632439 2:24786227-24786249 CAACAGAGTGAGACTTTGTCTGG - Intergenic
927930037 2:27038113-27038135 CGACAGAGGGAGAGGCTGCTGGG - Intronic
928159591 2:28909851-28909873 CAACACAGTGAGACCCTGTTTGG + Intronic
928497571 2:31849578-31849600 CAACACAGGGAGACCGTCTTGGG + Intergenic
928667696 2:33567186-33567208 CAACAGAGCGACACACTGTCTGG + Intergenic
929184714 2:39081498-39081520 CAACAGAGTGAGACTGTCCTCGG + Intronic
930027782 2:47039965-47039987 CAGCAGGGGCTGACTCTGTTAGG + Intronic
930525972 2:52530108-52530130 CAACAGAATGAGACCCTGTCTGG - Intergenic
931170235 2:59795406-59795428 CAGGAGAGAGAGACTGTGTTGGG - Intergenic
931189639 2:59987770-59987792 GAACAGAGAGAGTCTCTTTTTGG - Intergenic
931740048 2:65233920-65233942 CAACAGAGTGAGACCCTGTCAGG - Intronic
932382639 2:71299198-71299220 CAACAGAGCGAGACCCTGTCTGG + Intronic
932627800 2:73312790-73312812 AAACAAAGGTAGACTCTTTTTGG + Intergenic
932724729 2:74169646-74169668 CAACAGAGTGAGACCCAGTCGGG - Intronic
932967329 2:76492120-76492142 CAACAGAGTAAGACTCTCTAGGG - Intergenic
933539354 2:83618984-83619006 CCCCAGTGGAAGACTCTGTTTGG + Intergenic
933592488 2:84248305-84248327 CAACAGAGTGAGACTCTGTCAGG - Intergenic
933945548 2:87283366-87283388 TGACAGAGTGAGACTCTGTCTGG - Intergenic
934706048 2:96481936-96481958 CAACAGAGCGAGACTCTGTCTGG + Intergenic
936011067 2:108925635-108925657 CAACAGAAGGAGACTGTTTCAGG - Intronic
936334664 2:111578220-111578242 TGACAGAGTGAGACTCTGTCTGG + Intergenic
936652953 2:114450788-114450810 CAACAGGGGTTGTCTCTGTTTGG - Intronic
936939482 2:117869785-117869807 CGAAAGAGTGAGACTCTGTCTGG - Intergenic
937028978 2:118722216-118722238 CAGCTCAGGGAGCCTCTGTTGGG - Intergenic
937202692 2:120215613-120215635 CGACAGAGCGAGACTCCGTCTGG - Intergenic
938013544 2:127848534-127848556 CGACAGAGCAAGACTCCGTTTGG - Intronic
938253272 2:129833044-129833066 CATCAGAGGGAGACTGTGGGGGG - Intergenic
938275621 2:130018971-130018993 CAACAGAGTGAAACTCTTTCTGG - Intergenic
938413351 2:131083922-131083944 CGACAGAGCGAGACTCCGTCTGG - Intronic
938413858 2:131088224-131088246 CAACAGAGCAAGACTCTGTCTGG + Intronic
938894124 2:135733938-135733960 CAACAGAGCGAGACGCCGTCTGG + Intergenic
939531294 2:143364984-143365006 CAACAGAGCGAGACTCTGTGTGG + Intronic
939819749 2:146943282-146943304 AAACAGAGGAAGACTCTACTAGG - Intergenic
939896256 2:147794396-147794418 TGACAGAGAGAGACTCTGTCTGG + Intergenic
940304134 2:152207607-152207629 CAACAGAGCCAGACTCTGTGTGG - Intergenic
940509842 2:154599298-154599320 CGACAGAGCAAGACTCTGTCTGG + Intergenic
941956024 2:171205340-171205362 TAACAGAGCAAGACCCTGTTGGG - Intronic
942001464 2:171652480-171652502 ACACAGAGAGAGACTCTGTTTGG - Intergenic
942654269 2:178198320-178198342 CGACAGAGCGAGATTCTGTCTGG - Intronic
943753500 2:191534853-191534875 AAACAGTGGGAGACTCTGTGTGG + Intergenic
944390159 2:199209702-199209724 CAAAAGAGAGAGACTCCATTAGG + Intergenic
944704973 2:202279772-202279794 CAACAGAGCGAGACTCCTTCTGG + Intronic
944717167 2:202386698-202386720 CGACAGAGCAAGACTCTGTCTGG - Intronic
944840837 2:203622084-203622106 CAACAGAGGGAAAATCTTTGGGG + Intergenic
945280800 2:208033664-208033686 CAACAGAGTGAGACTCCATCTGG + Intergenic
945388094 2:209228433-209228455 TGACAGAGTGAGACTCTGTCTGG - Intergenic
945703118 2:213196529-213196551 AAATAGAAAGAGACTCTGTTGGG + Intergenic
946969799 2:225079263-225079285 CAACAGAGCAGGACTCTGTATGG - Intergenic
946984829 2:225259054-225259076 ACTCAGAGAGAGACTCTGTTTGG + Intergenic
947078066 2:226365845-226365867 CGACAGAGTGAGACTCTATCTGG - Intergenic
947116500 2:226776884-226776906 CAACACAGTGAGACTCTTTGTGG + Intronic
947297178 2:228643894-228643916 CGACAGAGTGAGACTCTGTCTGG + Intergenic
947442542 2:230135919-230135941 CAACAGAGTGAGATCCTGTGTGG - Intergenic
947487159 2:230561826-230561848 TGACAGAGTGAGACTCTGTCTGG + Intergenic
947505174 2:230703285-230703307 CAACAGAGTGAGACTCTGTCTGG - Intergenic
947723772 2:232384391-232384413 CAACAGAGCAAGACCCTGTCTGG + Intergenic
947730215 2:232424154-232424176 CAACAGAGCAGGACTCTGTTGGG - Intergenic
948008826 2:234634258-234634280 CGACAGAGCTAGACTCTGTCGGG - Intergenic
948742884 2:240059513-240059535 CGACAGAGCAAGACTCTGTCTGG + Intergenic
1169169617 20:3454270-3454292 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1169419898 20:5451471-5451493 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1170249010 20:14258960-14258982 TAACAGAGCAAGACTCTGTCTGG - Intronic
1172411570 20:34727741-34727763 CGACAGAGTGACACTCTGTCTGG - Intronic
1172665219 20:36594473-36594495 CAACAGTGGGAAACTGAGTTTGG + Intronic
1173008381 20:39158360-39158382 CAACACAGTGAGACCCTGTCTGG - Intergenic
1173681036 20:44882035-44882057 CAACAGAGTGAGACTCTCTCTGG + Intergenic
1174014334 20:47475613-47475635 CAACAGAGTGAGACTCTGTTGGG + Intergenic
1174602119 20:51733391-51733413 CAACAGAATTAGACTCTGTCTGG - Intronic
1174777467 20:53358358-53358380 TGACAGAATGAGACTCTGTTTGG - Intronic
1174810370 20:53640368-53640390 CGACAGAGTGAGACTTTGTTTGG - Intergenic
1174825178 20:53762253-53762275 CAACAGAGTGAGACCCTGTCAGG - Intergenic
1175235331 20:57506321-57506343 CAACAGAGCGAGACTGTCTCAGG - Intronic
1175709630 20:61208982-61209004 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1175848833 20:62075897-62075919 CAACAGAGTGAAACTTTGTCTGG + Intergenic
1175884927 20:62284394-62284416 CAACAGAGGGAGACCCTGCCTGG - Intronic
1176888604 21:14286363-14286385 CAACAGAGCAAGAGTCTGTGGGG + Intergenic
1177456433 21:21344927-21344949 AAATAGAGTGAGACTGTGTTTGG + Intronic
1177846596 21:26296048-26296070 CAACAGAATGAGACTCTGTCTGG - Intergenic
1178608703 21:34061073-34061095 CAAAAGAGTGAAACTCTGTCTGG + Intergenic
1178628303 21:34236858-34236880 CAACAAAATGAGACTCTGTCTGG + Intergenic
1178803116 21:35815672-35815694 AAAGAGAGGGAGATTCTCTTGGG - Intronic
1179663836 21:42896001-42896023 CAACAGAGTGAGACTGTCTCAGG - Intronic
1180166175 21:46031104-46031126 CCACAGAGTGAGACTCTGTCGGG - Intergenic
1180608444 22:17079475-17079497 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1181754762 22:25016038-25016060 CAACAGAGCGAGACTCCGTCTGG - Intronic
1181776672 22:25164926-25164948 CAACAGAGTGAGACTGTCTCGGG + Intronic
1182033381 22:27178161-27178183 CAACAGAGTGAGACTCTTCTCGG + Intergenic
1182231779 22:28842947-28842969 CAACAGAGCAAGACTCTGTCTGG + Intergenic
1182234795 22:28866760-28866782 TGACAGAGGGAGACCCTGTTAGG + Intergenic
1182340346 22:29615162-29615184 CAACAAAGCAAGACTCTGTCTGG + Intronic
1182373589 22:29829677-29829699 CGACAGAGCAAGACTCTGTCTGG + Intronic
1182479963 22:30601790-30601812 AAACAGAGCGAGACTGTGTCTGG - Intronic
1182655889 22:31889567-31889589 CAACAGAGCGAGACTCTGTCTGG - Intronic
1182686566 22:32124795-32124817 CAATAGAGCAAGACTCTGTCTGG - Intergenic
1182896336 22:33862296-33862318 GAGCAAAGGAAGACTCTGTTCGG + Intronic
1182979636 22:34656970-34656992 CAACAGAGTGAGACTCCTTCTGG - Intergenic
1183647720 22:39136068-39136090 CGACAGAGCGAGACTCTGTCTGG + Intronic
1183845922 22:40539927-40539949 CAACAGAGTGAGACCCTGTCTGG - Intronic
1183879887 22:40818684-40818706 CAACAGAGCAAGACCCTGTCCGG + Intronic
1183945585 22:41324048-41324070 CGACACAGCGAGACTCTGTCTGG + Intronic
1184200351 22:42964396-42964418 CGACAGAGCGAGACTCCGTCTGG + Intronic
1184479799 22:44739585-44739607 TGACAGAGCGAGACTCTGTTGGG - Intronic
1184513904 22:44948669-44948691 TGACAGAGTGAGACTCTGTCTGG + Intronic
949152881 3:791680-791702 TGACAGAGTGAGACTCTGTCTGG + Intergenic
949181107 3:1132537-1132559 CAACATAGAAAGACCCTGTTTGG + Intronic
949183721 3:1165987-1166009 CAAGAGAGGGAGACTTTCTGTGG - Intronic
949235586 3:1805444-1805466 CAGCTCAGAGAGACTCTGTTTGG - Intergenic
949268650 3:2188823-2188845 AAACAAAGGGAGACTCTGTTGGG + Intronic
950001387 3:9659208-9659230 CAACAGAGGAAGACCTTGTTGGG + Intronic
950082743 3:10235030-10235052 CCACAGAGGGAGAACCTGATTGG + Intronic
950211015 3:11123357-11123379 CAACAGAGCAAGACCCTGTCTGG + Intergenic
950308718 3:11937180-11937202 CAACAGAATGAGACCCTGTCTGG - Intergenic
950383015 3:12633461-12633483 CAACAGAGGGAGACCCTGTCTGG + Intronic
951918459 3:27826803-27826825 CAACATAGACAGACTCTGTAGGG + Intergenic
952303341 3:32124083-32124105 CTACAGAGGAAGACTCTGTCTGG - Intronic
952768727 3:36977725-36977747 TGACAGAGGGAGACCCTGTCAGG + Intergenic
952792951 3:37214760-37214782 TAACAGAGTGAGACCCTGTCTGG + Intergenic
953306680 3:41837581-41837603 TGACAGAGTGAGACTCTGTCTGG - Intronic
953365800 3:42343875-42343897 CAACAGAGCGAGACTCTGTCTGG - Intergenic
953552639 3:43915929-43915951 CAACGGAGCAAGACTCTGTCTGG - Intergenic
953744986 3:45567240-45567262 CAGCAGAGGGAGGATCTGTGAGG + Intronic
953752694 3:45621248-45621270 CAACAGAGCAAGACCCTGTAAGG - Intronic
954058602 3:48049916-48049938 CAACAGAGTGAGACTTCGTCTGG + Intronic
954070877 3:48142075-48142097 CGACAAAGCGAGACTCTGTCTGG - Intergenic
954349357 3:50030007-50030029 CAACAGAGTGAGACTTTGGGAGG + Intronic
954526007 3:51271829-51271851 CAACAGAGCGAGACTGTCTCAGG + Intronic
954678712 3:52329803-52329825 CAACAGAGTGAGACTCCATCTGG + Intronic
955328406 3:58027170-58027192 TGACAGAGGGAGACCCTGTCTGG - Intronic
955361060 3:58275347-58275369 TGACAGAGTGAGACTCTGTCTGG - Intronic
955844229 3:63144357-63144379 AAACAGAGAGAGGCTCTGTTTGG - Intergenic
956254974 3:67273783-67273805 CAACAAATTGAAACTCTGTTGGG - Intergenic
956863453 3:73347269-73347291 TGACAGAGCGAGACTCTGTCAGG - Intergenic
958608675 3:96395080-96395102 TGACAGAGTGAGACTCTGTCTGG - Intergenic
958930361 3:100201447-100201469 CGACAGAGCAAGACTCTGTCTGG - Intergenic
959332829 3:105027419-105027441 CAACAGAGTGAGACTCTATCTGG - Intergenic
959374005 3:105565008-105565030 CAACAGAGCAAGACTCTGTCTGG + Intronic
960207208 3:114917716-114917738 TCACACAGAGAGACTCTGTTTGG - Intronic
961186686 3:124921167-124921189 CAACAGAGTGAGACTCTGCCTGG - Intronic
961952414 3:130763272-130763294 ACACAGAGGGAGACTCTGTTAGG + Intergenic
962015273 3:131432390-131432412 ACACAGAGAGAGACTCTGTTTGG + Intergenic
963195141 3:142519319-142519341 TGACAGAGCGAGACTTTGTTTGG - Intronic
963378440 3:144499042-144499064 CAATAGAGGTAAACTCTGCTGGG + Intergenic
963498217 3:146095910-146095932 CATCAGAGGGAGACTGTGGAGGG - Intronic
963810162 3:149768559-149768581 CAACAGAGCAAGACTCTGTCTGG - Intronic
963893712 3:150663472-150663494 CAACAGAGCAAGACCCTGTTAGG - Intronic
964113216 3:153108321-153108343 CAACAGAGTGAGACTCCGTCTGG + Intergenic
964356506 3:155855886-155855908 CGACAGAGTGAGACTCCGTCTGG + Intergenic
964609906 3:158601734-158601756 CAAAAGAGCAAGACTGTGTTGGG + Intronic
964622320 3:158730443-158730465 CAACAGAGTGAGACCCTATGGGG - Intronic
964804187 3:160588353-160588375 AGAGAGAGAGAGACTCTGTTTGG + Intergenic
965398797 3:168193756-168193778 TGACAGAGGGAGACTCCGTTTGG - Intergenic
965724613 3:171700971-171700993 CAGCAGAGGTAGACTATGTCAGG + Intronic
965770175 3:172173798-172173820 CAACAGAGCAAGACCCTGTCTGG + Intronic
966872047 3:184297112-184297134 CGACAGAGCGAGACTCCGTCTGG + Intronic
967058654 3:185851967-185851989 CGACAGAGAGAGACCCTGTGTGG + Intergenic
968036346 3:195551333-195551355 CAATAGAGTGAGACTCAGTCTGG + Intergenic
968130163 3:196188557-196188579 CAACAGAGTGAGACTCCATCTGG - Intergenic
968326213 3:197819104-197819126 CAACAGAGTGAGATTCCGTCTGG + Intronic
968852966 4:3095498-3095520 CATCAGAGGGAGACTGTGCGAGG + Intronic
969112016 4:4850150-4850172 CAACAGAGTGAGACCCTGTCTGG + Intergenic
969397539 4:6932349-6932371 CGACAGAGCAAGACTCTGTCTGG + Intronic
969595270 4:8145201-8145223 CGACAGAGCGAGACTCTGTCTGG - Intronic
969656270 4:8500474-8500496 CAACAGAGCGAGACTCCCTCTGG + Intergenic
969725397 4:8915396-8915418 AGACAGAGGAAGACTCTGTATGG - Intergenic
969869216 4:10094406-10094428 CAACAGAGAGAAACTCAGTGGGG + Intronic
970081997 4:12298022-12298044 CAACAGAGTGAGACTGTCTCAGG - Intergenic
970192997 4:13532921-13532943 CAACAGAGCAAGACTCTGGACGG - Intergenic
970729360 4:19084712-19084734 AAACAGACGGAGGCTCTCTTTGG + Intergenic
971849191 4:31961328-31961350 CCACAGAGTGAGACTCTGTCTGG - Intergenic
972425189 4:38926472-38926494 CAACAGAATGAGACTCTATCTGG - Intronic
972531182 4:39962774-39962796 CAACAGAGCGAGACTCCGTCTGG + Intronic
972646606 4:40973869-40973891 CGACAGAGTGAGACTCTGTCTGG - Intronic
973160255 4:47007118-47007140 TGACAGAGCGAGACCCTGTTTGG + Intronic
973677545 4:53280494-53280516 CGACAGAGGGAAACTCTGTCTGG + Intronic
974148416 4:57974513-57974535 CGACAGAGCGAGACTCTGTCTGG - Intergenic
975068513 4:70100924-70100946 CGACAGAGCGAGACTCTGTCTGG + Intergenic
975369384 4:73567588-73567610 AGAGAGAGAGAGACTCTGTTTGG - Intergenic
975581704 4:75912532-75912554 TGACAGAGGGAGACTCTGTCTGG + Intergenic
976155149 4:82136060-82136082 TGACAGAGTGAGACTCTGTCTGG + Intergenic
976171604 4:82310583-82310605 CAGCACAGAGAGACTCTATTTGG - Intergenic
976434428 4:85000947-85000969 CAAGAGAGGGTAACTCTGTGAGG - Intergenic
976664666 4:87577698-87577720 CAACAGAGCAAGACTCTGTCTGG - Intergenic
977697812 4:99986153-99986175 CAACAGAGTGAGACTCTGTCTGG + Intergenic
977854814 4:101876352-101876374 GAACAGAGGGAGGCTTTGTTTGG + Intronic
979319079 4:119301405-119301427 CAACAGAGCGAGACTCCATCTGG + Intronic
979573109 4:122252950-122252972 ACACAGAGAGAGACTCTGCTTGG + Intronic
979685363 4:123505835-123505857 CAACAAAGGCAGATTCTGGTGGG - Intergenic
980112970 4:128652430-128652452 TAACAGAGCAAGACTCCGTTTGG + Intergenic
980677613 4:136109554-136109576 TGACAGAGGGAGTCTCTGTCTGG - Intergenic
980773088 4:137404316-137404338 CAACAGAGCGAAACTCCGTCTGG - Intergenic
980773509 4:137409539-137409561 TGACAGAGCGAGACTCTGTCTGG - Intergenic
981130476 4:141153269-141153291 CCACAGATGGTGACTGTGTTTGG + Intronic
981518237 4:145633911-145633933 AAACAGACAGAGATTCTGTTTGG - Intronic
981570614 4:146147030-146147052 CAACAGAGGGATTCTGAGTTAGG + Intergenic
981759516 4:148178309-148178331 CAACAGAGTGAGACTCTGTCTGG + Intronic
981806762 4:148724994-148725016 CAACATAGGGAGACCCCGTCTGG - Intergenic
981923473 4:150112828-150112850 CAACAGAAAAAGACTCTGTCCGG - Intronic
982109435 4:152040406-152040428 CAACAGAACGAGACTCCATTTGG - Intergenic
982178301 4:152727260-152727282 TAACAGAGTGAGACACTGTTTGG - Intronic
982453410 4:155578777-155578799 CTACAGAGTGAGACTCTGTCTGG + Intergenic
983165851 4:164476939-164476961 AGAGAGAGAGAGACTCTGTTTGG - Intergenic
983467423 4:168112276-168112298 CAGCAGAGCAAGACTCTGTCTGG + Intronic
983613911 4:169679857-169679879 CAACAGAGGGAGACCGTGGAAGG + Intronic
983780667 4:171666402-171666424 CAACAGAGTGACACCCTGTCTGG + Intergenic
984191337 4:176609567-176609589 GAACAGAGGGAAAGTCTGTGTGG + Intergenic
984776489 4:183485595-183485617 TGACAGAGCAAGACTCTGTTTGG + Intergenic
984950999 4:185007735-185007757 CAACAGAGCAAGACTCCGTCTGG - Intergenic
986231194 5:5866187-5866209 CAACAGAGCAAGACCCTGTTTGG - Intergenic
986486397 5:8242566-8242588 CAGAAGAGGGAGATTCTGATTGG - Intergenic
986874668 5:12093730-12093752 CAACAGAGTGAAACTCTGTTGGG + Intergenic
987071424 5:14340375-14340397 CAACAGAGCAAGACTCCGTCTGG + Intronic
987255269 5:16143816-16143838 CCCCAGAGAGAGACTCTGCTTGG + Intronic
987376507 5:17240236-17240258 CAACAGAGTGAGGCTCTGGCCGG + Intronic
987609547 5:20184593-20184615 CACCACAGGGTGATTCTGTTAGG + Intronic
987711782 5:21510293-21510315 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
987916601 5:24223293-24223315 CACTAGAGCGAGACTCTGTCTGG - Intergenic
988302630 5:29450487-29450509 CAAGAGAGAGAGAGTGTGTTGGG - Intergenic
988502761 5:31797431-31797453 CAACAGAGTGAAACCCTGTCTGG + Intronic
989017502 5:36956208-36956230 CAACAGAGTAAGACTCCGTCTGG + Intronic
989036089 5:37173488-37173510 CAACATAGTGAGACTCTGCTAGG - Intronic
989391883 5:40909215-40909237 CAACCAAAGGAGACTCTGTAAGG - Intergenic
990173900 5:53085926-53085948 CAACAGAGCAAGGCTCTGTCTGG - Intronic
991193341 5:63902082-63902104 TGACAGAGGGAGACTCTGTCTGG - Intergenic
991661158 5:68952048-68952070 TGACTGAGCGAGACTCTGTTTGG - Intergenic
991762149 5:69929435-69929457 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
991785179 5:70188665-70188687 CAAGAGAGAGAGAGTGTGTTGGG - Intergenic
991841377 5:70804484-70804506 CAAGAGAGAGAGAGTGTGTTGGG + Intergenic
991877626 5:71189063-71189085 CAAGAGAGAGAGAGTATGTTGGG - Intergenic
992199380 5:74368766-74368788 TGACAGAGTGAGACTCTGTCTGG - Intergenic
992436593 5:76760705-76760727 CAACAGAGCAAGATTCTGTCTGG + Intergenic
992739112 5:79755304-79755326 CGACAGAGTGAGACTCTGTGTGG - Intronic
992810024 5:80377374-80377396 CAACACAGCAAGACTCTGTCTGG + Intergenic
994196822 5:96931174-96931196 CAACAGAGTGAGATCCTGTCTGG - Intronic
994275264 5:97829335-97829357 CATCAGAGGGAAACTCCCTTAGG + Intergenic
994301593 5:98154517-98154539 CAACAGAGCAAGACTCTGACTGG + Intergenic
995157850 5:108936883-108936905 CAACAGAGGAATACTATCTTGGG - Intronic
995522320 5:113021346-113021368 GAACAGAGCAAGACTCTGTCTGG + Intergenic
995584913 5:113638562-113638584 CAACAGAGAGGGCCTCAGTTTGG + Intergenic
995864710 5:116678770-116678792 CAACAGAGAGAGACTCTGTCTGG - Intergenic
996164575 5:120209385-120209407 CAACAGAGTGAGACTGTGCCTGG + Intergenic
997222098 5:132177950-132177972 CGACAGAGTGAGACTCTCTTGGG - Intergenic
997550899 5:134752405-134752427 CAACAGTGGTAAACACTGTTTGG - Intergenic
997958463 5:138299171-138299193 TTACAGAGGGAGACTCTGTCTGG + Intronic
998659166 5:144216822-144216844 CCACAGAGGGAGACTCTGTCTGG + Intronic
998725338 5:145006521-145006543 CAACAGAGCGAGATGCTGTCTGG - Intergenic
998827249 5:146115021-146115043 CAACAGAGCAAGATTCTGTCGGG + Intronic
998835399 5:146198200-146198222 CAACAGAGCAAGACTCTTTCGGG - Intergenic
999406473 5:151311695-151311717 ACAAAGAGAGAGACTCTGTTTGG - Intergenic
999773178 5:154790834-154790856 AAAAAGAGTGAAACTCTGTTGGG - Intronic
999886171 5:155925516-155925538 AAACAGAGGCAGAGTCTGATTGG - Intronic
1000059920 5:157645640-157645662 CAACAGAGTGAGACCCTGTCTGG + Intronic
1000514823 5:162226835-162226857 CAACATGGTGAAACTCTGTTGGG + Intergenic
1002308991 5:178303018-178303040 CAACAGAGCTAGACTCTGTCAGG - Intronic
1002320487 5:178372590-178372612 CAATAGAGAGAGACTTTGTCTGG - Intronic
1002490333 5:179571482-179571504 CAACAGAGCCAGACTCTGTCTGG + Intronic
1002807367 6:590093-590115 CGACAAAGCGAGACTCTGTCTGG + Intronic
1003577051 6:7306895-7306917 CGACAGAGCGAGACTCTGTCTGG + Intronic
1003595710 6:7472442-7472464 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1003652379 6:7973332-7973354 CGACAGAGCAAGACTCTGTCTGG - Intronic
1003920870 6:10831957-10831979 AGACAGAGTGAGACTCTGGTTGG + Intronic
1004032523 6:11884856-11884878 CAACAGAGAGGGATTTTGTTGGG - Intergenic
1004072254 6:12311293-12311315 CAACAGAGGGAGTCCTTGTAAGG + Intergenic
1004149936 6:13107135-13107157 CAACAGAGCAAGAGTCTGTCTGG - Intronic
1004476078 6:15973510-15973532 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1004625892 6:17376769-17376791 TGACAGAGCGAGACTCCGTTTGG + Intergenic
1005400685 6:25430447-25430469 CAACAGTGCGAGACCCTGTCTGG - Intronic
1005515103 6:26547254-26547276 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1005547013 6:26882361-26882383 CAACAGAACAAGACTCTGTCAGG + Intergenic
1005570862 6:27144440-27144462 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1006363596 6:33601384-33601406 CAACAGAGTGAGACTTGGCTGGG - Intergenic
1006674932 6:35755907-35755929 CATCAGAGGGAAACTCTGATTGG - Intergenic
1006885621 6:37379931-37379953 CGACAGAGTGAGACACTGTCTGG - Intronic
1007542500 6:42660945-42660967 CAACGGAGCGAGACCCTGTGTGG + Intronic
1007611554 6:43152505-43152527 CGACAGAGTGAGACTCCGTCTGG + Intronic
1007792582 6:44320127-44320149 CAACAGAGCGAGACTCTGTCTGG + Intronic
1008132766 6:47737747-47737769 CGACAGAGCAAGACTCTGTCTGG - Intergenic
1008540067 6:52538510-52538532 CAACTGAAGGAGGCTCTGTGGGG - Intronic
1008784971 6:55157680-55157702 AAAGAGAGAGTGACTCTGTTTGG + Intronic
1008826530 6:55701454-55701476 TGACAGAGCGAGACTCTGTCTGG - Intergenic
1009847252 6:69149881-69149903 ATAAAGAGAGAGACTCTGTTTGG - Intronic
1009907217 6:69884874-69884896 CAACAGAGCGAGACTCAGTCTGG - Intronic
1010293409 6:74166990-74167012 CAGCAGAGGCTGACTCAGTTTGG - Intergenic
1010483463 6:76381929-76381951 GGACAGAGAGACACTCTGTTTGG - Intergenic
1011075508 6:83434323-83434345 CAACAGCGTGAGACTCTGTTGGG - Intergenic
1011084465 6:83523776-83523798 CCACAAAGGGAGTATCTGTTAGG + Exonic
1012106339 6:95164914-95164936 TGACAGAGTGAGACTCTGTTAGG - Intergenic
1012261350 6:97091187-97091209 CAATAGAGCGAGACCCTGTCTGG + Intronic
1012429576 6:99150540-99150562 CAAAAGAGTGACACTCTGTTGGG + Intergenic
1012555161 6:100502523-100502545 AAACAGAGCAAGACTCTGTCTGG + Intergenic
1013266247 6:108502044-108502066 CAACAGAGTGAGACTCTGTCTGG - Intronic
1013931124 6:115534392-115534414 CAACAGAGTGAGACCCCGTCTGG - Intergenic
1014319710 6:119911771-119911793 TGACAGAGCGAGACTCTGTCTGG + Intergenic
1014682363 6:124447515-124447537 CAACAAAGGAATACTCTGCTTGG + Intronic
1015240074 6:131012183-131012205 CAACTGAGGGAGACTCTAGATGG + Intronic
1015338889 6:132074789-132074811 CAACAGAGCAAGACTCTGTCTGG - Intergenic
1015764361 6:136700052-136700074 TGACAGAGCGAGACTCTGTCAGG + Intronic
1015950417 6:138547398-138547420 CAACAGAGTGAGACCCTCTCAGG - Intronic
1016678427 6:146799511-146799533 CAACAGAGCAAGACTCTGGGGGG + Intronic
1016827364 6:148400729-148400751 CGACAGAGTGAGACTTTGTCTGG + Intronic
1016910866 6:149197692-149197714 CAAAAGAGGGAGACTCTAAATGG - Intergenic
1017290336 6:152728142-152728164 CAACAGAGTGAGCCTCTGTCTGG + Intergenic
1017471713 6:154744270-154744292 CAACAGAGCAAGACTCTGGCTGG + Intronic
1017985191 6:159437221-159437243 CAAAAGAGGGAGAAAATGTTGGG + Intergenic
1018359959 6:163057433-163057455 TGACAGAGTGAGACTCTGTCTGG - Intronic
1018364332 6:163102490-163102512 CCAGAGAGGGAGACTCTCCTTGG - Intronic
1018693601 6:166370809-166370831 CAACAGAGCAAGACCCTGTCTGG + Intronic
1019554969 7:1624805-1624827 CCTCAGAATGAGACTCTGTTTGG - Intergenic
1020052335 7:5090119-5090141 CAACAGAATGAGACCCTCTTTGG - Intergenic
1020095240 7:5364782-5364804 CAACAGAGGGAGGCTGTCTCAGG + Intronic
1020185065 7:5952757-5952779 CAACAGAGAAAGACTCCGTCTGG - Intronic
1020213923 7:6174565-6174587 CAGCAGAGCGAGACTCTGTCTGG - Intronic
1020628348 7:10610560-10610582 CAACAGAGCGAGACTGCGTCTGG - Intergenic
1021703209 7:23340867-23340889 CGACAGAGCGAAACTCTGTCTGG - Intronic
1021712900 7:23434056-23434078 AGACAGAGTGAGACTCTGTCTGG + Intronic
1022419308 7:30205815-30205837 TAACATAGGGAGAATGTGTTGGG + Intergenic
1022443177 7:30450172-30450194 CAACAGAGCGGGACTCCATTTGG + Intronic
1023004872 7:35853403-35853425 CGACAGAGTGAGACTCTCCTCGG + Intronic
1023387592 7:39675711-39675733 CAACAGAGTGAGACCATGTCTGG + Intronic
1023476729 7:40587920-40587942 CGGCAGAGTGAGACTCTGTCTGG - Intronic
1023803471 7:43854641-43854663 CAACAGAGTGAGACTTAATTAGG - Intergenic
1023919533 7:44616929-44616951 CGACAGAGCGAGACTCCTTTCGG + Intronic
1023975983 7:45030454-45030476 AAACAGAGTGAGACCCTGTCTGG - Intronic
1024257188 7:47547918-47547940 CGACAGAGTGAGACTCCGTCAGG - Intronic
1024350834 7:48361074-48361096 CAACAGAGTGAGACCCTGTTTGG + Intronic
1024486014 7:49920573-49920595 GAACAGAGAGAGACTCTGCTTGG + Exonic
1024625289 7:51203019-51203041 TGACAGAGCGAGACTCTGTCTGG + Intronic
1024705776 7:51958544-51958566 GAACAGAGAGATACTCTGTTTGG - Intergenic
1024956628 7:54927386-54927408 AAAGAGAGAGAGACTTTGTTTGG + Intergenic
1025241354 7:57278827-57278849 CGACAGAGCGAGACTCTGTCTGG - Intergenic
1026004024 7:66586734-66586756 CGACAGAGTGAGACTCAGTCTGG - Intergenic
1026460466 7:70610453-70610475 CAACAGAATGAGACTCTGTCAGG - Intronic
1026472946 7:70709690-70709712 CAACAGAGCAAGATTCTGTCTGG + Intronic
1026618080 7:71925219-71925241 CAACACAGTGAGACTCTGAGGGG + Intronic
1026629562 7:72026563-72026585 CGACAGAGCAAGACTCTGTCTGG + Intronic
1026835656 7:73637453-73637475 TGACAGAGTGAGACTCTGTCTGG + Intergenic
1026956466 7:74379307-74379329 CAACAGAGGGAGACTCCGTCTGG + Intronic
1027198895 7:76050049-76050071 CAACAGAGTGGGACTCTGTCAGG - Intronic
1027800456 7:82743730-82743752 CAACAGAACAAGACTCTGTCTGG + Intergenic
1027996222 7:85427910-85427932 AGAGAGAGAGAGACTCTGTTTGG + Intergenic
1028038705 7:86019616-86019638 AGACAGAGTGAGACTCTGTCTGG + Intergenic
1028179276 7:87698821-87698843 CAACAGAGGGACTAGCTGTTGGG + Intronic
1028354223 7:89886944-89886966 GCACAGAGAGAAACTCTGTTTGG - Intergenic
1028397619 7:90389405-90389427 CAAGAGAGCGAGACTCCGTCTGG - Exonic
1028521889 7:91741634-91741656 GAACAGAGAAACACTCTGTTTGG - Intronic
1028545363 7:91993206-91993228 CAACAGAGCAAGACCCTGTATGG - Intronic
1028592334 7:92511157-92511179 CAGCAGAGTGAGACCCTGTTGGG - Intronic
1028716575 7:93978089-93978111 CAACAGAGTGACACCCTGTCTGG - Intronic
1029030498 7:97461530-97461552 CAACGGAGTGAGACTCTGTCTGG + Intergenic
1029134752 7:98361335-98361357 CGACAGAGCAAGACTCTGTCTGG + Intronic
1029519324 7:101050217-101050239 CCACAAAGGGAGTCTCTGGTAGG - Intronic
1029646767 7:101861852-101861874 CCACAGAGGGAGACTCCGGGAGG - Intronic
1029733648 7:102453746-102453768 CGACAGAGTGAGACTCTATCTGG - Exonic
1029789414 7:102826860-102826882 CAAGAGAGGGAGAGGCTCTTAGG + Intronic
1029797184 7:102908747-102908769 CAGAACAGAGAGACTCTGTTTGG - Intronic
1029802541 7:102964420-102964442 CAACAGAGAGAGACTCAGTCTGG - Intronic
1030048806 7:105520850-105520872 CAACACAGCGAGACCCTGTGTGG + Intronic
1030348480 7:108457685-108457707 GAACCGAGGGAGGCTCTGTGAGG - Intergenic
1030652169 7:112128007-112128029 CAACAGAGCGAGACTCTGTCGGG + Intronic
1032164433 7:129534279-129534301 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1032248509 7:130233024-130233046 CAACAGAGTGAGACTCCATCTGG - Intergenic
1033114804 7:138615773-138615795 CGACAGAGTGAGACTCCGTCTGG + Intronic
1033138622 7:138805373-138805395 CAACAAAGTGAGACCCTGTCTGG + Exonic
1033285517 7:140037671-140037693 CAACACAGGCAGGCTCTGCTGGG + Intronic
1033507942 7:142024392-142024414 CGACAGAGTGAGACCCTGTCTGG + Intronic
1033519762 7:142148807-142148829 CAAGACAGGGAGACTTTGATGGG + Intronic
1033541146 7:142357247-142357269 CGACAGAGTGAGACTCTGTCTGG - Intergenic
1033800200 7:144892243-144892265 CATCTGTGGGAGACTCTGCTTGG + Intergenic
1034086748 7:148328954-148328976 CGACAGAGCAAGACTCTGTCTGG + Intronic
1034105831 7:148488984-148489006 CAACAGAGAGAGACCCTGTCTGG - Intergenic
1034333731 7:150306659-150306681 CAACACAGCGAGACCCGGTTTGG + Intronic
1034482529 7:151333595-151333617 CAACAGAGTGAGACCTTGTCCGG + Intergenic
1034520570 7:151616214-151616236 CACCAGAGAGAGGCTCTGCTTGG + Intronic
1035005983 7:155661425-155661447 CCACAGAGCAAGACTCTGTCTGG - Intronic
1035772412 8:2158389-2158411 CAACAGAGCGAGAATCTGTCAGG - Intronic
1035795853 8:2355778-2355800 GCACAGAGGGAGACTCCGTGTGG + Intergenic
1035795875 8:2355857-2355879 GCACAGAGGGGGACTCTGTGTGG + Intergenic
1036404884 8:8445906-8445928 CGACAGAGTGAGACCCTGTCTGG + Intergenic
1037174645 8:15932598-15932620 CAACAAAGTGAGACTCTGTCTGG - Intergenic
1037317119 8:17609453-17609475 CGACAGAGCGAGACTCTGTCTGG + Intronic
1037536247 8:19827309-19827331 CCTCAGAGGGAGACTCGTTTGGG - Intronic
1037847322 8:22295057-22295079 CAACAGAGCGAGACTTCGTCTGG + Intronic
1037856750 8:22376856-22376878 CAACAGAGTGAGACAATGTCTGG + Intronic
1037942236 8:22960336-22960358 CAACAGAGCAAGACTCTGTCAGG - Intronic
1038095105 8:24300434-24300456 CGACAGAGCGAGACTCTGTCTGG - Intronic
1038136288 8:24789928-24789950 CAACAGAGTGAGACTCTGACTGG - Intergenic
1038281216 8:26166806-26166828 TAACAGAGTGAGACCCTGTCTGG + Intergenic
1038883929 8:31641829-31641851 CATCACAGGCAGACTCTGCTTGG - Intronic
1038989942 8:32857225-32857247 AAACAGAGGTAGACACAGTTAGG + Intergenic
1039231533 8:35454104-35454126 CAAAAGAGGGAAAGTCTGTCAGG - Intronic
1039372789 8:37003519-37003541 CAATGCAGGGAGACTGTGTTGGG - Intergenic
1039991909 8:42495767-42495789 CAACAGAACAAGACTCTGTCTGG - Intronic
1041075713 8:54167751-54167773 CAACAGAGCTAGACTCTCTCTGG + Intergenic
1041174181 8:55177054-55177076 TAACAGAGCAAGACTCTGTCTGG - Intronic
1042332876 8:67599505-67599527 CAAGAGAGGGAGTATCTATTAGG - Intronic
1042557393 8:70044803-70044825 CAACAGAGCCAGACTCCGTCTGG - Intergenic
1042562594 8:70084209-70084231 AGACAGAGTGAGACTCTGTCTGG - Intergenic
1042945101 8:74146436-74146458 CAACACAGGGCGACTCTGATGGG - Intergenic
1043110567 8:76175087-76175109 CAACAGAGCGAGACTCTTTCTGG - Intergenic
1043413453 8:80024207-80024229 CAACAGAGCAAGACCCTGTCTGG + Intronic
1043653832 8:82635671-82635693 TGACAGAGGGAGACTCTGTCTGG + Intergenic
1043673916 8:82925369-82925391 CGACAGAGAGAGACTCAGTCTGG - Intergenic
1044111428 8:88280055-88280077 CTACAGAGGGAGACTCCGCTTGG - Intronic
1044241062 8:89889041-89889063 CAACAAAGTGAGACCCTGTGTGG + Intergenic
1044434921 8:92150806-92150828 CAACAGAGTAAGACTCTGTCTGG + Intergenic
1044778622 8:95720840-95720862 CAACAGAGTGAGACTCTGCCAGG - Intergenic
1045516966 8:102868243-102868265 AAACAGAGCGAGAGTCTTTTAGG - Intronic
1045764027 8:105646029-105646051 CAACAGAGTGAGACTCCATCTGG + Intronic
1046335547 8:112781728-112781750 AAAGACAGAGAGACTCTGTTGGG + Intronic
1047281048 8:123446011-123446033 TGACAGAGTGAGACTCTGTCTGG - Intronic
1047523888 8:125616163-125616185 CAACAGAGTGAGACTCTGTCTGG + Intergenic
1047575521 8:126149910-126149932 GCACAGAGGGAGAATCTGGTGGG - Intergenic
1048337487 8:133513877-133513899 TAACAGAGCAAGACTCTGTCTGG + Intronic
1049824243 8:144657438-144657460 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1049994528 9:1022196-1022218 CAACAGAGCAAGACTCCATTTGG - Intergenic
1050145316 9:2560814-2560836 AAAGAGAGAAAGACTCTGTTTGG + Intergenic
1050601851 9:7260894-7260916 CAACAGAGGAAGACCCTCTTTGG - Intergenic
1050724768 9:8636255-8636277 GAACAGAGGTAGATTCTGATTGG + Intronic
1051306836 9:15718617-15718639 CAGCACAGAGAGACTCTGTTTGG + Intronic
1051319560 9:15887126-15887148 CAAAAGAGGGTAACTCTGTGAGG + Intronic
1051332236 9:16034500-16034522 CAACTGCAGGAGACACTGTTGGG + Intronic
1051650941 9:19323408-19323430 CGACAGAGCTAGACTCTGTCTGG + Intronic
1051936529 9:22448126-22448148 CAACAGAGTGAGATCCTGTCTGG - Intronic
1052859235 9:33426741-33426763 TAAGAGCGGGAGACTATGTTGGG + Intergenic
1053028125 9:34748523-34748545 CAGCATAGAGAGACTCTGTTTGG + Intergenic
1054786746 9:69217520-69217542 CAACCTAGTGAGACCCTGTTGGG + Intronic
1054924397 9:70574959-70574981 TGACAGAGTGAGACCCTGTTGGG - Intronic
1055073747 9:72193471-72193493 GAACAGAGAGAGAGACTGTTTGG - Intronic
1055191232 9:73527409-73527431 CAACAGAGTGAGACCCTGTCTGG - Intergenic
1055214398 9:73840820-73840842 CGACAGAACGAGACTCTGTCTGG + Intergenic
1056165018 9:83932604-83932626 CAACAGAAGGAGACTCTGTCTGG + Intergenic
1056256996 9:84809860-84809882 CAACAGAGCAATACTCTGTCTGG + Intronic
1056394607 9:86170094-86170116 CGACAGAGTGAGACTCTGCCTGG - Intergenic
1056468754 9:86884946-86884968 CAACAGAGTGAAACTCCATTAGG - Intergenic
1056537393 9:87541527-87541549 CAACAGAGCAAGACTCTGTCTGG + Intronic
1056637224 9:88341343-88341365 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1056987991 9:91382341-91382363 CAACAGAGCGAGACTCCGTCTGG + Intergenic
1057308510 9:93926575-93926597 CAACAGAGCAAGACCCTGTCTGG + Intergenic
1057427223 9:94962241-94962263 CAACTGAGGATGACTCTCTTCGG - Intronic
1057432810 9:95010350-95010372 CAACAGATGGTGACTGTGGTAGG + Intronic
1057523083 9:95775550-95775572 CAGCAGAGGAAGACAGTGTTGGG + Intergenic
1057620465 9:96630111-96630133 CCACAGAGTGAGACTCTATCGGG + Intergenic
1057692739 9:97300710-97300732 CAGCAGAGAGGGACGCTGTTGGG - Intergenic
1058458057 9:105156530-105156552 CAACAGAGTGAGACTCCATCTGG + Intergenic
1058759979 9:108121056-108121078 CAACAGAGTGAGACCCTGTCTGG + Intergenic
1058817528 9:108698894-108698916 CAACAGAGCAAGACCCAGTTAGG + Intergenic
1058891681 9:109366456-109366478 CAACAGAGCCAGACCCTGTCTGG - Intergenic
1059079612 9:111234183-111234205 CAACAGAGTGAGACCCTATCAGG + Intergenic
1059250487 9:112883636-112883658 GAAGACAGGGAGATTCTGTTGGG + Intronic
1059262112 9:112987733-112987755 TAACAGAGCAAGACTCTGTCTGG - Intergenic
1060470503 9:123944107-123944129 CAACAGAGCAAGACTGTGTCAGG + Intergenic
1060648282 9:125301466-125301488 CAACAAAGCAAGACTCTGTCTGG - Intronic
1060775431 9:126370400-126370422 CAACAGAACGAGACTCTGTCTGG - Intronic
1061301505 9:129708054-129708076 CAACAGAGCGAGACTCCAGTAGG - Intronic
1061334568 9:129923556-129923578 TGACAGAGCGAGACTCTGTCTGG + Intronic
1061556414 9:131372736-131372758 CGACAGAGCGAGACTCCGTCTGG - Intergenic
1061568922 9:131463959-131463981 CAACAGAGCGAGACTCCATCTGG - Intronic
1062593490 9:137286419-137286441 CAACCGAGTGAAACTCTGTCTGG - Intergenic
1062719476 9:138029628-138029650 CGACAGAGCGAGACCCTGTCTGG - Intronic
1185713632 X:2324035-2324057 TAACAGATGGAGACCCTGTCTGG + Intronic
1185767703 X:2739066-2739088 CAACATAGTGAGACCCTGTCTGG - Intronic
1186829384 X:13375707-13375729 CAACAGAGCGGGACCCTGTCTGG - Intergenic
1187014289 X:15310161-15310183 TAAGAGTGAGAGACTCTGTTGGG - Intronic
1187134528 X:16534322-16534344 CAACAGAGCGAGACTCCGTCTGG - Intergenic
1187315246 X:18186945-18186967 CAACAGAGCAAGACCCTGTCTGG + Intronic
1187390219 X:18881388-18881410 CGACAGAGTGAGACTCTGTCTGG + Intergenic
1187618218 X:21021191-21021213 AGAGAGAGAGAGACTCTGTTTGG + Intergenic
1187717128 X:22113967-22113989 CAATAGAGTGAGACTCTGTCTGG - Intronic
1188721412 X:33527955-33527977 ACACAGAGAGAGACTCTGTCTGG - Intergenic
1188846179 X:35075780-35075802 GAACAGAGAGAGACTCGGTTTGG - Intergenic
1188846191 X:35075852-35075874 ACAGAGAGAGAGACTCTGTTTGG - Intergenic
1189365553 X:40385196-40385218 AAACAGTGGGAGACTCTTTCTGG + Intergenic
1189464782 X:41270088-41270110 CGACAGAGTGAGACCCTGTCCGG - Intergenic
1189504309 X:41595573-41595595 TGACAGAATGAGACTCTGTTTGG + Intronic
1189828394 X:44944330-44944352 CAACAGAGTGAAACTCTGTTAGG + Intronic
1190341651 X:49301609-49301631 CAACAGAGTGAGACTCTGTCTGG - Intergenic
1190642521 X:52494667-52494689 CAACAGAGTGACACTCTGTCTGG + Intergenic
1190645152 X:52518200-52518222 CAACAGAGTGACACTCTGTCTGG - Intronic
1190890587 X:54563764-54563786 CAACAGAGTGAGACTGTCTCAGG + Intergenic
1190911768 X:54777610-54777632 AGAGAGAGAGAGACTCTGTTTGG + Intronic
1192302334 X:69918174-69918196 TGACAGAGGAAGACTCTGTCTGG - Intronic
1192331176 X:70176487-70176509 CGACACAGTGAGACTCTGTCTGG + Intergenic
1192467872 X:71370364-71370386 TGACAGAGAGAGACTCTGTCAGG - Intronic
1192725831 X:73751616-73751638 ACAGAGAGTGAGACTCTGTTTGG - Intergenic
1193092685 X:77511092-77511114 AGACAGAGAGAGATTCTGTTTGG + Intronic
1194715989 X:97287283-97287305 CAACAGAGTGAAACTCCGTCGGG + Intronic
1195199468 X:102533496-102533518 ACAGAGAGGGAGACTCGGTTTGG + Intergenic
1195511167 X:105716978-105717000 GAACATAGGGAGACCCTGTGTGG + Intronic
1195865809 X:109431677-109431699 CGACAGAGCTAGACTCTGTCTGG + Intronic
1196381117 X:115090916-115090938 CAACAGACTAAGACTCTATTTGG - Intergenic
1197731229 X:129812101-129812123 CAACAGAATGAGACTCTGTCTGG - Intronic
1197930282 X:131687698-131687720 CAACAGAGCGAGACTCCATCCGG - Intergenic
1198026286 X:132710869-132710891 CAAATGAGAAAGACTCTGTTGGG - Intronic
1198248155 X:134851514-134851536 CAACAGAGTAAGACTCTGTCTGG + Intronic
1198258160 X:134943219-134943241 CGACAGAGCGAGACTCCGTCTGG + Intergenic
1198375174 X:136031637-136031659 CAACAGAGCGAGACTCTGTCTGG + Intronic
1198990997 X:142514857-142514879 CCCCAGTGGGAGACTCTGTGTGG + Intergenic
1199148411 X:144398161-144398183 AAAGGGAGAGAGACTCTGTTTGG + Intergenic
1199295928 X:146158497-146158519 CAACAGAGCGAGACTCCATCTGG + Intergenic
1199304041 X:146245813-146245835 GCAGAGAGAGAGACTCTGTTTGG + Intergenic
1199441088 X:147868006-147868028 ACAGAGAGAGAGACTCTGTTTGG + Intergenic
1201290649 Y:12419019-12419041 CAACAAAGTGAGACTCTCTAGGG + Intergenic
1201342207 Y:12946923-12946945 CAACAGAGTGAGACTCCATCTGG - Intergenic
1201564818 Y:15354866-15354888 CAATAGAGCGAGACTCTGCCCGG + Intergenic