ID: 1141321005

View in Genome Browser
Species Human (GRCh38)
Location 16:83008753-83008775
Sequence CTGTGAAGATGAAAGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 3, 3: 68, 4: 546}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141321005 Original CRISPR CTGTGAAGATGAAAGGAAGG AGG (reversed) Intronic
900304898 1:2000947-2000969 CTGTGACAGTGAAGGGAAGGGGG - Intronic
900566740 1:3336093-3336115 CAGTGAAGATGAAGGGAGAGAGG + Intronic
900857797 1:5199996-5200018 TTGTGCAGATGAAAGCAAAGAGG + Intergenic
902439693 1:16421454-16421476 CTGTGTAGGAGAAAGGCAGGGGG - Intronic
902606923 1:17573963-17573985 TGGTGAAGAGGAAAGGAAGTTGG + Intronic
903001785 1:20271393-20271415 ATGTGAAGATAAAAGGAGGAGGG + Intergenic
903195828 1:21687458-21687480 GTGTGAAGAGGAAAGGCAGGGGG + Intronic
903214162 1:21833991-21834013 GTGTGAAGATGAAATGAATCAGG - Intronic
904210531 1:28884166-28884188 GTGTGAAGGTGACAGGCAGGGGG - Intergenic
904299315 1:29543887-29543909 CTGTCAAGCTGAATGGATGGCGG - Intergenic
904701895 1:32362668-32362690 CTGAGAGGGTGATAGGAAGGCGG + Exonic
904761342 1:32806610-32806632 CTCTGAAGAGGAAAGGAAGAGGG + Exonic
905025116 1:34844530-34844552 CTCTGGAGATGAAAGGAAAGAGG + Intronic
905336312 1:37247110-37247132 CTGTGGAGATGAAAGGGTGGGGG - Intergenic
906065599 1:42978255-42978277 TTGGGAAGAAGGAAGGAAGGAGG - Intergenic
906936905 1:50222169-50222191 CTGTGAAGAAGAAATAAAAGTGG - Intergenic
907115882 1:51968063-51968085 CTTTGAAGATGGATGGAAGAAGG + Intronic
907569907 1:55473612-55473634 CTCTGAAGATCAAAGGTAGCAGG - Intergenic
907676099 1:56519223-56519245 GTGTGAAGGTGAAAAGGAGGAGG - Intronic
908187435 1:61665949-61665971 CTGTGAAGAAGAAAAGAAGTTGG + Intergenic
908511545 1:64853690-64853712 CTGTGTAGATGAAATAAATGAGG + Intronic
909245647 1:73279258-73279280 CATTGAAGAAGATAGGAAGGAGG + Intergenic
909855919 1:80531436-80531458 CTGTGTAGAGGAAAAGAAGTGGG - Intergenic
909932521 1:81513918-81513940 CACAGAAGATGACAGGAAGGGGG - Intronic
910058619 1:83061930-83061952 CTGTGAAGCTAACAGAAAGGAGG - Intergenic
910781889 1:90947017-90947039 CTGTGTGGATGAAGGCAAGGAGG + Intronic
911222111 1:95259553-95259575 CTAAGAAAAGGAAAGGAAGGAGG - Intergenic
912304864 1:108557096-108557118 GTGAGAAGTTGAAAGGAAGAAGG - Intergenic
912572720 1:110636360-110636382 CTGTGCAAATGTAAGAAAGGTGG - Intergenic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
914438055 1:147678073-147678095 CAGTGGAGAACAAAGGAAGGAGG + Intergenic
914920630 1:151844944-151844966 CTCTGAGACTGAAAGGAAGGAGG - Intergenic
915475506 1:156150526-156150548 CCCTGAAGCTGAAAGGGAGGAGG + Intronic
915521308 1:156446021-156446043 CAGGGAAGAGGAAACGAAGGAGG + Intergenic
915574853 1:156768516-156768538 AAGTGAAGATGCAAAGAAGGGGG - Intronic
916472659 1:165139127-165139149 GGGTGAAGATGAAAGGACAGGGG + Intergenic
916849989 1:168693985-168694007 CTGGGCAGATGAGGGGAAGGGGG + Intergenic
916887605 1:169085583-169085605 GTGTGAAGATTAAGGGAGGGAGG + Intergenic
917264238 1:173202964-173202986 ATGGGAAGATGAGAGGAGGGAGG - Intronic
917410241 1:174752198-174752220 TTGTGAAGATGAAAGCAATTAGG + Intronic
917617744 1:176763801-176763823 CTGGGAAGTTCAAAGGAAGAGGG + Intronic
917923808 1:179772214-179772236 GTGAGCAGAGGAAAGGAAGGTGG - Intronic
919660621 1:200241332-200241354 ATGTGATTATGCAAGGAAGGAGG + Intergenic
920554682 1:206895997-206896019 CAGTGGAGATGAAAGAAAAGAGG - Intergenic
921315236 1:213884265-213884287 CTTTGCAGATTGAAGGAAGGGGG - Intergenic
921328357 1:214010523-214010545 CTGTGATGACAAAAGGCAGGGGG + Intronic
921395037 1:214659780-214659802 CTGTGGAGTTGAGAGGAAGTAGG - Intronic
923148897 1:231216852-231216874 CTGGGAAGATGAGAGGAGGGAGG - Exonic
923762391 1:236858662-236858684 CTGTGAAAATGGAAGCAGGGTGG + Intronic
924603679 1:245513887-245513909 CAGTGTAGATGAAATGAGGGAGG - Intronic
1063488335 10:6440650-6440672 CTGAGCAGAGGAAAGGAAGCAGG + Intronic
1063543608 10:6958807-6958829 CTATGGAGAGGAAAGAAAGGAGG - Intergenic
1063583129 10:7327343-7327365 CTGTGAAGATAAACAGAAGGAGG - Intronic
1064340518 10:14481429-14481451 TTGTGAGGAAGGAAGGAAGGAGG - Intergenic
1065259871 10:23913507-23913529 TTTTGGAGATGAAAGCAAGGGGG + Intronic
1065399913 10:25287404-25287426 CTTTGGACATGAAATGAAGGGGG - Intronic
1065754099 10:28915031-28915053 GTATGCAGATGAAAGGAAAGAGG - Intergenic
1066236919 10:33493940-33493962 CTCTGAAGTTAAAAAGAAGGAGG + Intergenic
1066998580 10:42585298-42585320 ATGTGACGATCACAGGAAGGAGG - Intronic
1067606338 10:47666798-47666820 ATGAGAAGAGGAAATGAAGGTGG - Intergenic
1067934839 10:50601084-50601106 TTGGGAAGATGAAATGAAGAAGG + Intronic
1068288968 10:54976940-54976962 CTGTGAGGCTGGAAGAAAGGTGG + Intronic
1070256390 10:74816256-74816278 TTGTGATGAAGAAAGGATGGAGG - Intergenic
1070353343 10:75614593-75614615 CTAGGAAGAGGAAAGGAAGTTGG - Intronic
1070371068 10:75782536-75782558 CTGTGAAGCGGAAAGGAGGCCGG + Intronic
1071171752 10:82874231-82874253 CTGTTTAGATGATAGGAAGTGGG + Intronic
1072526803 10:96279030-96279052 CCATGAACATGAAAGGCAGGAGG + Intergenic
1072559166 10:96554269-96554291 GTGAGAAGATGAAAAGAATGAGG - Intronic
1072700286 10:97635966-97635988 CAGTGGAGATGAAAGAAAGGGGG + Intronic
1072827278 10:98619876-98619898 ATGTGAGGAAGAAAGGCAGGTGG + Intronic
1073368143 10:102961384-102961406 CTGAGAATATGAAAAGAAAGAGG + Intronic
1073573446 10:104600392-104600414 ATGTGCAGATCAAAGGAAGCAGG + Intergenic
1073839483 10:107482148-107482170 CTTTGCAGATGAACGGAGGGCGG - Intergenic
1073904822 10:108265915-108265937 CAGTGATGATGAGAAGAAGGAGG - Intergenic
1074228974 10:111514906-111514928 CTCTGAAGAAGAAATGAAGCAGG - Intergenic
1074496385 10:113983480-113983502 ATGTGAACATGAGAGGAAGTAGG - Intergenic
1074599267 10:114897200-114897222 CAGAGAAGAACAAAGGAAGGAGG - Intronic
1074758097 10:116642535-116642557 CTGGGAAGATGAATGGATGGAGG - Intronic
1075495836 10:122917686-122917708 CTGTGGAGATGACAGGAAGCTGG - Intergenic
1075672277 10:124270754-124270776 CTGTGAAGATGAAATGCTGCAGG - Intergenic
1075995625 10:126873993-126874015 GTGTGGAGAGGAAAGGAAGGAGG - Intergenic
1076028250 10:127134964-127134986 AGGGGAAGAAGAAAGGAAGGAGG + Intronic
1076074593 10:127523161-127523183 CTAAGAAGATGAGAGGAAGCTGG - Intergenic
1076420692 10:130329779-130329801 CTGGGAAGACGAAAGGGCGGTGG - Intergenic
1076424630 10:130358921-130358943 CTGCCACGATGAAAGGCAGGGGG - Intergenic
1076427460 10:130377931-130377953 CATTCAAGATGAAAGGAAAGTGG + Intergenic
1076984220 11:223692-223714 CTGTGCAGGAGACAGGAAGGTGG - Intronic
1077891316 11:6419864-6419886 GTGTAAAGATGTAAGGAAGATGG + Intergenic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1078153705 11:8780112-8780134 CTGTAAGTATGAATGGAAGGAGG - Intronic
1078828032 11:14950512-14950534 CTCTGAAGCTGAAAAGAATGAGG - Intronic
1079019840 11:16900676-16900698 ATGAGAGGATGAAAGGGAGGAGG + Intronic
1079032151 11:16993885-16993907 CTGGGTAGATTTAAGGAAGGGGG + Intronic
1079275016 11:19027288-19027310 GTGACAAGATTAAAGGAAGGAGG + Intergenic
1079960632 11:26919036-26919058 TTGTGAAAAAGAAATGAAGGAGG + Intergenic
1080127735 11:28756752-28756774 CTGTGCAGATGAGTAGAAGGTGG + Intergenic
1080391377 11:31850230-31850252 CTGAGAAGAGGCAAGGAATGTGG + Intronic
1080405512 11:31975320-31975342 CTGTGAAGATGGGAGTCAGGTGG + Intronic
1080438109 11:32264975-32264997 CTGGCAAGATGAAAAGAAGTAGG - Intergenic
1081113368 11:39165611-39165633 ATGTAAAGAGGAAAAGAAGGTGG + Intergenic
1081657628 11:44867975-44867997 CTGAGAAGATGGCAGGGAGGTGG + Intronic
1081726579 11:45333971-45333993 CTGTTAGCATGAAAGAAAGGGGG + Intergenic
1081963372 11:47154524-47154546 CTGTGAACATGGATGCAAGGAGG + Intronic
1083461275 11:62813892-62813914 TTGAGAAGGTGAAAGGAAGTGGG - Intronic
1083713106 11:64560650-64560672 CTGTGATGAGGGAAGCAAGGAGG - Intronic
1084009101 11:66337925-66337947 TTAGGAAGCTGAAAGGAAGGAGG + Intronic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084639477 11:70416005-70416027 CTGCCCAGATGAAGGGAAGGCGG - Intronic
1084863813 11:72040014-72040036 CTGAGAAGATAAAAGGCAAGAGG + Intronic
1085107821 11:73861302-73861324 CTGTGAAGAGGAAAAGCAGGAGG - Intronic
1085383066 11:76138316-76138338 CTGTGAGGAAGATAGGCAGGTGG - Intronic
1085557715 11:77440464-77440486 CTGTGAAGATTAAAGGATATAGG - Intronic
1085742667 11:79090415-79090437 CCGTGCAGAAGAAAGGCAGGTGG + Intronic
1087203842 11:95373301-95373323 CTGGGAAGATCTAAGGAAAGAGG + Intergenic
1087425208 11:97976536-97976558 CAGAGGAGATCAAAGGAAGGAGG + Intergenic
1087581193 11:100056699-100056721 CAGTGAAGATGAAAATAAAGAGG + Intronic
1087731917 11:101788510-101788532 CTCTGAAGATAATTGGAAGGAGG - Intronic
1088133253 11:106521727-106521749 CAGTCAAGATGAATGGCAGGTGG - Intergenic
1088693875 11:112349819-112349841 CTGGGGACAGGAAAGGAAGGGGG + Intergenic
1088725381 11:112629837-112629859 CTGTGATGAGGAAAGGGAGCAGG + Intergenic
1089032161 11:115343332-115343354 CTGTGAAGGTTAAATGAGGGTGG - Intronic
1089213139 11:116819782-116819804 CTGTGGCGAGGAAAGGGAGGTGG + Intergenic
1089398297 11:118149975-118149997 CTGTGGAGAAGAGAGGAAAGGGG - Intronic
1090698950 11:129278380-129278402 ACTTGAAGATGGAAGGAAGGAGG - Intronic
1090775552 11:129962006-129962028 GTCTCAAGATGAGAGGAAGGCGG + Intronic
1091152386 11:133341007-133341029 CTGTGAAGAAGAAGAGAAGAAGG - Intronic
1091561613 12:1618649-1618671 CTGTGCAGATGATAAGAAAGAGG - Intronic
1092105506 12:5919206-5919228 CAGGGAAGATGTCAGGAAGGAGG + Intronic
1092228574 12:6764601-6764623 GAGGGAAGAGGAAAGGAAGGCGG + Intronic
1092750435 12:11714177-11714199 CGTTGGAGATGAGAGGAAGGAGG + Intronic
1092750556 12:11715310-11715332 TTTTGAAGATGAAGAGAAGGAGG + Intronic
1093235918 12:16608205-16608227 CTGAGAAGAAGAAAAGAGGGAGG + Intronic
1093673727 12:21908640-21908662 CTGAGAGGATGAAAAGTAGGGGG + Intronic
1094150455 12:27277007-27277029 TTGTGAAGATCAAACGAAAGAGG - Intronic
1094196623 12:27756817-27756839 CAGTGCAGATGAAAGCAAAGAGG + Intergenic
1094343999 12:29446253-29446275 TTGTAGGGATGAAAGGAAGGAGG + Intronic
1094438247 12:30445544-30445566 ATGTGCAATTGAAAGGAAGGTGG - Intergenic
1094599796 12:31898492-31898514 CTGGAAAGAAGGAAGGAAGGAGG + Intergenic
1094628133 12:32145508-32145530 CTTGGAAGAGGGAAGGAAGGAGG + Intronic
1095426156 12:42076503-42076525 AAGTGAAGTGGAAAGGAAGGTGG + Intergenic
1095512251 12:42965246-42965268 CTGTAAAGTTGAAAGAAATGTGG + Intergenic
1095926439 12:47584178-47584200 CTGAGCAACTGAAAGGAAGGAGG + Intergenic
1096213066 12:49781198-49781220 CTGAAAAGAAGGAAGGAAGGAGG - Intergenic
1096553333 12:52388653-52388675 CTGTGAAGATTAAAAGCAGGAGG + Intergenic
1096778267 12:53976940-53976962 CTGTGGAGAGGAGAGGGAGGGGG - Exonic
1097310853 12:58117618-58117640 CTGTGAAGAATAAAGCCAGGAGG + Intergenic
1098049117 12:66434716-66434738 CTTTGAAGGTAGAAGGAAGGTGG - Intronic
1099096762 12:78383793-78383815 TTGTGAAGATGAATGGAAGAAGG + Intergenic
1099446407 12:82757112-82757134 CTGTGAAGCTGAAAAGTAAGTGG + Intronic
1099828985 12:87815807-87815829 CTGTGAATACGACACGAAGGAGG + Intergenic
1100481483 12:94983805-94983827 CTGTGAAGAATAAAGGAAGGAGG - Intronic
1101588991 12:106109911-106109933 CTCTGAAAAAGAAAGGAAGAAGG - Intronic
1101722105 12:107359184-107359206 CTGTGAGGACAAAAGGTAGGAGG + Intronic
1102421545 12:112807311-112807333 CTGTGAAGAGGAGTGGAGGGTGG - Intronic
1102756675 12:115347237-115347259 CTTGGAAGATGCAAGGAAGGAGG - Intergenic
1102799151 12:115716459-115716481 CTGTGAAGAATAAAGGAAGCAGG + Intergenic
1103250595 12:119496637-119496659 CCGTGAAGATGAAAAGAAATGGG - Intronic
1103947109 12:124532776-124532798 CTTTGAAGTTGGAAGGAAAGCGG - Intronic
1104182649 12:126397461-126397483 CTGTGAAATTGCAAGCAAGGAGG + Intergenic
1104300614 12:127561832-127561854 GAGTGAAGATGGAAGGAAGTGGG + Intergenic
1105328433 13:19391466-19391488 CTGTGAACTTGAAGGGAAAGAGG + Intergenic
1105742784 13:23345991-23346013 GTGTGCAGAGGAAGGGAAGGTGG - Intronic
1105846374 13:24297692-24297714 CTGTGCAGATGAAAGGAGGCGGG + Exonic
1106066799 13:26360449-26360471 CTATGAAGATGAAGGGATGAGGG - Intronic
1106477947 13:30114412-30114434 CTTTGAAGATAAAGGGAGGGCGG - Intergenic
1106715479 13:32383788-32383810 CTGGGCAGATCAAAGGTAGGTGG + Intronic
1106730693 13:32538685-32538707 CTGTGAAGGTGAAAGAAAAGCGG + Intronic
1106797046 13:33217360-33217382 CAGTGGAGGTGAAAGGCAGGAGG - Intronic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1107343043 13:39430434-39430456 CTGTGAGGAGTAAAGGAAGTAGG - Intronic
1108314327 13:49222471-49222493 CTGTTAAGAAGAATGGAAAGAGG + Intergenic
1108546218 13:51497347-51497369 ATGTGAAGAAGAAAGTGAGGAGG - Intergenic
1108642483 13:52395670-52395692 CTGTGAAGAAGCAAGCAGGGAGG + Intronic
1108758480 13:53532774-53532796 CTTTGAAGATGGGGGGAAGGGGG + Intergenic
1109039511 13:57314725-57314747 CTGTCATGTTGAAAGGAAAGGGG - Intergenic
1109570970 13:64189248-64189270 CTGTAAAGAACAAAGAAAGGTGG + Intergenic
1110128072 13:71973166-71973188 AAGGAAAGATGAAAGGAAGGTGG + Intergenic
1111028499 13:82566900-82566922 CTGTGAAGCTGGAAGTAAGATGG + Intergenic
1111862650 13:93727893-93727915 CTGTGAAGCAGCCAGGAAGGAGG - Intronic
1113007701 13:105725922-105725944 CCGTGAAGAAGGAAGGAAGTCGG - Intergenic
1113325383 13:109276590-109276612 TTGTAAAGAAGAAAGGAAAGAGG + Intergenic
1114596625 14:23917709-23917731 CTCTGGAGAGGAAAGGAGGGTGG + Intergenic
1114699192 14:24660043-24660065 CTGACCAGATGAAAGGGAGGAGG + Intergenic
1114736512 14:25049122-25049144 CTGTGAAGATGAACGGGGTGGGG + Intronic
1115157844 14:30360566-30360588 GTGTGGAAATGAAGGGAAGGAGG + Intergenic
1115892241 14:38044311-38044333 CTGTGAAGGTGAAAGGAAAATGG + Intergenic
1116861917 14:50002048-50002070 GTGTGAAGATACCAGGAAGGAGG - Intronic
1117275837 14:54192538-54192560 CTGTAAAGAAGAAGGGAAGCAGG + Intergenic
1118029601 14:61807551-61807573 CCTTGAAGATGAAGGGTAGGAGG - Intergenic
1118776475 14:68977377-68977399 CTAGGAAGATGACAGGAAGAGGG + Intronic
1119041519 14:71278734-71278756 AGGTAAAGAGGAAAGGAAGGAGG + Intergenic
1119318000 14:73711606-73711628 CTGTTAAGATGACAGCAAGAGGG + Intergenic
1119638399 14:76294904-76294926 ATGTGTAGAAGAAAGGAAGGAGG - Intergenic
1120222344 14:81748565-81748587 CAGTGAAGAAGAGAGGAAGAAGG + Intergenic
1120830103 14:88990290-88990312 CTGTGATGAGGAAAGGCAAGAGG - Intergenic
1121584792 14:95055830-95055852 CTTTGCAGATGAAAGTAATGAGG - Intergenic
1121843866 14:97156274-97156296 CTGAGAGGAAGAAAGGAAGGAGG - Intergenic
1122092876 14:99351753-99351775 GTGTGAAGAGGGAAGGGAGGTGG - Intergenic
1122546003 14:102523262-102523284 CTGTCAAAAAGAAAGGAAAGAGG + Intergenic
1123038360 14:105480410-105480432 CTGTGGGGAGGTAAGGAAGGTGG + Intergenic
1125803525 15:42472365-42472387 ATGTGAAGATGAATGTAAGAAGG - Intronic
1125893978 15:43286719-43286741 CTGTGAAGATGAGAGAAAGATGG - Intronic
1125932261 15:43608918-43608940 CTGTGAAGATTAAATGAGGTAGG - Intronic
1125945357 15:43708390-43708412 CTGTGAAGATTAAATGAGGTAGG - Intergenic
1126432131 15:48597574-48597596 CCGTGAAGAATAAAGGAAAGAGG - Intronic
1127364686 15:58276929-58276951 CTGTGAAAATGAAATCAAAGTGG + Intronic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128953474 15:71913078-71913100 CTCAGGAGATGAAAGGGAGGAGG - Intronic
1129014144 15:72450973-72450995 TGGTGAAGATGCAAGGAAGCTGG - Intergenic
1129206507 15:74040369-74040391 CTTGGAAGAGAAAAGGAAGGGGG - Intronic
1129520720 15:76184379-76184401 CTGTGAAGATGACTGGTAGTTGG - Intronic
1129951126 15:79592494-79592516 CTGTGAAGCTGAGATGAAGGAGG - Intergenic
1131311069 15:91290274-91290296 ATGTGAAGAGGTAAGGAAGGTGG + Intronic
1131313082 15:91308263-91308285 GTGGGGAGATAAAAGGAAGGAGG + Intergenic
1131330392 15:91493196-91493218 GTGAGAAGAAGAAAGGAGGGGGG + Intergenic
1131776902 15:95812355-95812377 CTGAGAAGTACAAAGGAAGGAGG - Intergenic
1132285924 15:100662275-100662297 CTGTCAAGATGTAAGGGAGAGGG + Intergenic
1133312718 16:4860649-4860671 CTGTGAAGCTGCAAGCAAGAGGG - Exonic
1133974128 16:10588299-10588321 ATGGGAACATGAAAGGCAGGAGG + Intergenic
1134054992 16:11164462-11164484 ATCTGTAGGTGAAAGGAAGGAGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135205998 16:20484480-20484502 CTGTGCTGAGGAAAGGCAGGTGG - Intronic
1135212914 16:20539304-20539326 CTGTGCTGAGGAAAGGCAGGTGG + Intronic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136670194 16:31849688-31849710 CTGTGGATATAAAAGTAAGGAGG + Intergenic
1138120773 16:54399390-54399412 CCTTGAAGAGCAAAGGAAGGGGG + Intergenic
1139299860 16:65935722-65935744 CTGGGATGATAATAGGAAGGTGG - Intergenic
1139644652 16:68319468-68319490 GTGTGAAGAGGCCAGGAAGGTGG + Intronic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1139902667 16:70340635-70340657 CTGTGAAGACGAAAGTCACGTGG - Intronic
1139916421 16:70431068-70431090 CTGCAAAGAAGACAGGAAGGAGG + Intronic
1141321005 16:83008753-83008775 CTGTGAAGATGAAAGGAAGGAGG - Intronic
1141339476 16:83189715-83189737 CTGTGAATATTAAAGGCAAGAGG + Intronic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1142264490 16:89057525-89057547 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142264518 16:89057615-89057637 CTGGGAGGAGGACAGGAAGGAGG - Intergenic
1142313181 16:89326041-89326063 CTGTGAAGACGAAGGGGAGGAGG + Intronic
1142915389 17:3132373-3132395 CTGGGTAGATGAAAGGCAGGAGG + Intergenic
1143171208 17:4931727-4931749 CTGTGAAGAGGAAGAGAAGCGGG + Intergenic
1143458037 17:7080341-7080363 CCGAGAAGAGGAAAGGAAGTAGG - Intergenic
1143793471 17:9317054-9317076 TTGTGTAGATGAAAGGAATAAGG + Intronic
1145124911 17:20292225-20292247 CTGGGAAGGTGAAAACAAGGAGG - Intronic
1145884889 17:28375032-28375054 CTGAGAAGAAGAAAGCAAGAGGG - Intronic
1146931506 17:36781269-36781291 CTGGGAAGAGGGAAGGCAGGAGG + Intergenic
1147330453 17:39696174-39696196 CTGACAAGAGGAGAGGAAGGGGG - Intronic
1147471459 17:40666007-40666029 CTGTAAAGATGAAAAGACTGAGG + Intergenic
1147533869 17:41305434-41305456 CTGTGAAGATGACTGGAAAATGG - Intergenic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1148712441 17:49691642-49691664 CTTGGATGATGGAAGGAAGGAGG + Intergenic
1151463596 17:74270401-74270423 CTATGAAGATGAATAGAATGAGG + Intergenic
1153289839 18:3489936-3489958 CTGTGAAGAAGAAAGAAAGAAGG + Intergenic
1154458063 18:14548511-14548533 CCAGGAAGATGAAAGAAAGGTGG + Intergenic
1155132573 18:22953123-22953145 CTGTGAAGAAGAGAGGGAAGAGG + Intronic
1156345933 18:36257239-36257261 CTATAAAGATGAATGGAAGCTGG - Intronic
1156971884 18:43166781-43166803 ATGTAAAGATGGAAGGAAAGAGG + Intergenic
1157492445 18:48133808-48133830 CTGTGGAGATGAATAGAGGGAGG - Intronic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1157887449 18:51382845-51382867 TTGTGAAGATGAAAGGAAAAGGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158106937 18:53896097-53896119 TTGTGAAGAACAAAGGAAGGAGG + Intergenic
1158601748 18:58862526-58862548 CTGTGAACAATAAAGGAACGAGG + Intergenic
1159972297 18:74669370-74669392 CACTGAGGAAGAAAGGAAGGAGG - Intronic
1160040121 18:75337538-75337560 CTGGGAAGATGAGAGAACGGTGG + Intergenic
1160253773 18:77228978-77229000 CTATGAAGAAGAAATGAAGGGGG + Intergenic
1160600437 18:80008576-80008598 ATGTGGAGAAGACAGGAAGGGGG - Intronic
1161934618 19:7364012-7364034 ATGGGTGGATGAAAGGAAGGAGG + Intronic
1162239548 19:9338534-9338556 ATTTGAAGAGGAAAGGATGGTGG + Exonic
1162265975 19:9574659-9574681 CAGAGGAGAAGAAAGGAAGGAGG + Intronic
1162429026 19:10615862-10615884 CTGTAAAGATGAAATGAGGCGGG + Intronic
1162860612 19:13504021-13504043 CTTCTAAGAGGAAAGGAAGGAGG - Intronic
1163212946 19:15854873-15854895 CTTGGAAGCTGAAAGGATGGAGG + Intergenic
1164528111 19:29026660-29026682 CTGAGAAGCAGAAAGGAAGCAGG - Intergenic
1165749331 19:38250791-38250813 CTGCAAAGATGAGAGGAAGATGG - Intronic
1166553948 19:43685765-43685787 TTGTGAAGCAGAAAGGAAAGGGG + Intergenic
1166756510 19:45195598-45195620 CTCTGAGGAAGGAAGGAAGGAGG - Intronic
1166868228 19:45854127-45854149 CTGAGCAGGTGAAAGGGAGGAGG - Intronic
1167410820 19:49342703-49342725 GTGGGGTGATGAAAGGAAGGTGG - Intronic
1167980906 19:53274134-53274156 CTCTGAAGACGATAGGCAGGTGG + Intergenic
1168102074 19:54146606-54146628 CTCTGAAGATGATAAGAAGAGGG + Exonic
1168497894 19:56869516-56869538 CTGGGGAAATGAAAGGAAGTGGG - Intergenic
1168506570 19:56940139-56940161 CGGTGAACAAGAAAGGAAAGAGG + Intergenic
925077063 2:1025622-1025644 CTGTGAAGATGATGTGAAGATGG - Intronic
925196215 2:1928268-1928290 CTGTGCAGAGGAAATGAAGTTGG + Intronic
925989866 2:9246010-9246032 CTGTGAAAAGGACAGGAGGGTGG + Intronic
927352481 2:22133678-22133700 CTGGGAAGACAAGAGGAAGGAGG - Intergenic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
928220589 2:29399793-29399815 ATGTGAAAATGCAAGGAAGAAGG - Intronic
928319269 2:30270213-30270235 CCTTTAAGATAAAAGGAAGGAGG - Intronic
928695016 2:33840672-33840694 CTGTCATGTTGAAAGGAAAGAGG + Intergenic
928695219 2:33842133-33842155 CTGTGATGATGCAAAGTAGGAGG - Intergenic
929160408 2:38826515-38826537 CTGGGAAAATGAAAGAAAAGAGG - Exonic
929357937 2:41049478-41049500 CTGAAAAGAGGAAAGGAAAGGGG - Intergenic
929604113 2:43224283-43224305 CAGTGAGGAGGAAGGGAAGGCGG - Exonic
929762299 2:44816309-44816331 CTTAGAAGCTGACAGGAAGGGGG + Intergenic
930086377 2:47500430-47500452 CTGAGTCGATGGAAGGAAGGAGG + Intronic
930500072 2:52203438-52203460 CTGGGAAGATTAAAGGGAAGGGG + Intergenic
930713243 2:54569160-54569182 CTGGGAAGAAGAAAGGAACGGGG + Intronic
930806073 2:55492058-55492080 CTGTGAGGAAGTAAGGAAGGTGG + Intergenic
931022007 2:58056617-58056639 ATGGGAAGATGAGAGGAAGTGGG - Intronic
931678248 2:64719441-64719463 CTGTCAAGATGACTGGAAAGCGG - Intronic
932440353 2:71730974-71730996 CAGTGAAGAGGACAAGAAGGGGG - Intergenic
933367991 2:81378901-81378923 ATGTGAAGCTGAAATGAACGAGG + Intergenic
933674468 2:85042043-85042065 CTTAGAAGATGCCAGGAAGGTGG - Intronic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933717939 2:85375857-85375879 CTTTGAAGATGGAAGAATGGAGG - Intronic
934731310 2:96660208-96660230 CTGTAAAGATGAAAGGAGTTAGG + Intergenic
935579706 2:104746033-104746055 CGGAGAAGGAGAAAGGAAGGCGG + Intergenic
935687877 2:105700297-105700319 CTGTGGAGCTCACAGGAAGGAGG - Intergenic
935715969 2:105939266-105939288 CTCTGAAGATGAACTTAAGGGGG + Intergenic
936053009 2:109239806-109239828 CTGTGGGGATGAAAGGCAGGTGG - Intronic
936664074 2:114574502-114574524 ATGTGAAGAGGAAAGGTAGCTGG + Intronic
937084869 2:119164833-119164855 GAGGGAAGAAGAAAGGAAGGAGG - Intergenic
937284176 2:120739491-120739513 CCATGCAGATGAAAGGAAGCTGG - Intronic
938566583 2:132524202-132524224 CTGTGAAGAGGGAACGAAGAGGG + Intronic
938780777 2:134582829-134582851 CTGAGAGGAGGAAAGGTAGGGGG + Intronic
942127761 2:172844492-172844514 CTGTAAGGAGGAGAGGAAGGAGG - Intronic
942460094 2:176162651-176162673 TTGGGAAGAAGAAAGGAAAGAGG - Intronic
944050213 2:195459532-195459554 TTTTGAAGATCAAGGGAAGGTGG - Intergenic
944404815 2:199371947-199371969 CTGTGAAAAAGAAAGGATGAGGG + Intronic
944496629 2:200313744-200313766 GGTTGAAGATGAAAGGAAGATGG - Intronic
944535349 2:200704300-200704322 CAGCTGAGATGAAAGGAAGGGGG + Intergenic
944788551 2:203099891-203099913 ACTTGAGGATGAAAGGAAGGAGG - Intronic
945032143 2:205675600-205675622 CTCTGAAGATGTAAGGGAAGCGG + Intergenic
945213619 2:207410221-207410243 CAGTGAAGATGAATGGGAGATGG - Intergenic
946016325 2:216606858-216606880 CTGTGAGGAAGGAAGGCAGGTGG - Intergenic
946086563 2:217179351-217179373 CTTTGAAGATGGAAGGAAGATGG + Intergenic
946522303 2:220479714-220479736 CTGTGGAGAGGTAAGGAAGAAGG - Intergenic
947288811 2:228547997-228548019 CTTAGAAGAATAAAGGAAGGTGG + Intergenic
947305168 2:228737898-228737920 CTGTGGATGTGAAAGGAAGGTGG + Intergenic
947541826 2:230985176-230985198 CTTTGGAGATGAAGGGAGGGAGG + Intergenic
947835586 2:233172484-233172506 CAGTGAAAATGAAAGAAAGGGGG + Intronic
947903980 2:233746267-233746289 CTGTGGGGATTCAAGGAAGGTGG + Intronic
948282759 2:236760454-236760476 ATGGGAAGAAGGAAGGAAGGAGG + Intergenic
948793599 2:240391389-240391411 CAGAGAGGATGAAAGGACGGGGG + Intergenic
1169666808 20:8046762-8046784 CTTTGTGAATGAAAGGAAGGAGG - Intergenic
1169898754 20:10532421-10532443 CTGGGAAGGTGACATGAAGGAGG + Intronic
1170206068 20:13799873-13799895 ATCTGAAGATCAAAGGGAGGAGG + Intronic
1170459571 20:16564737-16564759 ATGGAGAGATGAAAGGAAGGAGG - Intronic
1170914142 20:20606149-20606171 CTGTGAAAATGGAAGGAAAAGGG - Intronic
1171115311 20:22520361-22520383 CTGTGAGGAAGAAGGGAAGCAGG + Intergenic
1173438774 20:43056920-43056942 CTTTTAAGATAAAAGGAAGCAGG - Intronic
1173746875 20:45444427-45444449 CCATGAAGATGGAAGGAGGGAGG - Intergenic
1174292836 20:49521159-49521181 TTGTGAAGATGAAAGGAGGCAGG - Intronic
1174975528 20:55328853-55328875 CTGAGAAGATGGAGGGAGGGAGG - Intergenic
1175151971 20:56941978-56942000 GTGGGAAGATCAAAGGAAGGAGG - Intergenic
1176003138 20:62843143-62843165 CGGTGAGGAAGAAAGGAAGGGGG + Intronic
1176301915 21:5102545-5102567 CTGTGCAGGTGACACGAAGGAGG - Intergenic
1176922912 21:14710408-14710430 TTGTAAAGATGAAAGGAATAGGG - Intergenic
1177047496 21:16188266-16188288 CAGTGAAATTGAAGGGAAGGGGG + Intergenic
1179248401 21:39652554-39652576 CTGCTAGGATGAAAGGAATGAGG - Intronic
1179297923 21:40079784-40079806 ATGTGGAAATGATAGGAAGGTGG + Intronic
1179474759 21:41636079-41636101 ATGAGAAGATGAATGGATGGTGG - Intergenic
1179855115 21:44159355-44159377 CTGTGCAGGTGACACGAAGGAGG + Intergenic
1180711445 22:17842196-17842218 CTCTGCAGGAGAAAGGAAGGTGG + Intronic
1180725019 22:17940400-17940422 GTCTGAAGAAGGAAGGAAGGAGG + Intronic
1180904178 22:19396948-19396970 CTGTGAAGAAAAAAGGAATGTGG + Intronic
1181363835 22:22358428-22358450 CTCTGAGGATGAAGGGGAGGAGG - Intergenic
1181440987 22:22935108-22935130 CTTGGGAGATGCAAGGAAGGAGG + Intergenic
1181615192 22:24049525-24049547 CTGGGAAGGGGAAAGGCAGGAGG - Intronic
1181881339 22:25982688-25982710 CTTTGAAGATGGAGGCAAGGGGG - Intronic
1182520666 22:30882832-30882854 CTGTGAACAGCAAAGGTAGGAGG + Intronic
1182710231 22:32318017-32318039 CTGTGAGGATGAGTGAAAGGGGG - Intergenic
1182967721 22:34537758-34537780 CATTGAAGGTGAAAGGAAGCAGG + Intergenic
1183507956 22:38219900-38219922 CTGCCACGAGGAAAGGAAGGAGG + Exonic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183852537 22:40602885-40602907 TTGTGAAGAAGAAATGAAGGGGG - Intronic
1184129045 22:42506450-42506472 CTGTGAAGATTAAAGAGGGGAGG + Intergenic
1184138992 22:42566764-42566786 CTGTGAAGATTAAAGAGGGGAGG + Intronic
1184696979 22:46145330-46145352 CTGTGCAGCTGAGTGGAAGGGGG - Intergenic
1184806679 22:46799127-46799149 CTGTGGAAAGGAAGGGAAGGTGG - Intronic
1184980867 22:48095476-48095498 CGGAGAAGATGAAAGGATGAGGG + Intergenic
949561078 3:5203194-5203216 CAGAGAAGATGAAAGGAAAAGGG - Intronic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
950240283 3:11363546-11363568 CTATGAAGATTAAAGGAGGCCGG - Intronic
950259431 3:11533232-11533254 CGGTGATGATGAAAGGGAGCTGG - Intronic
950311260 3:11960057-11960079 CTGTGAAGGAAAGAGGAAGGAGG + Intergenic
950616691 3:14165586-14165608 CTGTGAAGAGGAAAGGAGGAAGG + Intronic
950957576 3:17070873-17070895 CAGAGAAGAGGAAATGAAGGAGG + Intronic
952119486 3:30225088-30225110 CTGTGATGATGAAGGTAATGTGG + Intergenic
952184956 3:30958545-30958567 GTGTGGAGATGAAGGGAGGGAGG - Intergenic
952206863 3:31188970-31188992 CTGAAAAGAAGAAAGGAAGAGGG + Intergenic
953276123 3:41500448-41500470 CTGTGATGATTAAAGGGAGGAGG + Intronic
953718178 3:45333535-45333557 CTGTGCAGATGGAAGGAAGTGGG + Intergenic
954238929 3:49278036-49278058 CTGTGAAGCTGAAAAGGGGGTGG - Intronic
954926509 3:54240569-54240591 AAGTGAGGATGAGAGGAAGGAGG + Intronic
955061185 3:55492588-55492610 CTGGGAAGAGGAGAGGAATGTGG + Intergenic
955351636 3:58197813-58197835 CTGTGCATATGACAGGTAGGAGG - Exonic
955860381 3:63323310-63323332 CTGTGAAGTGGAAAGAAAGAAGG - Intronic
955914575 3:63893891-63893913 CTGTGAGAGTGAAAGCAAGGTGG + Intronic
956308184 3:67849651-67849673 ATGCAAAGATCAAAGGAAGGAGG + Intergenic
956354335 3:68374362-68374384 CTGTAAAGAAGAAAGGAGTGAGG + Intronic
956566286 3:70642183-70642205 GTGTGTAGATGCAAGGAGGGTGG - Intergenic
957220859 3:77380721-77380743 CTGTGATGATGGAAGGAAGGAGG - Intronic
958440426 3:94149766-94149788 CTGTGATGATGATAATAAGGAGG - Intergenic
959192668 3:103135058-103135080 CTTTGAAGATGAAAGGATCCAGG - Intergenic
959584363 3:108012356-108012378 GAGGGAAGAGGAAAGGAAGGAGG + Intergenic
959837776 3:110940950-110940972 CACTGAAGATGAGAGGAAAGTGG + Intergenic
960293633 3:115916193-115916215 CTTTGAAGAGAAAAGGCAGGTGG - Intronic
960807869 3:121601272-121601294 GTTTGACAATGAAAGGAAGGGGG - Intronic
961074699 3:123971485-123971507 CAGAGGAGAGGAAAGGAAGGTGG - Intronic
961308982 3:125980993-125981015 CAGAGGAGAGGAAAGGAAGGTGG + Intronic
961414517 3:126747752-126747774 CTCTGGAAATGAAGGGAAGGAGG - Intronic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961770743 3:129248323-129248345 CTGTGGAGAGGAGAGGCAGGAGG - Intergenic
962304917 3:134277642-134277664 ATGTGAAGAGAAAGGGAAGGAGG + Intergenic
962893310 3:139692096-139692118 TTGTGGAAATGAAAGAAAGGAGG - Intergenic
963390580 3:144658829-144658851 CAGTGAAGATGAAAATAAAGAGG - Intergenic
963717281 3:148818073-148818095 ATATGATGATGAAAAGAAGGAGG + Intronic
963863931 3:150340250-150340272 CTGTGAAGGATAAAGGGAGGAGG + Intergenic
963872068 3:150427794-150427816 AAGAGAAGAAGAAAGGAAGGAGG - Intronic
964578582 3:158204207-158204229 CTGTGAAAAAGAAAGGAATGAGG - Intronic
965580035 3:170258056-170258078 CAGAGAAGATAAAAGGAAGTAGG + Intronic
967268847 3:187716482-187716504 ATGTGAAGATGAAAAGATTGAGG + Intronic
967311698 3:188112209-188112231 CTGAGTAGATGAAAGGATGAAGG - Intergenic
967421313 3:189276221-189276243 CTGTGAAGATGAAGAGGTGGTGG + Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
969000401 4:3976176-3976198 CTGAGAAAATGCAGGGAAGGTGG - Intergenic
970381496 4:15512587-15512609 CTGGGAAGATGGATGGATGGTGG + Intronic
971490364 4:27205800-27205822 CAGTGAGGCTGAAAGGAAGGAGG + Intergenic
971822179 4:31571583-31571605 TTGTGAAAATGAAATGTAGGAGG + Intergenic
972388470 4:38590277-38590299 TTGAGAGGATGTAAGGAAGGAGG - Intergenic
972766889 4:42159466-42159488 CAGTGACGATGGAAGGAAGTGGG + Intergenic
973981510 4:56312099-56312121 CTGAGAAGATAAAAGGAAGAGGG - Intronic
974996828 4:69171110-69171132 CTGTGAAGAGGAAAGGAACACGG + Intronic
975009800 4:69336071-69336093 CTGTGAGGAGGAAAGGAACGTGG + Intronic
976455756 4:85245552-85245574 TTTTGAGGAAGAAAGGAAGGGGG - Intergenic
976482382 4:85559742-85559764 CAGGGAAGATGAAAAGAAGTTGG - Intronic
976825294 4:89254180-89254202 AGGGGAAGAGGAAAGGAAGGAGG - Intronic
977917806 4:102613402-102613424 CTGTGAGAAAGAAAGGAAGGAGG - Intronic
978032555 4:103953139-103953161 CTGTGAAGATAAAATGGGGGTGG - Intergenic
979235556 4:118396477-118396499 CTGAGAACATTAAAAGAAGGAGG - Intergenic
979316547 4:119271783-119271805 ATATGAAGATGAAATGAAGCAGG + Exonic
980911699 4:139000066-139000088 CTGGGAAGTTGTAAGGGAGGAGG - Intergenic
981595125 4:146411878-146411900 AAGTGCAGATGAAAGGAAGAAGG + Intronic
982972451 4:162006367-162006389 TTTTCAAAATGAAAGGAAGGTGG - Intronic
983481962 4:168285869-168285891 ATGGGAAGAAGAAAGGAAGGAGG + Intronic
983747670 4:171221735-171221757 TTGTGAAAAGGAAAGAAAGGAGG - Intergenic
984051172 4:174867129-174867151 CTGTGAAGCAAAAAGGAACGAGG + Intronic
984489199 4:180410818-180410840 CTGAAAAGAGGAAAGTAAGGTGG + Intergenic
984688124 4:182694432-182694454 TCGTGATGATGAAAGAAAGGTGG + Intronic
985706125 5:1402305-1402327 TTGTGTAGAAGAAAGGCAGGTGG - Intronic
985771308 5:1813409-1813431 CTGTGAGGTGGAAAGGAAGGAGG - Intronic
986788976 5:11142408-11142430 GTGTGAAGTTGAATGCAAGGGGG + Intronic
988252626 5:28780087-28780109 CAGAGAAGAAGGAAGGAAGGAGG - Intergenic
989088395 5:37700941-37700963 CTGTAAAGAAGAAAGGGAAGGGG - Intronic
989212159 5:38866705-38866727 CTGTGCTGATGAGAGGGAGGGGG + Intronic
990158496 5:52907536-52907558 CTGGGAATCTGAAAGAAAGGTGG + Intronic
990496626 5:56354306-56354328 GTGGGAACAGGAAAGGAAGGAGG + Intergenic
990587162 5:57223620-57223642 GTGTGAGGAGGTAAGGAAGGTGG - Intronic
990630250 5:57660999-57661021 AAGTGAAGAAGAAAGGAAGCAGG - Intergenic
990742977 5:58931156-58931178 CTGTGAATATAAAATAAAGGGGG + Intergenic
990832494 5:59975181-59975203 CTGTCAAGATGACAAAAAGGTGG - Intronic
990842593 5:60100435-60100457 AAGAGAAGAAGAAAGGAAGGAGG + Intronic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991282146 5:64927402-64927424 CTGTGAAGAAGAGGGGCAGGAGG - Intronic
991529106 5:67595803-67595825 ATGGGAAGAAAAAAGGAAGGAGG + Intergenic
992245907 5:74822214-74822236 CTTTGAAGATGTAAGGGATGAGG - Intronic
992364123 5:76074357-76074379 CTGGTAAGATGCAAGGAAGGGGG - Intergenic
992385332 5:76279229-76279251 CTGTGAAGATGTAAGTAGGCAGG + Intronic
992982887 5:82195013-82195035 CTGTGAATAAGCAAGGAAGATGG - Intronic
993430760 5:87829963-87829985 CTGTGAAGGTTAAAGAAAGGAGG + Intergenic
994492834 5:100470035-100470057 TTCTGAAGATGAATGGATGGTGG + Intergenic
994835084 5:104841215-104841237 CTGTGTAAATGAAAGAAATGGGG - Intergenic
995708660 5:115012344-115012366 CTATTAAGAGAAAAGGAAGGAGG + Intergenic
996408785 5:123133130-123133152 CTGTGAATATGAAAGTAAAAAGG + Intronic
996980500 5:129487009-129487031 ATGTGAACCTGACAGGAAGGGGG - Intronic
997609486 5:135205059-135205081 CTGTAAAGGTGAAGAGAAGGCGG - Intronic
997646539 5:135485940-135485962 TTGGGAAGGGGAAAGGAAGGTGG - Intergenic
998588258 5:143450806-143450828 CAGTGAAGATGACAGGTGGGAGG - Intergenic
998947410 5:147354395-147354417 CTGGGGAGAGGAAAGAAAGGTGG - Intronic
999446732 5:151646284-151646306 CAGGCAAGATGAAAGGACGGTGG + Intergenic
999580531 5:153033464-153033486 CAGAGAAGAACAAAGGAAGGAGG + Intergenic
999865139 5:155693205-155693227 ATCTGAAAATGAAAGGAGGGAGG - Intergenic
1000285682 5:159824287-159824309 GAGAGAAGATGAAAGGAAGAAGG + Intergenic
1000349985 5:160345532-160345554 GAGTGAAGATGACAGGCAGGAGG + Intergenic
1000443783 5:161295150-161295172 CTGAGAAGAGGAAAGGGAAGAGG + Intronic
1000829394 5:166084299-166084321 GTGTGAAGGAGAAAGGAAGAAGG - Intergenic
1001133244 5:169081285-169081307 CTGGGAAGAGGAGAGGAAGGAGG + Intronic
1001589746 5:172857233-172857255 TTGTGAGGATGAAATGAATGGGG + Intronic
1002562802 5:180093720-180093742 CAGAAAACATGAAAGGAAGGGGG - Intergenic
1003775465 6:9356636-9356658 ATGTGCTGATGAAAGGAATGTGG - Intergenic
1004070006 6:12289247-12289269 AAGTGAATATGCAAGGAAGGTGG - Intergenic
1004185166 6:13415341-13415363 CATTGATGTTGAAAGGAAGGGGG - Intronic
1004295117 6:14403144-14403166 CAATGAAGAAGAAAGGAAGGAGG + Intergenic
1005497282 6:26398806-26398828 CAGGGAAGATGGGAGGAAGGAGG - Intergenic
1006206009 6:32343538-32343560 CTGAAAAGATGAAAGAAAGAGGG - Intronic
1006681376 6:35798951-35798973 ATGTAAAGGTGAGAGGAAGGGGG - Intergenic
1007260921 6:40562448-40562470 CAGTGAAGAGCAAAGGGAGGGGG + Intronic
1007551382 6:42732602-42732624 CTGTCATGTTGAAAGGAAAGGGG + Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1008422588 6:51319511-51319533 CTCTGAGGATGAGAGGAAGCAGG - Intergenic
1008918612 6:56818283-56818305 CTGTTATCATGAAGGGAAGGAGG + Intronic
1011315839 6:86030195-86030217 CTGGGATGTTCAAAGGAAGGAGG - Intergenic
1012692829 6:102336399-102336421 CTTTGAAGATGGAAGGAAGAGGG - Intergenic
1013281276 6:108639241-108639263 CTTTGCATATGAAAGGAAGCAGG - Intronic
1015113456 6:129619494-129619516 CAGTGAAGGGGAAGGGAAGGGGG + Intronic
1015789433 6:136951535-136951557 CTGTTAAGATGGAGTGAAGGAGG - Intergenic
1018644812 6:165938019-165938041 CTTTGTAGAGGAAAGGAAGTGGG - Intronic
1019029544 6:168998623-168998645 TGGTTAAGACGAAAGGAAGGAGG + Intergenic
1019105625 6:169664818-169664840 GTGTAAAGATGACAGGAAAGGGG + Intronic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1020342866 7:7131467-7131489 CTGTGAAGATTAAATGTGGGAGG - Intergenic
1020503902 7:8959152-8959174 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020504005 7:8960471-8960493 TTGTGAAAATGAAAGGAAATTGG + Intergenic
1020742188 7:12035026-12035048 CAGAGAAGGTGAAAGGAAGATGG + Intergenic
1021121353 7:16799173-16799195 CTGTGAAGAGGAAGGGCCGGAGG + Intronic
1021457504 7:20845556-20845578 CTTTGAAGAAGAAAGGGAGCAGG - Intergenic
1021702466 7:23333107-23333129 CTGTAAAGATAAAACAAAGGAGG + Intronic
1022154122 7:27642100-27642122 GTGTGAAGAAGGAAAGAAGGTGG - Intronic
1022157009 7:27670865-27670887 CTGTGAAGATGAATTGGAAGTGG - Intergenic
1022278103 7:28876257-28876279 CTGAGAAAATGAACGAAAGGAGG + Intergenic
1022672727 7:32471497-32471519 CTGTCATGTTGAAAGGAAAGAGG - Intergenic
1023689710 7:42773167-42773189 CTGCGAAGAGGAGAGGAGGGTGG - Intergenic
1023784682 7:43694138-43694160 CTGAGGAGATGAAAGGAACTGGG - Intronic
1024181191 7:46896952-46896974 CTTTGTAGATGAACAGAAGGTGG - Intergenic
1024908612 7:54419428-54419450 CTGTCATGTTGAAAGGAAAGAGG - Intergenic
1026357864 7:69575180-69575202 CTGAAGAGATGAAAGGCAGGAGG + Intergenic
1026452009 7:70537750-70537772 CCCTGAAGGTGAAATGAAGGAGG + Intronic
1027164631 7:75825628-75825650 CTGACAAGAGGAAGGGAAGGCGG + Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028320313 7:89451289-89451311 CTGGGGAGATGAAGGGAGGGAGG - Intergenic
1029729959 7:102433025-102433047 CAGTGGAGGGGAAAGGAAGGTGG - Intergenic
1030684412 7:112469840-112469862 CTGAGATGAAGAAAAGAAGGTGG - Intronic
1030874229 7:114793376-114793398 CTGTGAGGAAGAAAGGAACAAGG + Intergenic
1031359074 7:120824958-120824980 TTGTAAAGTTGAAAGGAATGAGG - Intronic
1031991853 7:128203560-128203582 CTGTTAGGAGGAAAGGGAGGAGG - Intergenic
1032251844 7:130264479-130264501 CTGGGAAGAACAATGGAAGGGGG - Intergenic
1032403360 7:131638753-131638775 CTGGGAAGAGGAAGGGAAGATGG + Intergenic
1032553375 7:132806315-132806337 CAGTGAAGAAGAAATGGAGGTGG + Intronic
1032999207 7:137484483-137484505 CTGTTAAGAGGAAAGGTATGTGG - Intronic
1033231571 7:139602462-139602484 ATGTCAAAACGAAAGGAAGGAGG + Intronic
1033498088 7:141919727-141919749 GGGTGAAGATGAAAGGATTGAGG - Exonic
1033601890 7:142894344-142894366 CTGGGAGGCTGAGAGGAAGGTGG + Intergenic
1033977174 7:147116531-147116553 CTGGGAAGAAGAATGGATGGGGG + Intronic
1034053480 7:148008460-148008482 ATGAGAAGAGGAAAGGAAGCAGG - Intronic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1035410410 7:158636321-158636343 TTCTGAAGATGAAAGGGAAGAGG - Intronic
1036414503 8:8534687-8534709 CAGTGAAAATGAAAGGAAATGGG - Intergenic
1036515364 8:9438730-9438752 CTGTAAAGGAGAAGGGAAGGTGG + Intergenic
1037144246 8:15554166-15554188 TTGTGATGATACAAGGAAGGTGG - Intronic
1038122821 8:24637215-24637237 AGGAGAAGATGAAAGAAAGGTGG + Intergenic
1038379588 8:27080066-27080088 CTGGAAAGAAGGAAGGAAGGAGG - Intergenic
1038722832 8:30053165-30053187 CTGAGAGGATGAAACGAAGGGGG + Intergenic
1039135373 8:34316762-34316784 CTTTGAAGATGGAGGGAATGTGG - Intergenic
1039263502 8:35799261-35799283 CTGTTAAGATAAAACAAAGGAGG + Intergenic
1039845537 8:41323157-41323179 CTGTGATGGTGAGAGGAAGATGG - Intergenic
1039954526 8:42196852-42196874 ATGAGAAGAAGGAAGGAAGGGGG + Intronic
1041174596 8:55181445-55181467 CTGGAAGGATGAAAGGAAGGAGG - Intronic
1041607674 8:59802327-59802349 CTGTGAAAATGGAAGTTAGGAGG - Intergenic
1041701410 8:60793081-60793103 GCGTGCAGATGAAAGGAAAGGGG + Intronic
1041713431 8:60913125-60913147 CTGGTGAGATGAAAGGAAAGAGG + Intergenic
1041875622 8:62683735-62683757 CTGAGAAGATGGAATGAAAGGGG + Intronic
1042540254 8:69900932-69900954 TAGTGAAGAAGAAAGGAAGAAGG - Intergenic
1042836377 8:73082343-73082365 GTGTGAGGATGATAGGAAAGCGG - Intronic
1043960785 8:86416266-86416288 GTGTGAAGACAAAGGGAAGGAGG + Intronic
1044187219 8:89268447-89268469 CTAAGAAGAAGAAAGGAAGTTGG - Intergenic
1044891412 8:96840182-96840204 CTGTAAATATCAAAGCAAGGTGG + Intronic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045130431 8:99145935-99145957 CTGGGAAGATGTAAAGAAGCTGG - Intronic
1045357743 8:101404462-101404484 ATCTGAAGATGAAAAGAAGATGG - Intergenic
1045523275 8:102921577-102921599 CTGTCAAAAAGAAGGGAAGGAGG - Intronic
1045613488 8:103876636-103876658 CTATGAGGATGAAAGGCATGAGG - Intronic
1046133304 8:109994880-109994902 CTGAGAACATGGAACGAAGGTGG - Intergenic
1047020086 8:120766106-120766128 CTGTGAAAATGACAAGAAGAGGG + Intronic
1047063625 8:121255371-121255393 CTTTGAGGATGGAAGGATGGGGG + Intergenic
1048297762 8:133227284-133227306 CTGTGAAGCTGAAAGTAAGGTGG + Intronic
1048348314 8:133595286-133595308 CTGTGAAGGTGGGAGGAGGGAGG + Intergenic
1048497711 8:134948811-134948833 CAGGGAAGATGAAGAGAAGGAGG - Intergenic
1048630661 8:136238880-136238902 CAATGACAATGAAAGGAAGGGGG - Intergenic
1048777569 8:137964184-137964206 CGGTGAAGATGAAGAGATGGTGG + Intergenic
1049231754 8:141488361-141488383 CAGGGAGGATGAGAGGAAGGAGG - Intergenic
1049350543 8:142162143-142162165 CTGTCAAGGTGGGAGGAAGGGGG - Intergenic
1049499631 8:142955022-142955044 CTGTGAGGGTGTAAGGAAGGGGG - Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050762317 9:9087775-9087797 TTGTGAAAATGAAAGGAATGTGG - Intronic
1052832541 9:33228117-33228139 CTGTGATGATGAAAGCAGAGTGG - Intronic
1052838280 9:33267745-33267767 CTTTGAAGAAGAGAGGAAGTAGG + Intronic
1053136016 9:35650638-35650660 CTGTGGATGTGAAAGGAAGGGGG + Intronic
1053293087 9:36894950-36894972 CTTAGACGAGGAAAGGAAGGCGG - Intronic
1055409513 9:76013961-76013983 CTTTGAAGAAAAAAGGAAGTGGG + Intronic
1055497726 9:76872176-76872198 CTGTGACGATGCTTGGAAGGTGG - Intronic
1055727912 9:79251230-79251252 CTGAGAAGGAGAAAGGATGGTGG - Intergenic
1056323164 9:85455830-85455852 ATGGGAAGATGAAAGGGAGTGGG + Intergenic
1056959808 9:91113172-91113194 CTCTGAAAATGACAGGAAGATGG + Intergenic
1057001652 9:91515475-91515497 TTGATAAGACGAAAGGAAGGAGG - Intergenic
1057951706 9:99374030-99374052 CTTTCAAGCTAAAAGGAAGGAGG - Intergenic
1058721758 9:107770511-107770533 CTCTGAAGAGGAAGAGAAGGAGG - Intergenic
1059043505 9:110840257-110840279 CTGTAAAGCTGAATGTAAGGTGG + Intergenic
1059208964 9:112493423-112493445 CTGGGAAAATGGATGGAAGGTGG - Intronic
1059338612 9:113584394-113584416 CTGTGAAGAAGAGGGAAAGGTGG - Exonic
1059354231 9:113687085-113687107 CAGAGAAGAGGAAAGGAGGGAGG + Intergenic
1059579172 9:115525068-115525090 TTGTGAAGATGATAGGAATAAGG + Intergenic
1059724206 9:116990238-116990260 CTTTTAAGAAGAAAGGAAGGGGG - Intronic
1059915320 9:119093289-119093311 CTGTGGGGATGGAAGGATGGAGG + Intergenic
1060454680 9:123780597-123780619 CATTGAAAATGAAAGGAATGGGG + Intronic
1061264397 9:129496992-129497014 CCAGGAAGAAGAAAGGAAGGAGG + Intergenic
1061850997 9:133415449-133415471 CTGTGAAGATCTCAGGAAGGTGG + Intronic
1062012325 9:134273802-134273824 CTATGCAGATGACAAGAAGGAGG - Intergenic
1186134177 X:6501772-6501794 CCATGAAGAAGAAAGGAAAGAGG - Intergenic
1186216938 X:7310728-7310750 GTGTGAAGATAAAGGGAAGGGGG - Intronic
1186387654 X:9126143-9126165 CCCTGAAGAAGAAAGGGAGGGGG + Intronic
1186397566 X:9225187-9225209 CTGTGAAGGAGAAAGGCATGGGG - Intergenic
1186429880 X:9496206-9496228 CTGAGGAGATGAAAGAGAGGTGG + Intronic
1186848505 X:13555373-13555395 CTTTGGAGATGAGAGGAAGAAGG + Intergenic
1187892783 X:23952817-23952839 CTGTGAAGACAAAAGGAGAGTGG - Intergenic
1188163229 X:26828237-26828259 ATGAGAGGAAGAAAGGAAGGAGG - Intergenic
1189846488 X:45143359-45143381 GTGTTAAGATGAAGGGAAGTTGG - Intergenic
1192273860 X:69610399-69610421 CTAGGATGATGACAGGAAGGTGG + Intergenic
1193704801 X:84808527-84808549 CTGTGAAGAGGAAGGGAACTAGG + Intergenic
1195071617 X:101286396-101286418 CTTTTAAGAGGAAAGGAAGTAGG - Intronic
1195084366 X:101400366-101400388 TAGTGAAGATGGAAGGAAGTGGG + Intronic
1195418610 X:104647676-104647698 TGGTGAAGATGCAAGGAAGCTGG + Intronic
1195468074 X:105203025-105203047 CTGTGAAACTGGAAGCAAGGGGG - Intronic
1195867112 X:109444899-109444921 CTGTGAGGGTGAAACAAAGGTGG + Intronic
1197683897 X:129417543-129417565 CTCTGAAGTGGAAAGGAGGGAGG + Intergenic
1199452400 X:147991286-147991308 CTATGAAGAGGAGATGAAGGAGG - Intronic
1199677947 X:150203572-150203594 ATGTGAAGGTGAAAGGAGTGAGG + Intergenic
1200431191 Y:3084581-3084603 ATTTGAAGTTGAAAGGTAGGAGG - Intergenic