ID: 1141324005

View in Genome Browser
Species Human (GRCh38)
Location 16:83038515-83038537
Sequence CATCATGACCTTCCACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141324005_1141324006 3 Left 1141324005 16:83038515-83038537 CCTGTCTGTGGAAGGTCATGATG 0: 1
1: 0
2: 2
3: 11
4: 144
Right 1141324006 16:83038541-83038563 TTGACACACCAAGTTATGTCTGG 0: 1
1: 0
2: 0
3: 5
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141324005 Original CRISPR CATCATGACCTTCCACAGAC AGG (reversed) Intronic
901300965 1:8199983-8200005 GATCTTGGCCTTCCCCAGACTGG + Intergenic
902688585 1:18095375-18095397 CTTCTTGATCTTCCACAGCCTGG + Intergenic
906242446 1:44250422-44250444 CCCCAAGATCTTCCACAGACTGG + Intronic
908039076 1:60087927-60087949 CATAATGATGTACCACAGACTGG + Intergenic
911417553 1:97594276-97594298 CACTATGACCTTCCTCAGAAAGG + Intronic
918247164 1:182670355-182670377 CTACATGACCTTCCTCAGCCTGG + Intronic
919042303 1:192405811-192405833 CATCATATCCTTCCACAGTGTGG - Intergenic
919760230 1:201093425-201093447 CATAATAACATTCCACAGATTGG - Intronic
919798166 1:201333794-201333816 CATCCTGACCTTCCCCATCCAGG - Intergenic
922507157 1:226133236-226133258 CATCACAACCTTCCCCAGCCTGG + Intergenic
922680788 1:227593557-227593579 CCTCCTGACCCTCCTCAGACTGG - Intronic
922690138 1:227682547-227682569 CCTCCTGACCCTCCTCAGACTGG + Intergenic
924922688 1:248647314-248647336 CAGCATGACATTCAACAGAATGG + Intergenic
1064251254 10:13708061-13708083 CTGCATCACCTTCCACATACTGG + Intronic
1065767579 10:29045448-29045470 CATCTTGCCCTTCCCCAAACAGG + Intergenic
1068671811 10:59730647-59730669 CCTCATGACTCTCCTCAGACTGG - Intronic
1070348332 10:75567246-75567268 CATCAAGGCCTTCCACATTCAGG + Intronic
1076210180 10:128634315-128634337 CTCCATGAACTTCCACAGAGCGG + Intergenic
1079086828 11:17452176-17452198 CATCATCACCTTCTTCAGAGGGG + Intronic
1081508062 11:43738764-43738786 CATCATGACATTCATCACACAGG - Intronic
1081756234 11:45546749-45546771 CATAATGAAATCCCACAGACTGG - Intergenic
1084446796 11:69208589-69208611 AATCATGCTCCTCCACAGACAGG + Intergenic
1085095939 11:73760785-73760807 CAGCAGGACTCTCCACAGACTGG + Exonic
1085439231 11:76543285-76543307 CATAATGACTTTGCACATACAGG - Intronic
1085445503 11:76598229-76598251 CATCTTGCCCTGTCACAGACTGG - Intergenic
1087028997 11:93683213-93683235 CTTCATGACTTTCCTCAGAAAGG + Intronic
1087812069 11:102619172-102619194 CAGCATCAACTTGCACAGACAGG - Intronic
1089812076 11:121140525-121140547 CATAATGAAATACCACAGACTGG + Intronic
1089934491 11:122349771-122349793 CATCATGAACGTCCACAAACAGG + Intergenic
1092561331 12:9616971-9616993 CATAATGAAATGCCACAGACTGG - Intergenic
1092571136 12:9722764-9722786 AATCATGTCCTGCCAAAGACTGG - Exonic
1093926540 12:24913863-24913885 CTTTATGGCCTTACACAGACAGG + Intronic
1094649076 12:32357556-32357578 CATCATGAATGACCACAGACTGG + Intronic
1102780788 12:115562748-115562770 CATCATGACCTTGAGCAGCCTGG - Intergenic
1104975917 12:132551951-132551973 CCTGATGGGCTTCCACAGACGGG - Intronic
1106467815 13:30028452-30028474 CACCTTGGCCTTCCACAAACTGG - Intergenic
1108464151 13:50697445-50697467 CACCATGTCCTTCCTCAGATGGG + Intronic
1113316287 13:109182982-109183004 CATCATGGAATTCCACACACTGG + Intronic
1114215119 14:20652150-20652172 CATCATAAAATACCACAGACAGG + Intergenic
1118297638 14:64585133-64585155 CATCCTGAACTCCCACAGTCTGG - Intronic
1118817732 14:69324737-69324759 CATCATCACCTTCCACAATGAGG + Exonic
1119619511 14:76121420-76121442 CCTCATGGCCTTCCAAAGAAAGG - Intergenic
1119781678 14:77280151-77280173 GATGGTCACCTTCCACAGACAGG + Intronic
1125724340 15:41860714-41860736 CATCTTGTGCTTCCACAGAAGGG + Exonic
1130017162 15:80196479-80196501 CCTCATGACCAGCCACAGAAGGG + Intergenic
1130765646 15:86868086-86868108 CATCCTGACCTCTCACAGACCGG - Intronic
1130883970 15:88078124-88078146 CATCATGTCCTTGAACAGATGGG + Intronic
1131969933 15:97881725-97881747 CTTCCTGTCCTTCCCCAGACAGG - Intergenic
1132421311 15:101672479-101672501 CATCATCACCTCCAACATACGGG + Intronic
1133707352 16:8367596-8367618 CATTCTAACCCTCCACAGACAGG + Intergenic
1134280507 16:12812738-12812760 CATCCAGACCTTCAACTGACTGG - Intergenic
1135168366 16:20160674-20160696 AATCAGGGCCTTCCACAGAGAGG - Intergenic
1136739748 16:32506716-32506738 CATAATGTCCTTTCACAGAATGG + Intergenic
1137668881 16:50267670-50267692 AAACATGTCCTTCCACACACAGG - Intronic
1140330408 16:74051026-74051048 CATCATTACCTTCCTCAGCCAGG - Intergenic
1140732859 16:77872079-77872101 CATCATCCCCTTCCACAGTTGGG + Intronic
1141324005 16:83038515-83038537 CATCATGACCTTCCACAGACAGG - Intronic
1203013167 16_KI270728v1_random:320621-320643 CATAATGTCCTTTCACAGAATGG - Intergenic
1203031502 16_KI270728v1_random:593780-593802 CATAATGTCCTTTCACAGAATGG - Intergenic
1203040219 16_KI270728v1_random:740651-740673 CATAATGTCCTTTCACAGAATGG + Intergenic
1145119024 17:20239507-20239529 CAACATGACCTTCCATAGGAAGG + Intronic
1148053821 17:44781861-44781883 CAGCATGGCCATTCACAGACAGG - Intergenic
1154348844 18:13566259-13566281 CAGACTGACCTTCCAGAGACAGG - Intronic
1157244362 18:46040450-46040472 CATGTTGACCTTCGACAGACTGG + Intronic
1157547632 18:48557649-48557671 CATAATGAAACTCCACAGACTGG + Intronic
1158575585 18:58634776-58634798 CATCATTACCTGCCACACACTGG + Intergenic
1158617817 18:59004284-59004306 CATAATGAAGTACCACAGACGGG - Intergenic
1160299123 18:77663605-77663627 CAGCATGACCTTCCAGTGCCCGG + Intergenic
1160517881 18:79488479-79488501 CATCATGAACCTCCAGAGAGTGG - Intronic
1163131103 19:15273501-15273523 CATCATCCCCTTCCACACACAGG - Intronic
1165808252 19:38595418-38595440 CATCATGACATTCATCAGATGGG - Intronic
927951570 2:27173408-27173430 CGTCATGACCCTCCACTGTCTGG - Intergenic
928399282 2:30966235-30966257 CATCATCACCTTCCACAACGAGG - Exonic
928742610 2:34372810-34372832 TATCATGAGCTTCCTCAGACTGG - Intergenic
929575686 2:43050331-43050353 CAGGATGGGCTTCCACAGACAGG + Intergenic
929833833 2:45375699-45375721 CATAATGAAGTTCCACAAACTGG + Intergenic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
935628755 2:105194485-105194507 CATCAAGACCCTCCACTGAGAGG - Intergenic
938444086 2:131363870-131363892 CAGCAGGACTCTCCACAGACTGG + Intergenic
939402186 2:141708971-141708993 CATAATGATATGCCACAGACTGG - Intronic
939690449 2:145253942-145253964 CTTCCTGGCCTTCCACAGAATGG + Intergenic
942505970 2:176641995-176642017 CATCATGTTTTTCCACAGAGGGG - Intergenic
943224008 2:185145088-185145110 CTACAAGACCTTCCACAGGCAGG - Intergenic
947449894 2:230198158-230198180 CAGCATGACCTACCACATAGAGG - Intronic
1170388947 20:15851316-15851338 CATCATAAAGTACCACAGACTGG + Intronic
1172265348 20:33607511-33607533 CATAATGAAATACCACAGACTGG + Intronic
1172595502 20:36148528-36148550 TCTCAAGACCTTCCACAGCCTGG - Intronic
1174338726 20:49882962-49882984 CACCAGGACCTTCCCCAGACAGG - Intronic
1174377817 20:50138241-50138263 CATCCTGACCTTCCAGAGGAGGG + Intronic
1174608893 20:51782650-51782672 CGTCAGGACCTTCCACATAGAGG + Intergenic
1178063946 21:28882946-28882968 CATCTAGATCTTCCACTGACAGG - Intronic
1178661838 21:34513407-34513429 GACCATAACCTACCACAGACAGG + Intronic
1178760294 21:35395941-35395963 CATCTTGAGCTTTGACAGACAGG + Intronic
1184954015 22:47870002-47870024 CTTCATGACCTTCAATAGGCAGG - Intergenic
950917978 3:16664941-16664963 CATCATGAGCTCCCACTCACTGG + Intronic
951116783 3:18872537-18872559 CATCATGACCTTCCAATTTCTGG - Intergenic
952291461 3:32020853-32020875 CATAATGAAATACCACAGACTGG + Intronic
958758018 3:98273580-98273602 CCTCATGCCCTAGCACAGACAGG + Intergenic
959175817 3:102908864-102908886 CATAATGAAGTACCACAGACTGG + Intergenic
960258385 3:115535531-115535553 CAGCATGAGCTTCCTCAGAGAGG + Intergenic
962934461 3:140067032-140067054 CATCATGAGATCACACAGACTGG - Intronic
963973907 3:151459815-151459837 CATCATGCTGTTCCACAGAACGG - Intergenic
965581525 3:170273319-170273341 CATTCTGACCATGCACAGACAGG + Exonic
966157428 3:176932208-176932230 CACCACCATCTTCCACAGACTGG + Intergenic
966608803 3:181847924-181847946 CATTAGGAACATCCACAGACTGG - Intergenic
966931352 3:184677791-184677813 CCTCCTGCCCCTCCACAGACCGG + Intronic
966996501 3:185285757-185285779 AATCAGGACCTTCCAAAGAGAGG + Intronic
967764731 3:193266488-193266510 CATCAGAACCTGCCAGAGACAGG - Intronic
968259541 3:197308742-197308764 CATCACTTACTTCCACAGACAGG + Intergenic
968273198 3:197420673-197420695 CGTCATGTTCCTCCACAGACAGG - Intergenic
970131406 4:12875721-12875743 CATAATAATGTTCCACAGACTGG - Intergenic
970845769 4:20535557-20535579 CATAATGAGCTTCCACAGACTGG + Intronic
972635178 4:40877863-40877885 TATCATGACCTGCCACACCCCGG + Intronic
974225687 4:59039766-59039788 CATGATAAACTACCACAGACTGG - Intergenic
978914721 4:114109943-114109965 CATCATGCCCAGCCACACACTGG + Intergenic
979474159 4:121135123-121135145 CACCATGTCCTGTCACAGACTGG + Intronic
980438810 4:132814913-132814935 CATCCTGACTCTCCTCAGACTGG - Intergenic
984760766 4:183360801-183360823 CACCATGAAATACCACAGACGGG - Intergenic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
988713978 5:33806410-33806432 CACCATTCCATTCCACAGACTGG - Intronic
999150710 5:149424267-149424289 CAACATCACCTTTCACAGAAGGG + Intergenic
999534286 5:152500389-152500411 CATTATTACCTTCCAGGGACAGG + Intergenic
1000286061 5:159827052-159827074 CATAATGAAGTACCACAGACTGG + Intergenic
1002339385 5:178504997-178505019 CATAACGAAGTTCCACAGACCGG + Intronic
1005104322 6:22206894-22206916 CATCATAAAATACCACAGACTGG - Intergenic
1009360727 6:62809032-62809054 GATCATGGCCTTCAACAGAGAGG + Intergenic
1009635755 6:66262521-66262543 CTTCCTGACTTTCCTCAGACTGG + Intergenic
1014905058 6:127015906-127015928 CATAATGAAATACCACAGACAGG + Intergenic
1017969251 6:159297130-159297152 GATCATGACCTTACAAAGAATGG + Intergenic
1017994395 6:159520008-159520030 CATCAAGATCTTCCAGAGAATGG - Intergenic
1018678031 6:166240344-166240366 CAACATGACCCTCTACTGACTGG - Intergenic
1018887079 6:167948796-167948818 CACCATGAGCTCCCACAGGCAGG - Intronic
1018912856 6:168113437-168113459 CATCATGACCTTCCACACAGTGG - Intergenic
1020501709 7:8931155-8931177 CATAATGAAATTCCACAGACTGG - Intergenic
1022927562 7:35071481-35071503 CATCATCAAGTACCACAGACAGG - Intergenic
1023039756 7:36161705-36161727 CAAAATGACCTTCCCCAGCCTGG + Intronic
1023040245 7:36166908-36166930 CATAATGAAGTCCCACAGACTGG + Intronic
1030980403 7:116179384-116179406 CATAATGAAGTACCACAGACTGG + Intergenic
1033146324 7:138873431-138873453 GATCATGAGCTTCTCCAGACAGG + Intronic
1033620351 7:143056940-143056962 CATCAAGACCCTGCACAGATGGG + Intergenic
1034960149 7:155359800-155359822 CAGAATGACGTCCCACAGACTGG + Intronic
1035116744 7:156531288-156531310 CATAATGAAGTTCCATAGACTGG + Intergenic
1037129423 8:15389755-15389777 CATAATGAAATACCACAGACTGG + Intergenic
1038057553 8:23874898-23874920 CACCATGGCCTTCCACTGATTGG + Intergenic
1041828287 8:62123334-62123356 CTTAATGAAGTTCCACAGACTGG + Intergenic
1043544249 8:81297296-81297318 CATCATGACCCTGAACAAACTGG - Intergenic
1046314710 8:112483979-112484001 CACCTTGACCTTCAACAGCCAGG - Intronic
1047293920 8:123554402-123554424 CAGAATGACCTTCTAAAGACCGG + Intergenic
1052138680 9:24949262-24949284 CACAATGAAGTTCCACAGACAGG + Intergenic
1055772143 9:79728893-79728915 CATCATGACCTTCCTAAGATTGG + Intergenic
1056555192 9:87682237-87682259 CTTCCGGGCCTTCCACAGACAGG + Intronic
1057796350 9:98160735-98160757 CATCACCAGCTGCCACAGACAGG - Intronic
1060885589 9:127149835-127149857 CATCATGACCTTCTTCATCCAGG - Intronic
1060907254 9:127317827-127317849 CAGCATGGCCTTCAACATACAGG - Intronic
1189568465 X:42269821-42269843 AATGATGACCTTCTGCAGACTGG + Intergenic
1190630290 X:52379487-52379509 CATCAAAAACTACCACAGACTGG - Intergenic
1190817616 X:53942193-53942215 ATTCATGATCTTCCACAGTCTGG + Intronic
1197414024 X:126151989-126152011 CATCATGAAATACCACAGACTGG + Intergenic