ID: 1141304134

View in Genome Browser
Species Human (GRCh38)
Location 16:82845167-82845189
Sequence TCACTGCTGTAGACAGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141304130_1141304134 2 Left 1141304130 16:82845142-82845164 CCAATATATTAAGGAATCCTTGA 0: 1
1: 0
2: 1
3: 13
4: 160
Right 1141304134 16:82845167-82845189 TCACTGCTGTAGACAGCCAGGGG 0: 1
1: 0
2: 0
3: 12
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141304134 Original CRISPR TCACTGCTGTAGACAGCCAG GGG Intronic
900586621 1:3435704-3435726 TCACCGCTGGGGACAGCCTGAGG - Exonic
902863002 1:19259298-19259320 TCTCTCCTGGAGACAGCAAGAGG + Exonic
903302954 1:22391972-22391994 TCACTGGTGTAGAAGGCCACAGG - Intergenic
906685664 1:47761534-47761556 TTACTGGTTTAGACAGCCAGCGG + Exonic
906842454 1:49154127-49154149 TTTCTGCTGTAGAATGCCAGAGG + Intronic
908340055 1:63168916-63168938 TCACTGCTGTGCACACACAGGGG - Intergenic
910290609 1:85596843-85596865 GCATTGCTGCAGATAGCCAGGGG + Intergenic
910507790 1:87969797-87969819 TCAGGGCTGTGGACAGCAAGGGG + Intergenic
910929943 1:92433354-92433376 TCACAGCTGAAGTCTGCCAGAGG - Intergenic
912522090 1:110252488-110252510 TCTGTGCTCAAGACAGCCAGTGG - Intronic
917898993 1:179522995-179523017 TTGCTGCTGTAAACACCCAGAGG + Intronic
924526967 1:244861874-244861896 TCGCTGCTGAAGAAAGCTAGTGG + Intronic
1062835034 10:629737-629759 TCACTGCTGGGCACAGCCTGAGG + Intronic
1064265075 10:13819452-13819474 TGAGTGCTGTAGAAATCCAGAGG - Intronic
1067186845 10:44036517-44036539 ACCCTGCTGTGAACAGCCAGTGG - Intergenic
1074710460 10:116172926-116172948 AGACTGCTGCAGACACCCAGAGG + Intronic
1074860930 10:117509906-117509928 TCACTGCTGCAGAAACCCACAGG - Intergenic
1076838986 10:133036106-133036128 TCCCTGCTGTAGGAAGCGAGGGG + Intergenic
1077823805 11:5781750-5781772 TTTCTGTTGTAAACAGCCAGAGG - Intronic
1080109471 11:28549177-28549199 TCAATGCTGTGGACAGTGAGTGG + Intergenic
1081298833 11:41425442-41425464 TCACTTCTTTACTCAGCCAGAGG - Intronic
1083689062 11:64395750-64395772 CCACTGCGGTGGGCAGCCAGAGG + Intergenic
1084009090 11:66337860-66337882 ACCCTGCTGTTCACAGCCAGGGG - Intronic
1084761207 11:71272300-71272322 GCAGTGCTGCAGGCAGCCAGAGG + Intergenic
1085313686 11:75530934-75530956 TCACTGAGGTAGACAGACTGGGG + Intergenic
1085515399 11:77108550-77108572 TTTCTACTGTAGACAGCGAGAGG + Intronic
1086045068 11:82523275-82523297 TCACTGCTGTAGGCAGCACAGGG - Intergenic
1089781267 11:120874810-120874832 TGAATGCTGTGGACAGCCAAGGG + Intronic
1100690320 12:97032448-97032470 ACACTGCAGTAGACTGGCAGGGG + Intergenic
1100867808 12:98875877-98875899 ACACTGCTGTAACAAGCCAGGGG + Intronic
1102137659 12:110588594-110588616 TTAATGCTGGAGACAGCAAGGGG + Intergenic
1104711531 12:130990262-130990284 TCACTCCTGCAGCCAGCAAGGGG + Intronic
1106922274 13:34576344-34576366 TCACTGCTAGAGAGATCCAGGGG + Intergenic
1110702669 13:78567158-78567180 TCACTGGTCTAGAGAGGCAGTGG + Intergenic
1113425887 13:110208119-110208141 CCATTGCTGTAGCCAGCCTGTGG - Intronic
1113440871 13:110327039-110327061 TGTCTGCTGGAGACAGGCAGAGG - Intronic
1118301237 14:64618348-64618370 AAACTTCTGTAGACAGCCAGAGG + Intergenic
1119656946 14:76423982-76424004 CCTCTGCTGAAGACAGCCAGGGG - Intronic
1120012674 14:79435134-79435156 TCACTTCAGTGGACTGCCAGGGG - Intronic
1122734845 14:103832162-103832184 TCAATGATGTAGACAGCAACTGG - Intronic
1202919077 14_KI270723v1_random:14133-14155 TCACACCTGTAGTCAGCCAAAGG - Intergenic
1202925553 14_KI270724v1_random:20862-20884 TCACACCTGTAGTCAGCCAAAGG + Intergenic
1128107813 15:65057342-65057364 TCAGTGCTGGAGAAATCCAGTGG + Intronic
1128305275 15:66594316-66594338 TCACTGGTGCTCACAGCCAGGGG + Intronic
1128547036 15:68575299-68575321 TCACTGCAGGAGGCATCCAGAGG - Intergenic
1133150360 16:3823892-3823914 TCACTGCTGAAGAGAGCTAGGGG - Intronic
1141304134 16:82845167-82845189 TCACTGCTGTAGACAGCCAGGGG + Intronic
1141621472 16:85238682-85238704 TCCCTGCTGTAGCCAGCCCTTGG + Intergenic
1143863982 17:9910824-9910846 TTACTGATCTAGGCAGCCAGAGG + Intronic
1145804567 17:27717320-27717342 TCATACCTGAAGACAGCCAGTGG + Intergenic
1152658889 17:81533319-81533341 TCACTGCTTGAGCCAGCCTGTGG - Intronic
1153421945 18:4916787-4916809 TCACTGCTGTATGCAGCCTAGGG - Intergenic
1154303945 18:13217622-13217644 TCACGGCTGGAGACAGACGGCGG + Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1160151976 18:76402218-76402240 TCACTGCTGAACTCAGCAAGAGG - Intronic
1161590587 19:5127546-5127568 TCACTGCTGTCTCCAGACAGGGG + Intronic
1162747837 19:12809017-12809039 TAACTGGTGTAGACAGACAAGGG + Intronic
1164691283 19:30212652-30212674 TCACTGCTGAGGACACCGAGAGG + Intergenic
1165863925 19:38924490-38924512 TCCATGATGTAGACAGCCCGAGG + Intronic
1168304605 19:55428784-55428806 TCCCTGGTGAGGACAGCCAGAGG - Exonic
925417648 2:3682403-3682425 TCACTGATCAAAACAGCCAGTGG - Intronic
925774935 2:7325729-7325751 TCAGTGCTGTGGACAGCTGGAGG - Intergenic
927935978 2:27077018-27077040 TGGCTGCTGGAGACAGTCAGAGG - Intergenic
930413858 2:51064200-51064222 TCACTGCTGTACACTGCTAAGGG + Intergenic
932772335 2:74507536-74507558 TTACTGCTGTGGTCGGCCAGCGG - Intronic
939877322 2:147592560-147592582 TCACAGCTGTGGGCAGTCAGGGG + Intergenic
941240233 2:163027203-163027225 TCACTCCTGAAGCCAGCGAGAGG + Intergenic
943438853 2:187901156-187901178 TCACAGCTGAATACATCCAGAGG + Intergenic
1170567519 20:17615420-17615442 TCACAGCTGAAGGCAGGCAGGGG - Exonic
1174400534 20:50273568-50273590 TCCCTGCTTCACACAGCCAGAGG - Intergenic
1176880592 21:14187688-14187710 CCATTGCTGTAGAGAGACAGAGG - Intronic
1178259193 21:31083206-31083228 TCACTCCTGAAGTCAGCGAGAGG - Intergenic
1180288910 22:10778788-10778810 ACGCTGCTACAGACAGCCAGTGG + Intergenic
1182392124 22:30007138-30007160 TGCCCGCTGTGGACAGCCAGAGG + Exonic
1184354897 22:43973282-43973304 TCACTGCGGGAGACGGACAGAGG + Exonic
1184834667 22:47014172-47014194 CCACCGCTGCAGAAAGCCAGGGG - Intronic
1185079794 22:48703406-48703428 TCCTTTCCGTAGACAGCCAGTGG + Intronic
949935057 3:9110078-9110100 TGGCTGCTGTACAGAGCCAGGGG + Intronic
950824920 3:15808390-15808412 TCTCTGAGGTAGAAAGCCAGGGG - Intronic
954756172 3:52841383-52841405 TAACTGCTGAAGACAAACAGCGG + Intronic
956034859 3:65079746-65079768 TCCCTGCTGTTGCCAGCCACAGG + Intergenic
956107351 3:65833907-65833929 TCACTGCTACAGAAAGCCACTGG - Intronic
956501522 3:69891596-69891618 TCACTGCTGTAGAAACCTGGAGG + Intronic
961486976 3:127223480-127223502 TCACTGCTCTGGTCAGCAAGGGG - Intergenic
963290235 3:143479776-143479798 TCACTGCTGAGGACAGCCTGAGG - Intronic
968065104 3:195754139-195754161 TCAAGGGTGTAGACAGCCAAAGG - Intronic
969102052 4:4776732-4776754 TCACTGGTGTACACAGACAGGGG - Intergenic
970303879 4:14710576-14710598 TCACTTCTGTTTACAGCCAATGG + Intergenic
970380798 4:15505547-15505569 TCAGTGGAGTTGACAGCCAGTGG + Intronic
970441226 4:16082850-16082872 TCACGGCTGTAGAAAGTCAGAGG - Intronic
973927909 4:55758647-55758669 GCTCTGCTGTAGACAGGCAGTGG - Intergenic
975662523 4:76701751-76701773 TAACTGCTGAAAATAGCCAGTGG - Intronic
982354691 4:154453261-154453283 ACACTGCTGGAGACAGAAAGGGG + Intronic
983690241 4:170460536-170460558 TCATTGCTATAGACAGCTAATGG + Intergenic
985184227 4:187298005-187298027 TGACTGCTGCAGTGAGCCAGTGG + Intergenic
986741773 5:10711172-10711194 GCTCTGCTGTACACAGCAAGGGG + Intronic
988738390 5:34045219-34045241 TCAATGCGGTAGAAAGTCAGAGG - Intronic
989301863 5:39904142-39904164 TCAGTGCTGTAGACAGAAAGAGG - Intergenic
990347972 5:54887691-54887713 ACACTGCTGTGGACAGCTGGAGG - Intergenic
994018111 5:94992098-94992120 TCACTGTAGCATACAGCCAGAGG + Intronic
995831872 5:116362585-116362607 TCACTCCTGTAGATATCCCGAGG - Intronic
997011698 5:129885852-129885874 TCACTGCTGTAGCCAGGGATTGG + Intergenic
998151804 5:139761826-139761848 TGAGGGCTGCAGACAGCCAGGGG - Intergenic
999619690 5:153460146-153460168 ACACTGGTGTAGAGAGCCAGTGG - Intergenic
1000059991 5:157646207-157646229 TCACTGCTCTAGAAAAGCAGTGG - Intronic
1000784613 5:165528414-165528436 TCACTGCTCTATGCAGCCTGAGG + Intergenic
1001214311 5:169841106-169841128 TCACTGCTGAAGACAGAGAAGGG + Intronic
1002044268 5:176533181-176533203 TCCCTGCTGGAACCAGCCAGAGG - Intronic
1006715564 6:36117300-36117322 GCACTGCTATAGAGAGCCAGAGG - Intergenic
1012437719 6:99232528-99232550 TGACTTCTGTAGATGGCCAGAGG - Intergenic
1012460887 6:99458711-99458733 ACAGTGCTATAGAAAGCCAGAGG + Intronic
1012476157 6:99616526-99616548 ACACTGCTTTAGTCAGCCGGTGG + Intergenic
1017041640 6:150313124-150313146 TAAATGCTGTAGGCAGTCAGAGG + Intergenic
1017645069 6:156532781-156532803 GCGCTGCTGTAGACAATCAGAGG + Intergenic
1017663542 6:156696543-156696565 TCAATGCTATAAAGAGCCAGGGG - Intergenic
1018393819 6:163361746-163361768 TTACTGCTAAAGACAGCCAAGGG + Intergenic
1018629927 6:165813308-165813330 TCAGTTCTGTAGACTGGCAGAGG + Intronic
1018671798 6:166184437-166184459 TCACTGCTTTGGAAAGCCATTGG - Intergenic
1018996397 6:168713696-168713718 CCAATGGTGTGGACAGCCAGAGG - Intergenic
1022363477 7:29685450-29685472 TTCCTGCTGGAGACAGCGAGGGG - Intergenic
1026150561 7:67784814-67784836 ACACTGCGGAAGACAGGCAGAGG - Intergenic
1027636471 7:80681513-80681535 CCACAGCTGTAGAGAACCAGAGG - Intergenic
1029196616 7:98810047-98810069 TCACTGCTGTGGACAGCCGTGGG - Intergenic
1030016684 7:105229778-105229800 GCACTGCTGTGTTCAGCCAGAGG + Intronic
1034343818 7:150373639-150373661 ACAGTGCTGCTGACAGCCAGGGG - Intronic
1037304384 8:17490018-17490040 TCACTGCTGTTGACACACAAAGG + Intergenic
1039936222 8:42048537-42048559 TAACTGCTGGTGAAAGCCAGAGG + Exonic
1040015589 8:42696533-42696555 TCAGTGCTGTGCACACCCAGAGG - Intergenic
1040560386 8:48518421-48518443 TCCCTGCTTTGGAAAGCCAGTGG - Intergenic
1040728442 8:50411872-50411894 TCACAGTTGTAGTCAGCCTGTGG + Intronic
1040956732 8:52987590-52987612 TCTCCGCTGTAGGCAGGCAGTGG + Intergenic
1042506012 8:69561592-69561614 TCACTGCGTTAGACAAACAGTGG - Intronic
1044552256 8:93525345-93525367 TCACTGGTGTAGTAAGTCAGTGG + Intergenic
1045201544 8:99987613-99987635 TCTCTGCTTTGGACAGCCTGTGG - Exonic
1045261539 8:100579454-100579476 ACACAGTTTTAGACAGCCAGGGG - Intronic
1045797609 8:106064627-106064649 TCTCTGCTGTCAAAAGCCAGTGG - Intergenic
1045813050 8:106246441-106246463 TCACTGAAGTGGACTGCCAGTGG - Intergenic
1048379794 8:133855419-133855441 TCACTGCTGAAGACACCAAAGGG + Intergenic
1049531236 8:143156675-143156697 TCCCTGCTGGACACAGCCAAGGG - Intergenic
1051415609 9:16836866-16836888 TCAATGCTGTGGACAGCCCAAGG - Intronic
1054935419 9:70682556-70682578 TCACTGATGTGGACAGAGAGTGG + Intronic
1055508377 9:76970798-76970820 GCACTGCTGTTGACTGCCTGGGG - Intergenic
1056135533 9:83626278-83626300 TCTCTGGTTTAGACAGACAGTGG + Intronic
1057874654 9:98744499-98744521 TCAGTCCTGTAGACAGCCCAAGG - Intronic
1059234616 9:112751068-112751090 TCGCTGCTGGAGCCGGCCAGCGG - Exonic
1059920944 9:119159209-119159231 TGACTTCTGTAGACAGTAAGTGG - Intronic
1060529649 9:124340726-124340748 TCACTGCTGTGGACTGTCACCGG - Intronic
1062272981 9:135718240-135718262 TCACTGCAGTACACAGGAAGGGG - Intronic
1187204408 X:17168554-17168576 TCACTGTTGTAGGCAGTGAGAGG - Intergenic
1187313606 X:18170728-18170750 TCCCTGCTATGGACTGCCAGGGG - Intronic
1188182731 X:27075561-27075583 ACACTGCTGTCCACAGACAGAGG + Intergenic
1194942882 X:100033393-100033415 TCACATCTGTAGAATGCCAGGGG + Intergenic
1199803133 X:151270976-151270998 TGAGTGCTGTAGACAGAAAGTGG - Intergenic
1201500782 Y:14640487-14640509 GCACTGCTGGAGAAGGCCAGAGG - Intronic