ID: 1141308987

View in Genome Browser
Species Human (GRCh38)
Location 16:82894880-82894902
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141308982_1141308987 13 Left 1141308982 16:82894844-82894866 CCAGAGAGGAAGACTATGGCGAA 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1141308987 16:82894880-82894902 CTGAGAAATGCCAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr