ID: 1141309948

View in Genome Browser
Species Human (GRCh38)
Location 16:82903812-82903834
Sequence GTGCTCTTATTTACGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141309948_1141309951 24 Left 1141309948 16:82903812-82903834 CCATGTTTCGTAAATAAGAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1141309951 16:82903859-82903881 TTGCTGAAGTGCCTATAGCTAGG 0: 1
1: 0
2: 1
3: 12
4: 141
1141309948_1141309952 30 Left 1141309948 16:82903812-82903834 CCATGTTTCGTAAATAAGAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1141309952 16:82903865-82903887 AAGTGCCTATAGCTAGGAAGTGG 0: 1
1: 0
2: 4
3: 39
4: 297
1141309948_1141309950 -8 Left 1141309948 16:82903812-82903834 CCATGTTTCGTAAATAAGAGCAC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1141309950 16:82903827-82903849 AAGAGCACTGAGGTTGAGAGAGG 0: 1
1: 1
2: 10
3: 90
4: 734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141309948 Original CRISPR GTGCTCTTATTTACGAAACA TGG (reversed) Intronic
903108951 1:21111528-21111550 GTGCTCTTAATTAGGAATCTGGG - Intronic
908742914 1:67347059-67347081 GTGCCCTTATTTATAAAATAAGG - Intronic
913012290 1:114696218-114696240 GTTTTCTTATTTGGGAAACAGGG - Intergenic
916943219 1:169698153-169698175 GTTTCCTTATTTACCAAACAGGG + Intronic
919693777 1:200550984-200551006 GTGATCTTATATACATAACAAGG + Intergenic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1066210232 10:33229908-33229930 ATTCTCTTATTTACCACACAGGG + Intronic
1076501194 10:130937580-130937602 GTGCCCTTCATTAGGAAACAGGG - Intergenic
1078949467 11:16113402-16113424 GTACTCTAATGTACGAAACTTGG - Intronic
1080116730 11:28629951-28629973 GTGATCTTATTTGGGAAACTGGG - Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1088757133 11:112894781-112894803 GTGCTGTTAAATAGGAAACAGGG - Intergenic
1089088683 11:115847227-115847249 GTTCTCTTATTTCCCGAACAGGG + Intergenic
1090593426 11:128295413-128295435 GTTCCCATATTTAGGAAACAAGG - Intergenic
1093563800 12:20577796-20577818 GTCATTTTATTTACCAAACACGG + Intronic
1097574533 12:61374719-61374741 TTTCTTTTATTTACGATACAGGG - Intergenic
1101091044 12:101285972-101285994 GTGCTCATAATTTAGAAACAAGG + Intronic
1116807965 14:49511754-49511776 GTGGTCTTATTTAATAAAAAAGG + Intergenic
1118701973 14:68442272-68442294 GTTTTCTTATTTATGAAATATGG + Intronic
1121817929 14:96942698-96942720 GTCCCCTTATTTATAAAACAAGG - Intergenic
1126418243 15:48441648-48441670 GTGGTCTTATTTTTCAAACATGG - Intronic
1129555155 15:76500617-76500639 ATCTTCTTATTTACGTAACATGG + Intronic
1131863346 15:96678335-96678357 GTTGACTTATTTACAAAACAGGG - Intergenic
1135543618 16:23351313-23351335 GTTCTCTCATCTACAAAACAGGG - Intronic
1141259619 16:82440689-82440711 TTGCTCTTATCTATGTAACAGGG + Intergenic
1141309948 16:82903812-82903834 GTGCTCTTATTTACGAAACATGG - Intronic
1142063116 16:88043650-88043672 GTGGTCTAATTTACCATACAAGG - Intronic
1146090021 17:29867804-29867826 GTTCTCTTATTTATTAAAGAAGG - Intronic
1146270183 17:31479955-31479977 GTCCTCATATTTGCAAAACACGG + Intronic
1146717797 17:35100927-35100949 GTGCTGTTGTTTGGGAAACAGGG - Exonic
1149789043 17:59461402-59461424 CTGCTCTAAGTTAAGAAACACGG + Intergenic
1151846915 17:76662952-76662974 ATGTTCTTATTTTAGAAACAGGG + Intergenic
1155556234 18:27021988-27022010 GAGCTCTTGTTTATAAAACAGGG - Intronic
1158429890 18:57375809-57375831 GTGATCTTGGTTACAAAACAAGG - Intergenic
1160020682 18:75178443-75178465 GTCTTCTTCCTTACGAAACAGGG - Intergenic
930663354 2:54077859-54077881 GTTCTCTTATTTGCTAAAGAAGG - Intronic
939539889 2:143480928-143480950 GTGCTCTTATTTATGTAATTTGG + Intronic
940343908 2:152609975-152609997 GTCCTTTTATTTACCAAACCAGG + Intronic
944768946 2:202893996-202894018 GTTCTCTTATTCAGGAAACTTGG - Intronic
944853181 2:203741306-203741328 TGGCTCTTCTTTCCGAAACAGGG - Intergenic
947477429 2:230463144-230463166 GTTCTCTCATCTAGGAAACAAGG - Intronic
1169953421 20:11073937-11073959 ATTCTCTTATGTACAAAACAAGG - Intergenic
1170033930 20:11970309-11970331 GTGCTCTTTTTTAATCAACAGGG - Intergenic
952691116 3:36207709-36207731 GTTCCCTTCTTTATGAAACAGGG + Intergenic
954913797 3:54131856-54131878 GTGCTATAATTTGCGAAGCAAGG + Intronic
956804959 3:72800409-72800431 GTTTTCTCATTTATGAAACAAGG - Intronic
964530546 3:157663160-157663182 ATGCATTTATTTATGAAACAGGG - Intronic
967152843 3:186665416-186665438 GTTCCCTCATTTACGAAATATGG - Intronic
967491679 3:190099026-190099048 GTGCTTTTTTTTAAGAAAAAGGG + Intronic
969939398 4:10715427-10715449 GTTCTCTTATTTTCAAAATATGG + Intergenic
970645008 4:18109604-18109626 GTTTTCTTATCTACAAAACAGGG - Intergenic
971508187 4:27389572-27389594 GTGATCTTATTTGAAAAACAAGG + Intergenic
974689714 4:65281001-65281023 TTGCTCTTATTTAACAAACTAGG - Intergenic
977121951 4:93113291-93113313 GTTTTCTTATCTACAAAACAAGG - Intronic
991093090 5:62711664-62711686 TTGCTCTTATTTCTGAATCAAGG + Intergenic
993423387 5:87730963-87730985 GTGCTCTTACTTAAGAAAGTAGG + Intergenic
996536582 5:124584196-124584218 GTGCTCTTATTTACAAAAGGAGG - Intergenic
998696580 5:144647552-144647574 GTGCTCTTTTTTTCTAAAGATGG - Intergenic
999142467 5:149371560-149371582 GTGCACTCATTCACCAAACACGG + Intronic
1000574602 5:162961872-162961894 GTGTTCTTGTTTCAGAAACATGG - Intergenic
1003698223 6:8434948-8434970 GTGCCCCTATTTAATAAACACGG + Intronic
1003784474 6:9469003-9469025 GTGCTCTTTTTTGAGCAACAGGG + Intergenic
1006092858 6:31638185-31638207 GTGCTCTTATCAACTAAGCATGG - Intergenic
1011892654 6:92186126-92186148 GTTTTCTTATTTATGAAATAGGG + Intergenic
1016298040 6:142597116-142597138 GTTCTCTTGTTCAAGAAACATGG + Intergenic
1021947183 7:25739602-25739624 GGGCTCTAATTTATGAAAGATGG - Intergenic
1024187080 7:46960956-46960978 GAACCCTTATTTAAGAAACATGG + Intergenic
1024541400 7:50477758-50477780 GTACTCTCCTTTACGACACATGG + Intronic
1032554939 7:132822718-132822740 GTACTTTTATTTCCGTAACATGG - Intronic
1033838980 7:145350725-145350747 GTGATATTATTTATCAAACAAGG - Intergenic
1036979858 8:13458307-13458329 GTGCTCTTATTTATGGAGCAAGG - Intronic
1038889219 8:31700104-31700126 GTTCTCTTTTTTAAGAGACATGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041998707 8:64095217-64095239 GTGCTTATATTTCTGAAACAAGG + Intergenic
1045186175 8:99840609-99840631 ATTTTCTTATTTAAGAAACATGG - Intronic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1051460360 9:17306450-17306472 GTGCTCTATTTTATGAAGCAAGG + Intronic
1054977270 9:71162463-71162485 GTACTCTTATTTAAGAAAATGGG + Intronic
1055852285 9:80646132-80646154 GTTTTCTTATTTTTGAAACAAGG - Intergenic
1194687503 X:96940700-96940722 GTGCTGTTTTTTAAGCAACAAGG + Intronic
1195380705 X:104268294-104268316 GTGCTCTTATTTACTCAAAGAGG + Intergenic
1196409088 X:115396951-115396973 GTGCTCTTAACCACGAAATATGG - Intergenic
1199940984 X:152627661-152627683 GTGCTCTTAATTAATCAACAAGG - Intergenic