ID: 1141314301

View in Genome Browser
Species Human (GRCh38)
Location 16:82946204-82946226
Sequence ATGGATACATGGATGAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2177
Summary {0: 2, 1: 4, 2: 64, 3: 466, 4: 1641}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141314293_1141314301 26 Left 1141314293 16:82946155-82946177 CCATAACTATTTGTTGATTAAAT 0: 1
1: 2
2: 28
3: 203
4: 1034
Right 1141314301 16:82946204-82946226 ATGGATACATGGATGAATGGAGG 0: 2
1: 4
2: 64
3: 466
4: 1641

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141314301 Original CRISPR ATGGATACATGGATGAATGG AGG Intronic
Too many off-targets to display for this crispr