ID: 1141314301 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:82946204-82946226 |
| Sequence | ATGGATACATGGATGAATGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2177 | |||
| Summary | {0: 2, 1: 4, 2: 64, 3: 466, 4: 1641} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141314293_1141314301 | 26 | Left | 1141314293 | 16:82946155-82946177 | CCATAACTATTTGTTGATTAAAT | 0: 1 1: 2 2: 28 3: 203 4: 1034 |
||
| Right | 1141314301 | 16:82946204-82946226 | ATGGATACATGGATGAATGGAGG | 0: 2 1: 4 2: 64 3: 466 4: 1641 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141314301 | Original CRISPR | ATGGATACATGGATGAATGG AGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||