ID: 1141305796

View in Genome Browser
Species Human (GRCh38)
Location 16:82862787-82862809
Sequence CAGATCATGCAGATGCAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 178}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141305796 Original CRISPR CAGATCATGCAGATGCAGTC GGG Intronic
901240408 1:7689760-7689782 GAGAGCATGCAGAAGGAGTCAGG - Intronic
902340946 1:15783364-15783386 CAGATCCTGGAGACCCAGTCTGG + Intronic
902760530 1:18577825-18577847 CAGATCATGCCACTGCAGTCCGG + Intergenic
903317716 1:22521647-22521669 CAGAACATGCAGGTGGAGTTTGG + Exonic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
904864272 1:33564481-33564503 AAGAACATGCAGATGCCCTCAGG - Intronic
906536782 1:46555133-46555155 CAGATCCAGCAGATGCACTGAGG - Intergenic
906778801 1:48553925-48553947 AAGTTAATGCAGATGCACTCAGG - Intronic
907394902 1:54182596-54182618 GAGATCATGCCGCTGCACTCTGG - Intronic
908538570 1:65101697-65101719 CAGATCATGCCACTGCAGCCTGG - Intergenic
910984403 1:92991698-92991720 CACACCATCCAGATGCAGCCAGG - Intergenic
912118055 1:106432272-106432294 AAGATCATGCCAATGCACTCCGG + Intergenic
913610962 1:120509490-120509512 CAGATGCTGCAGAAGCAGTTGGG - Intergenic
913983852 1:143547498-143547520 CAGATGCTGCAGAAGCAGTTGGG + Intergenic
914580227 1:149012749-149012771 CAGATGCTGCAGAAGCAGTTGGG + Exonic
916488592 1:165281025-165281047 CAGAACATGGAGAAGTAGTCTGG + Intronic
919425272 1:197422026-197422048 CATAGCAGGCAGAAGCAGTCTGG - Intronic
923181312 1:231522545-231522567 TTCATCATGCAGATGCACTCAGG + Intergenic
923326905 1:232888122-232888144 CACTTCATGCGGCTGCAGTCAGG - Intergenic
923331019 1:232924718-232924740 TTGCTCATGCAGACGCAGTCAGG - Intergenic
923465708 1:234246368-234246390 CAGATGCTGCAGCTGAAGTCTGG - Intronic
1066373762 10:34839019-34839041 AAGATCATGCCGCTGCACTCCGG + Intergenic
1066675845 10:37886079-37886101 CAGATCATCCAGAAGCAATAAGG + Intergenic
1068272248 10:54743513-54743535 GAGATCATGAAGATGCAAACAGG + Intronic
1069545081 10:69321806-69321828 CAATTTATGCAGATGCCGTCTGG - Intronic
1069545153 10:69322401-69322423 CAATTTATGCAGATGCCGTCTGG - Intronic
1070333277 10:75432749-75432771 CAGCTCCTACAGATGCAGTGAGG + Intronic
1072147571 10:92656104-92656126 GAGATCATGCCAATGCACTCTGG - Intergenic
1073870581 10:107859164-107859186 CAGGTCATGTGGAAGCAGTCTGG + Intergenic
1074281554 10:112056439-112056461 TTGAACATGCAGATGAAGTCAGG + Intergenic
1074693339 10:116026475-116026497 CAGGGAATGCAGATGGAGTCTGG + Intergenic
1075513886 10:123094241-123094263 GAGATCATGCAGCTACAGCCAGG + Intergenic
1079327343 11:19505553-19505575 CGGGTCATGCAGATGGAGTGGGG + Intronic
1081039305 11:38191505-38191527 CAGATGGTGCAGATGGAGTTAGG + Intergenic
1084331804 11:68434802-68434824 TAGATAATTCACATGCAGTCTGG + Intronic
1085505869 11:77058488-77058510 CAAATCTTGCACATGCAGCCTGG + Intergenic
1085599078 11:77838663-77838685 CAGATAATGCCACTGCAGTCTGG - Intronic
1087203814 11:95372936-95372958 AAGATCATGCCGCTGCACTCCGG + Intergenic
1087945737 11:104158367-104158389 CATATCTTTCAGATGCATTCTGG - Intronic
1088786781 11:113189399-113189421 GAGATCATGCCACTGCAGTCTGG + Intronic
1089607805 11:119651751-119651773 TAGATCATGGAGATGGAGTGGGG + Intronic
1092996470 12:13955856-13955878 AAGATCAAGAAGATGCAGCCTGG + Intronic
1094418580 12:30244926-30244948 AAGATCATGCAGTTGCAGGTAGG - Intergenic
1096133770 12:49182402-49182424 CAGATCATGCCACTGCAGCCTGG + Intergenic
1096375301 12:51104758-51104780 GAGATCATGCCGCTGCACTCCGG - Intronic
1096669984 12:53192836-53192858 CAGAGCATGCGAATGCAGTGGGG - Exonic
1097937615 12:65271250-65271272 CAGGTCAAGCAGAAGCATTCAGG - Intergenic
1100214471 12:92433505-92433527 CACGTCTTGCAAATGCAGTCAGG + Intergenic
1103905522 12:124325535-124325557 CTGATCATGCGGCTGCAGGCGGG - Exonic
1105604579 13:21916319-21916341 GAGATCATGCCACTGCAGTCTGG - Intergenic
1107630863 13:42341763-42341785 CAAATCATGGAGATGCATTTAGG + Intergenic
1108681094 13:52781058-52781080 AAGATGATGCAGATGCAGGCTGG + Intergenic
1110358560 13:74598358-74598380 AAGATCATGCAACTGCACTCCGG - Intergenic
1113246433 13:108401879-108401901 CTGTACTTGCAGATGCAGTCAGG - Intergenic
1115739049 14:36368075-36368097 GAAATCATGCAGAAGCAGTCTGG - Intergenic
1117473259 14:56068041-56068063 CAGATGATGAAGATGCAGACAGG - Intergenic
1118402754 14:65394792-65394814 AAGATCATGCCGCTGCACTCTGG - Intergenic
1119976488 14:79029893-79029915 GAGATCATGCCAATGCACTCAGG - Intronic
1123681550 15:22767878-22767900 CAGATCATGCAGCTGCCCCCTGG - Intergenic
1124333765 15:28842335-28842357 CAGATCATGCAGCTGCCCCCTGG - Intergenic
1124358079 15:29013326-29013348 GAGATCATGCCACTGCAGTCCGG - Intronic
1124930949 15:34118971-34118993 CAGATCATGCCACTGCACTCTGG - Intergenic
1125481553 15:40084608-40084630 CAGGTCACAGAGATGCAGTCTGG + Intergenic
1126865002 15:52926840-52926862 CCTTTCATGCAGTTGCAGTCAGG + Intergenic
1126963074 15:54020073-54020095 CAGGTCAGGAGGATGCAGTCTGG + Intronic
1128357729 15:66939910-66939932 CACAGCGTGAAGATGCAGTCTGG - Intergenic
1129528791 15:76243748-76243770 CAGATCATGCTGCTGCACTCTGG + Intronic
1132014877 15:98306667-98306689 AAGTTTATGCAGATGCAGTTGGG - Intergenic
1132132300 15:99293542-99293564 GAGATCATGCCGTTGCATTCCGG + Intronic
1135949030 16:26895648-26895670 AAGATCATGCTGATGCACTCCGG - Intergenic
1136750807 16:32634046-32634068 CAGATCATGCTATTGCACTCTGG + Intergenic
1138069544 16:53978948-53978970 GAGATCATGCCGCTGCACTCCGG + Intronic
1140765460 16:78152824-78152846 CAAAGCATGCAGATGCCGCCTGG + Intronic
1141305796 16:82862787-82862809 CAGATCATGCAGATGCAGTCGGG + Intronic
1141727047 16:85796552-85796574 TAGATCATGCAGAGGCATTTGGG - Intronic
1141735634 16:85850602-85850624 CAGATCATGCAGACGCACTATGG - Intergenic
1141781969 16:86168552-86168574 CAGATCATGCACAGACAGCCAGG - Intergenic
1142004944 16:87685250-87685272 CAGAGCCTGCAGCTGCAGCCTGG + Intronic
1142407542 16:89899203-89899225 CAGTTCAGGAAGATGCAGCCGGG + Intronic
1203052942 16_KI270728v1_random:893306-893328 CAGATCATGCTATTGCACTCTGG + Intergenic
1143675388 17:8428720-8428742 GAGATCATGCCACTGCAGTCTGG - Intronic
1143836659 17:9698452-9698474 GAGATCATTCTGATGCACTCAGG - Intronic
1143882616 17:10041111-10041133 AAGATCGTGCAGCTGCACTCCGG + Intronic
1147906463 17:43826365-43826387 CAGGTGATGCTGATGCAGCCGGG - Intronic
1148189624 17:45669429-45669451 CAGCTGATGCTCATGCAGTCTGG + Intergenic
1148774823 17:50089400-50089422 AAGAGCATGCACATGCTGTCTGG + Exonic
1152422037 17:80198681-80198703 CAGACGATGCAGATCCACTCTGG + Intronic
1152933842 17:83124607-83124629 CAGAGGATGCAGACGCCGTCAGG - Intergenic
1152933952 17:83125152-83125174 CAGAGGTTGCAGATGCCGTCAGG - Intergenic
1152933962 17:83125194-83125216 CAGAGGTTGCAGATGCCGTCAGG - Intergenic
1152933971 17:83125236-83125258 CAGAGGTTGCAGATGCCGTCAGG - Intergenic
1156676043 18:39528487-39528509 CTCCTCATGAAGATGCAGTCTGG + Intergenic
1160048479 18:75409226-75409248 CAGGTAGTGCAGATGCAGCCTGG + Intronic
1160947170 19:1649002-1649024 CAGTTCAGGCAGGTGCAGTGAGG - Intronic
1161027572 19:2043563-2043585 CAGATCATTGAGAAGCAGCCAGG - Exonic
1162704170 19:12542951-12542973 AAGATCATGCCGTTGCACTCTGG + Intronic
1166755227 19:45186654-45186676 GAGATCATGCAACTGCACTCCGG + Intronic
925093787 2:1177454-1177476 CACATCCTGCAGATGTACTCTGG + Intronic
929340681 2:40813201-40813223 CAGGTGATTCAGATGCAGCCGGG - Intergenic
930795061 2:55380662-55380684 GAGATCATGCTGCTGCACTCTGG - Intronic
931714491 2:65018460-65018482 CAGACCATGCAGCTGCAATGTGG - Intronic
932145022 2:69308738-69308760 GAGGTCATGCAGATTCTGTCTGG + Intergenic
933302370 2:80556562-80556584 CAGAGCTTGCAGATGCATTGGGG + Intronic
933421919 2:82059520-82059542 CAGATCATGCCACTGCAGACTGG - Intergenic
933624210 2:84580257-84580279 CAAATGATGCAGATGGAATCAGG + Intronic
936707098 2:115087878-115087900 CAAGTTATGCAGATGCTGTCAGG + Intronic
937438857 2:121900396-121900418 CAGAACATGCAGACCCAGTGAGG - Intergenic
937672994 2:124558651-124558673 CAGTTCAGGGAAATGCAGTCTGG - Intronic
940855798 2:158727813-158727835 CAGAGCTTCCAGATGGAGTCAGG - Intergenic
942823777 2:180148409-180148431 GAGATCGTGCCGCTGCAGTCCGG + Intergenic
942930644 2:181488605-181488627 CAGATCATGCCACTGCACTCTGG - Intronic
946276889 2:218638399-218638421 CACATCATGCAGGTGCACTGTGG + Exonic
946729731 2:222697629-222697651 CAGATCATGCCATTGCACTCCGG - Intronic
947059281 2:226144362-226144384 TAGATAATCCAGATTCAGTCAGG - Intergenic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
1170524611 20:17226202-17226224 CAGATCTTGGAGGTGCAGCCAGG + Intronic
1173075359 20:39813395-39813417 TGGCTCATGCAGATGCTGTCAGG - Intergenic
1173547258 20:43908312-43908334 CAGATCAGAAAGATGCAGTGAGG + Intergenic
1175354136 20:58349222-58349244 CAGAGCAACCAAATGCAGTCAGG + Intronic
1178809610 21:35869350-35869372 CAGAACCTGCAGAGGCAGTAGGG - Intronic
1178959423 21:37051024-37051046 GAGATCATGCAATTGCACTCTGG + Intergenic
1181838942 22:25637853-25637875 CTGATGGTGCAGATGAAGTCTGG + Intronic
1182505104 22:30776508-30776530 CAGTTCATTCAGTTGCATTCTGG + Intronic
1184364093 22:44038324-44038346 CAGTTCAAGCCCATGCAGTCTGG - Intronic
953348308 3:42194793-42194815 CAGCTCACGCAGCTGCAGGCAGG - Exonic
954124273 3:48519500-48519522 CAGCCCATGCAGATGCAGTCTGG + Exonic
954429705 3:50463999-50464021 CAGATCATGCAGAGGGAGCATGG + Intronic
955242872 3:57194915-57194937 CAAATCAAGCTAATGCAGTCAGG - Intergenic
962274256 3:134000269-134000291 GAGCACATGCAGATGCAGTCAGG + Intronic
962444397 3:135451824-135451846 CAGATCATGCTGATGGTGCCTGG - Intergenic
965746519 3:171932156-171932178 GAGGTCCTGCAGATGCAGGCGGG - Intronic
966058502 3:175727117-175727139 CAGATCATGCAAAGGCTCTCGGG - Intronic
967398478 3:189033328-189033350 AAGATCATACAGCTGCACTCCGG - Intronic
967948886 3:194825074-194825096 CAAATGATGCAGATGCTGTGGGG - Intergenic
969992879 4:11282495-11282517 CAGGTCATGCAAGTGTAGTCTGG + Intergenic
971870730 4:32235116-32235138 AAAATCATGCACATGCACTCAGG - Intergenic
972063505 4:34910485-34910507 CAGATCATGCTGATGCAAGAGGG - Intergenic
975809317 4:78149851-78149873 CAGATCGTGCAGATGATGACAGG - Intronic
976448128 4:85155310-85155332 CAGTTCATGCAAATCCAGACAGG - Intergenic
980421526 4:132566528-132566550 CAGATACTGCAGCTGCAGTATGG - Intergenic
981710814 4:147707587-147707609 GAGATCACGCCGCTGCAGTCCGG - Intergenic
982901918 4:161016691-161016713 CATATCATGCTTCTGCAGTCTGG - Intergenic
984517349 4:180757152-180757174 AAGATCATGCTGCTGCACTCCGG + Intergenic
988845478 5:35123213-35123235 AAGATTATGCTGATGCTGTCAGG - Intronic
991282594 5:64933154-64933176 CTGATACTGCAGATCCAGTCTGG + Intronic
992218356 5:74547469-74547491 CAGACCATGCACTTGCAGCCAGG + Intergenic
992266412 5:75022621-75022643 CAGATGATTCTGATGCAGACTGG + Intergenic
993851033 5:93009329-93009351 CAGATTATGCAGGTACAGTGTGG + Intergenic
996569582 5:124917854-124917876 GAGATCATGCCGCTGCACTCCGG + Intergenic
1001927730 5:175650907-175650929 GAGATCATGCCACTGCAGTCTGG - Intergenic
1006145996 6:31960083-31960105 CACACCATGCAGAGGCAGCCAGG - Exonic
1019506582 7:1394484-1394506 CCCATCATGCAGCTGCAGCCAGG - Intergenic
1022141772 7:27499187-27499209 GAGATCATGCTACTGCAGTCTGG + Intergenic
1022613147 7:31897216-31897238 CTGCTGATGCAGGTGCAGTCAGG + Intronic
1024505125 7:50156334-50156356 CAGATCAAGCAGAAACAGTCAGG - Intronic
1025716797 7:63964795-63964817 CCGTCAATGCAGATGCAGTCAGG + Intergenic
1030270967 7:107667833-107667855 CAAATGGTGCAGATGCAGACGGG + Intronic
1031620376 7:123927940-123927962 CAATTCCTGCTGATGCAGTCTGG - Intronic
1036219195 8:6907046-6907068 GAGATCATGCGGCTGCACTCTGG - Intergenic
1036536073 8:9653936-9653958 AAAACCATGCAGATGCAGACAGG - Intronic
1039314846 8:36359838-36359860 CAGATCATGCCACTGCACTCCGG + Intergenic
1041701969 8:60800464-60800486 CAGATGATGCAGATGCTGCTGGG + Exonic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1045446075 8:102265348-102265370 CAAATCATTCAAATGAAGTCAGG + Intronic
1045516460 8:102864345-102864367 CGGGTCATGCAGGTGCAGACTGG + Exonic
1046332810 8:112743026-112743048 CAAATCATGCAGCTGGTGTCTGG + Intronic
1046979592 8:120322350-120322372 CACATCCTGCACATGCACTCTGG + Intronic
1047205115 8:122796955-122796977 CCCATCAGGCAGATGCAGGCCGG + Intronic
1049783516 8:144439696-144439718 CAGCTCTTGCAGAGGCAGCCGGG + Intronic
1049980632 9:901061-901083 GAGATCATGCTGCTGCACTCTGG - Intronic
1051214549 9:14782079-14782101 CAGGTAATTCTGATGCAGTCAGG - Intronic
1053367573 9:37534410-37534432 CAGATCGTGCCACTGCAGTCCGG + Intronic
1056104788 9:83336475-83336497 CAGAGCAGGCAGCTCCAGTCAGG - Intronic
1056572184 9:87825531-87825553 CAGTTCCTTCAGGTGCAGTCCGG + Intergenic
1058840633 9:108904638-108904660 GAGATCATGCAGGTGGAGCCAGG - Intronic
1061108540 9:128551221-128551243 CAGATCATTCCTGTGCAGTCAGG - Intergenic
1061397662 9:130352346-130352368 CAGAGAGTGCAGATGCAGGCTGG - Intronic
1185597104 X:1313940-1313962 CAGATCATGCGATTGCACTCCGG + Intergenic
1186362115 X:8853032-8853054 CAGATCATGCACATCTAGTATGG + Intergenic
1186965164 X:14779112-14779134 CTGATCATGCAGAGGAACTCTGG - Intergenic
1189367863 X:40403040-40403062 GAGACCATGCAGATGAAGTGCGG + Intergenic
1189537184 X:41947494-41947516 CATTTAATGCAGATGCTGTCTGG + Intergenic
1192583978 X:72306140-72306162 CAGAGCGTCCAGATGCGGTCCGG + Intronic
1192926359 X:75758972-75758994 CAGCTCCTTCAGATGCATTCAGG + Intergenic
1194244598 X:91494989-91495011 CATATCAGGCACATGCAGCCAGG + Intergenic
1194377242 X:93151536-93151558 CAGATCATGCTGATGCAAGATGG + Intergenic
1197183392 X:123561648-123561670 GAGATCATGCACCTGCAGGCCGG + Intergenic
1199570550 X:149263100-149263122 CAGATTAAGCAGGTGAAGTCAGG - Intergenic
1200563575 Y:4736302-4736324 CATATCAGGCACATGCAGCCAGG + Intergenic