ID: 1141308920

View in Genome Browser
Species Human (GRCh38)
Location 16:82894344-82894366
Sequence TGCCTTAACAATAATAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141308914_1141308920 10 Left 1141308914 16:82894311-82894333 CCAAGGCAACTGACATTTTACTG 0: 1
1: 0
2: 0
3: 20
4: 275
Right 1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
1141308912_1141308920 12 Left 1141308912 16:82894309-82894331 CCCCAAGGCAACTGACATTTTAC No data
Right 1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89
1141308913_1141308920 11 Left 1141308913 16:82894310-82894332 CCCAAGGCAACTGACATTTTACT 0: 1
1: 0
2: 1
3: 37
4: 338
Right 1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141308920 Original CRISPR TGCCTTAACAATAATAGGGC AGG Intronic
903467863 1:23564811-23564833 TGCTTTAAGAATAATCTGGCCGG - Intergenic
905134013 1:35784305-35784327 TGTCTAAAAAAAAATAGGGCCGG + Intergenic
906713989 1:47953441-47953463 TGCTTTTAAAATCATAGGGCTGG + Intronic
909277807 1:73710233-73710255 TACCTTTACATTACTAGGGCAGG - Intergenic
910376281 1:86575471-86575493 TGCGTAAACAATCATTGGGCTGG - Exonic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
914868772 1:151456655-151456677 AGACTTAATAATAATAGGCCGGG + Intronic
919664879 1:200282498-200282520 TGCCCTGAGAATAATAGGCCAGG + Intergenic
1064106562 10:12505392-12505414 TGCCTTTAAAATTATAGTGCAGG - Intronic
1064275360 10:13900598-13900620 TGTATTAATAAAAATAGGGCCGG + Intronic
1064691940 10:17927347-17927369 TGCCTTAATTATATTGGGGCAGG - Intergenic
1068372838 10:56141067-56141089 TGATTTACCAATAATGGGGCTGG - Intergenic
1069553875 10:69383879-69383901 GGCCTGAACAATCCTAGGGCTGG + Intronic
1071903460 10:90145960-90145982 TCCCTTAATATTTATAGGGCAGG + Intergenic
1077064118 11:631655-631677 TGTCTTAAAAAAAATATGGCTGG - Intergenic
1084058088 11:66650566-66650588 TGTCTTAATAATAATAGGCCAGG + Intronic
1086790128 11:91026747-91026769 TCTCTTAACCATAATAGGGTAGG - Intergenic
1089478733 11:118788691-118788713 TGTCTCAAAAATAATAGGCCGGG - Intronic
1094399235 12:30043581-30043603 TGCCATAACAATACCACGGCAGG - Intergenic
1094469260 12:30788324-30788346 TCCCTTAACAATAAAGGGACCGG - Intergenic
1095460499 12:42438896-42438918 TAACTCAACAATAAGAGGGCCGG - Intronic
1097070078 12:56348381-56348403 TTTGTTAACAATAATAAGGCCGG - Intronic
1098567700 12:71954311-71954333 TGCCTCACCAATAATAGCGCAGG + Intronic
1101319937 12:103664530-103664552 AGTTTTAACAATAATAGGTCTGG + Intronic
1107419560 13:40233878-40233900 TGCCTTAACACTAGTAGGGCAGG + Intergenic
1114457771 14:22867911-22867933 GCCTTTAAAAATAATAGGGCCGG + Intergenic
1114462977 14:22900007-22900029 TGCCTTAATAATAAGGGGGTGGG - Intergenic
1115870398 14:37794409-37794431 TGCCGTAACAATAAAAGGATTGG + Intronic
1116030310 14:39563084-39563106 TGTCTTAACACTAATAGTGTTGG + Intergenic
1117837755 14:59825339-59825361 TGCCTAAACCATATTGGGGCTGG - Intronic
1117976836 14:61307100-61307122 TTTCTTAACAACAACAGGGCCGG + Intronic
1118170434 14:63383753-63383775 TGCTTTAACTTTCATAGGGCTGG + Intronic
1119505120 14:75166055-75166077 TGCCCTAACAATACTACTGCGGG + Intronic
1124039279 15:26085005-26085027 TGCCTTAGCAATGATGGGGGTGG + Intergenic
1127769073 15:62216184-62216206 TGCCTTAAGAATAAGCTGGCTGG + Intergenic
1128896477 15:71378293-71378315 TGCCTTTACAAGAATAGTGAAGG - Intronic
1132740656 16:1410932-1410954 TGCCTTAACAACACTATGGCCGG + Intronic
1137449612 16:48559057-48559079 TTCCTTCAAAATAATAGGGGTGG + Intronic
1137631539 16:49949553-49949575 TGCCTTAAAAAAAAAAAGGCAGG + Intergenic
1140392775 16:74602480-74602502 TGCCCTAAAAATAAAAGGGCGGG + Intronic
1140637708 16:76935852-76935874 TGTTTTAAAAATAATAGAGCAGG + Intergenic
1141308920 16:82894344-82894366 TGCCTTAACAATAATAGGGCAGG + Intronic
1143076543 17:4348890-4348912 TTAATTAATAATAATAGGGCCGG + Intronic
1143078937 17:4367113-4367135 TGGCTCAATAATAATAGGGCCGG - Intergenic
1147026962 17:37594825-37594847 GGCCTTAACATCAATAGGGGAGG - Intronic
1158835775 18:61330585-61330607 TACCTTATTAATAATAGGCCTGG + Intergenic
1165246532 19:34501181-34501203 TGCTTTAAAAATAACAAGGCTGG - Exonic
928894072 2:36240784-36240806 TTCCTTAATATTAATAGTGCTGG + Intergenic
930287576 2:49450931-49450953 TGCCTTAGAAATAATAGGGAGGG + Intergenic
931880687 2:66567400-66567422 TTCCTTAAAAATAAAAGGGGGGG - Intronic
939716906 2:145595405-145595427 TGCCGTAAGAACTATAGGGCTGG + Intergenic
941957111 2:171216178-171216200 TGCCTTAAAAAAACAAGGGCCGG + Intronic
942869747 2:180720656-180720678 TGCCTTCACACTAATAAGGAAGG - Intergenic
948955317 2:241285730-241285752 TGCCTTAAAAAAATTATGGCTGG + Intronic
1177092775 21:16790304-16790326 TGCCTTCACAATATTAGGGTAGG - Intergenic
1181302534 22:21891489-21891511 TTCCTTAAAAATAATTGTGCTGG - Intergenic
1182910939 22:33983842-33983864 TGCCTTCACAATGTCAGGGCTGG - Intergenic
1183753562 22:39737548-39737570 TGGCTTAACAATAATATGCTTGG + Intergenic
951313928 3:21164952-21164974 TGCCTTCACAGTAATGGGGGAGG - Intergenic
954338401 3:49934132-49934154 TTCCTTAACTATAAAAGGGGAGG + Intergenic
956502410 3:69900630-69900652 CTCCTTAACAAAAAAAGGGCTGG - Intronic
956956753 3:74350228-74350250 TGCCTTAAGAGTAATAAGTCTGG - Intronic
958140121 3:89551645-89551667 TGCCTTTATAATAATGGGGCAGG + Intergenic
960072327 3:113444769-113444791 AGCCTTAAAAACAATAGGCCTGG - Exonic
961022228 3:123517894-123517916 TGCTTTAAAAATATTTGGGCCGG + Intronic
963958489 3:151281804-151281826 TGCCTTATTAGTAATAGGACTGG + Intronic
964632343 3:158825451-158825473 TTACTTTAAAATAATAGGGCAGG - Intronic
965485266 3:169271332-169271354 TGCTTTAACAAAAATATGCCTGG - Intronic
967210336 3:187162601-187162623 TGCCTGATCAATATTAGAGCTGG - Intronic
971261511 4:25061438-25061460 TCCCTTATCTATAAAAGGGCAGG - Intergenic
977477015 4:97524588-97524610 TGCCATAAAAATAAGATGGCTGG - Intronic
979271309 4:118765603-118765625 TGCCTTGAGATTAATAGGGCTGG + Intronic
982374007 4:154667523-154667545 TGCGTTAACAATAGTAAAGCTGG + Intronic
982841231 4:160189099-160189121 TGCCTTAGCAATGAAAGGGGAGG - Intergenic
985690400 5:1307067-1307089 TGACTTATCAATAATAATGCTGG - Intergenic
993182468 5:84572170-84572192 TGTATTAACAATTATTGGGCTGG - Intergenic
994782781 5:104113755-104113777 GGCATTATTAATAATAGGGCAGG - Intergenic
995647426 5:114328767-114328789 TGCCTAAACAATAATCTAGCTGG - Intergenic
996703322 5:126471615-126471637 TGCCTTCACAATAATACAGTAGG + Intronic
1000172269 5:158713560-158713582 TCCCTTAACATCAATAGGGGAGG - Intronic
1000503225 5:162078707-162078729 TGCTTAAAAAATAATAGGTCGGG - Intronic
1004608249 6:17214100-17214122 TGCCTTTACAGAAATAGGGAAGG - Intergenic
1009996799 6:70904864-70904886 TGCCTTCACAATAAGAGGTATGG + Intronic
1013661612 6:112303386-112303408 TGCTTTAACAATAACAAGGCTGG - Intergenic
1015515781 6:134081377-134081399 TGCCTTAAGAGTAGAAGGGCAGG - Intergenic
1015774469 6:136799790-136799812 TGGCTTAAAAATAATATGGTAGG + Intergenic
1018303720 6:162431059-162431081 TCCCTTAAAAAAAACAGGGCTGG + Intronic
1020505043 7:8975559-8975581 TGTGTTAACAATAAAAGGTCAGG + Intergenic
1026074692 7:67156060-67156082 TGCCTTACGAATGATCGGGCTGG - Intronic
1027613697 7:80394477-80394499 TGCTTTAAGAATAACAGGCCAGG + Intronic
1035915552 8:3617720-3617742 TGCCTTAACAATAAGGTAGCAGG - Intronic
1037012375 8:13859482-13859504 TGCCTTAAAAATGACAGGGAAGG + Intergenic
1039845901 8:41325235-41325257 TGCCTTATTAATAATTGGGAAGG + Intergenic
1043672868 8:82910497-82910519 TGCCTTCCAAATTATAGGGCAGG - Intergenic
1044538557 8:93384753-93384775 TGCTTTAAGAATAATAGGCCAGG + Intergenic
1048139842 8:131783645-131783667 TCCCTGAAAAATCATAGGGCAGG + Intergenic
1056438469 9:86596362-86596384 TTCCTCATCAATAATAGGGGAGG + Intergenic
1058140607 9:101353664-101353686 TGCCTTACAAGTAATAGGTCAGG - Intergenic
1060802307 9:126552455-126552477 TGCCTCAAAAATAACAAGGCCGG + Intergenic
1062147017 9:134995158-134995180 TGCCTGAACAAGAACTGGGCTGG + Intergenic
1188042334 X:25383572-25383594 TGCCCTGACAATAATGCGGCAGG - Intergenic
1199585247 X:149408210-149408232 TGCCTTTACAATAATAACTCTGG + Intergenic