ID: 1141324061

View in Genome Browser
Species Human (GRCh38)
Location 16:83039103-83039125
Sequence CTCCGTGGGAACCTGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 221}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141324061_1141324069 9 Left 1141324061 16:83039103-83039125 CCATGGCCCAGGTTCCCACGGAG 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1141324069 16:83039135-83039157 GGCCACAGGCTATATACGCTTGG 0: 1
1: 0
2: 1
3: 2
4: 44
1141324061_1141324068 -5 Left 1141324061 16:83039103-83039125 CCATGGCCCAGGTTCCCACGGAG 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1141324068 16:83039121-83039143 CGGAGAGTTATGAGGGCCACAGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141324061 Original CRISPR CTCCGTGGGAACCTGGGCCA TGG (reversed) Intronic
900121615 1:1050741-1050763 CACCCTGGGAGCCTGGACCAGGG + Exonic
900297552 1:1959592-1959614 TGCCGTGGCTACCTGGGCCAGGG + Intronic
900329535 1:2127125-2127147 CTCAGTGGGAGCCTGGGCTGTGG + Intronic
900356617 1:2268122-2268144 CCCAGGGGGCACCTGGGCCAGGG - Intronic
900387361 1:2416702-2416724 CTCCGTGGGAAACAGTGCCTGGG + Intergenic
900477964 1:2884868-2884890 CTTCCTGGGAGCCTGGCCCAGGG - Intergenic
901522938 1:9799262-9799284 CTCCATGGGAACCGGTGCCAGGG + Intronic
902424451 1:16308852-16308874 CTACTTGGGAACCTGAGGCAGGG - Intronic
902628084 1:17688489-17688511 CTCTGGGGGAAGCTGGGCCAAGG - Intronic
903659366 1:24967330-24967352 CTCCCTGGGAACCTGAGTCCAGG + Intergenic
904267482 1:29326048-29326070 CTGAGTGGGAACCTTGGCCTGGG - Intronic
904593156 1:31626582-31626604 CTCCTTGGGAACCCGCTCCAGGG + Intronic
904854410 1:33486346-33486368 CTCTGTGGGAACCAGTTCCAGGG - Intronic
905866058 1:41377421-41377443 CTCCTTCAGAACCTGGGCCAGGG - Intronic
906108264 1:43307379-43307401 CTCTGTGGGCCCCTGGGCCCAGG - Intronic
907271496 1:53294084-53294106 CACCCTGGGAACCAGAGCCAAGG - Intronic
907280343 1:53343147-53343169 CTCCCTAGAAACCTGGGGCAGGG - Intergenic
912856248 1:113170982-113171004 CTCAGTGGGCGCCAGGGCCATGG - Intergenic
913028694 1:114874107-114874129 CTCTGTGGGAACCAGAGTCAGGG - Intronic
913089636 1:115467901-115467923 TTCCCTGGGGACCTGGGGCAGGG - Intergenic
915171811 1:153983317-153983339 CTCAATGGGAACATGGTCCAAGG - Intronic
915714343 1:157930485-157930507 CTCCATGGGAGCCTGGGGCTGGG - Intergenic
916603849 1:166321769-166321791 CTCTCTGGGAACCAGTGCCAGGG - Intergenic
916800308 1:168209759-168209781 CTCCGTGGGCACTAGTGCCAGGG + Intergenic
917645265 1:177023461-177023483 CTCCAGCGGACCCTGGGCCATGG - Exonic
917656061 1:177126832-177126854 TTTCTAGGGAACCTGGGCCAAGG + Intronic
920166753 1:204041525-204041547 CCTCCTGGGGACCTGGGCCAGGG + Intergenic
921605239 1:217144580-217144602 CTCTGTAGGAACCAGTGCCAGGG + Intergenic
922756559 1:228100222-228100244 CAATGTGGGAACCTGGGGCAGGG - Intergenic
924862262 1:247936976-247936998 ACAAGTGGGAACCTGGGCCAAGG - Intergenic
1062971594 10:1653119-1653141 CTCCGTGGGAAGGTGGCCCTTGG - Intronic
1063110660 10:3034063-3034085 CTCCCTGGGCTCGTGGGCCATGG - Intergenic
1063371423 10:5525201-5525223 CTCCGTGGGGTTCTGGCCCAGGG - Exonic
1064018609 10:11791769-11791791 CTTCTTGGGAACCTGGGGAAGGG + Intergenic
1066041677 10:31554448-31554470 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1067549651 10:47225537-47225559 CTCAGAGGGAACCTGAGCAAAGG - Intergenic
1070288524 10:75100245-75100267 CTCCGAGGGGACCTAGGCCCAGG + Intronic
1072409520 10:95187126-95187148 CTCCATAGGTATCTGGGCCATGG - Intergenic
1073242853 10:102069438-102069460 CTCAGTGGGCCCCTGGGGCATGG + Intergenic
1075430293 10:122374755-122374777 CTCTGTGGGAGCCGGGGCCGCGG + Exonic
1075461634 10:122620426-122620448 CTCCCTGGGAACCTAGTCCTGGG + Intronic
1076685564 10:132197058-132197080 CTCAGCGTGCACCTGGGCCAAGG - Exonic
1076871634 10:133197634-133197656 CTCCGTGGTCACCTGGCCCAGGG + Intronic
1077254281 11:1573434-1573456 CTCAGTGGGCACCAGGACCACGG + Intergenic
1077339294 11:2018830-2018852 ATCCGAGGGGACCTGGGCGAAGG - Intergenic
1077376962 11:2209622-2209644 CCCCCTGGGAAGCAGGGCCAGGG - Intergenic
1077532722 11:3104704-3104726 CATCGTGGGACCCTGGGCCCAGG + Intronic
1078108912 11:8376204-8376226 ATCCTTGGGAACCTGGGTCCTGG + Intergenic
1078595760 11:12685119-12685141 CTTTGTGTGAGCCTGGGCCAGGG + Intronic
1080898674 11:36467180-36467202 CTCTGTGGGAGTCTAGGCCATGG - Intergenic
1081564172 11:44246979-44247001 CTCAGTGTGCACTTGGGCCAGGG - Intergenic
1082783555 11:57304198-57304220 CCCAGTGGGAACCTGGGGCCTGG - Intronic
1084459265 11:69287077-69287099 CTCTGTGGGAACCTGGGCCCGGG - Intergenic
1084494700 11:69497195-69497217 TTCAATGGGAACCTGGGGCAGGG - Intergenic
1086199129 11:84179438-84179460 CTCTTTGGGAACCAGTGCCAGGG + Intronic
1089688755 11:120173129-120173151 CTCTGTGTGAACCTAGTCCAGGG + Intronic
1090009477 11:123033487-123033509 CTACTTGGGAACCTGAGGCAGGG + Intergenic
1090682157 11:129072626-129072648 CTCTGTGGGAACCAGTGCTAGGG + Intronic
1202822278 11_KI270721v1_random:74012-74034 ATCCGAGGGGACCTGGGCGAAGG - Intergenic
1091704848 12:2686741-2686763 ATCCGTGGGAAGCAGGTCCAGGG + Intronic
1091802593 12:3334008-3334030 GTCCCTGGGAAGCTGGTCCACGG + Intergenic
1092529273 12:9331341-9331363 CTCCGTGGGCACCAGGGACATGG - Intergenic
1095566403 12:43628884-43628906 CTCTGAGGGAACCAGTGCCAGGG - Intergenic
1096154884 12:49336345-49336367 CGCCGTCGGGACCAGGGCCACGG + Exonic
1096406664 12:51348721-51348743 CTCCTTGGGAAGCTGTGGCAGGG + Intergenic
1102557947 12:113741234-113741256 CTCCCTGGGAACCTGGCTCAGGG - Intergenic
1103362464 12:120362075-120362097 CTCGGTGGGCACCTGGGTCCGGG - Intronic
1103596115 12:122025109-122025131 CTTTTTGGGAAACTGGGCCAGGG + Intronic
1104894243 12:132153971-132153993 CTCCTTGGGCTCCTGGGGCAGGG + Intergenic
1106562106 13:30855759-30855781 CTCTGTGAGTACCTGGGCCACGG + Intergenic
1108408154 13:50124804-50124826 CTGCGTGGGCACCAGAGCCAGGG + Intronic
1109597432 13:64574711-64574733 CTTCATGGGAACCAGTGCCAGGG - Intergenic
1115576330 14:34714959-34714981 CTCCGTAGGGCCCTGCGCCAGGG + Intergenic
1115914690 14:38298972-38298994 CTCTGTGGGAACTAGTGCCAGGG + Intergenic
1117409832 14:55440578-55440600 CTCTGCAGGAACCTGGGCCGAGG - Exonic
1118604269 14:67491618-67491640 CTTTGTGGGCACCTGGGTCAGGG - Intronic
1119499063 14:75107444-75107466 CTCCATGGTCAGCTGGGCCATGG - Exonic
1120392211 14:83923827-83923849 CACGGTAGGAACGTGGGCCACGG - Intergenic
1120950131 14:90033291-90033313 CTCAGTGGGATCCTGGCTCATGG + Intronic
1121786198 14:96663083-96663105 CTCCGCGGGAATCCGGGCCACGG - Intergenic
1122027773 14:98889969-98889991 CTCCGGGGCTACCCGGGCCAGGG - Intergenic
1122029968 14:98905085-98905107 CTGGGTGGGCAACTGGGCCAAGG + Intergenic
1122213405 14:100187750-100187772 CACCGTGTGAACCTCTGCCAAGG - Intergenic
1122389654 14:101371434-101371456 CCCAGTGGAAACCTAGGCCATGG + Intergenic
1122525134 14:102376703-102376725 GTCTGTGGAAACCTTGGCCATGG + Exonic
1123035841 14:105471609-105471631 CTCCGTGGGAGCCTGTGCTGGGG + Intergenic
1123047814 14:105527086-105527108 CTCCGTAGGGACCTGGCCCCAGG - Intronic
1202865570 14_GL000225v1_random:114945-114967 CCCCGTGGAAGCCTGGGGCAGGG - Intergenic
1123931338 15:25173129-25173151 CTCCTTGGGAATCTGACCCAAGG + Intergenic
1123933881 15:25184818-25184840 CTCCTTGGGAATCTGACCCAAGG + Intergenic
1124175052 15:27416695-27416717 CTCTGTGGGAACCAGTGCCAGGG - Intronic
1124609803 15:31200771-31200793 CTCCTTGACAAGCTGGGCCATGG - Intergenic
1125631625 15:41151925-41151947 CTCCGTGGGCTCCTGTGCCGCGG + Intergenic
1127661458 15:61103547-61103569 CTCTGTGGGCACCAGGGACAAGG - Intronic
1128114319 15:65095836-65095858 CTCTGGGAGAACCAGGGCCAGGG + Intronic
1128706783 15:69842563-69842585 CTCCCTGGGAAGCTGGCACAGGG - Intergenic
1128749376 15:70138086-70138108 CTCCTTAGGCAGCTGGGCCATGG - Intergenic
1130581852 15:85144688-85144710 CACCATGGGAACCAGTGCCAGGG + Intergenic
1131919629 15:97310003-97310025 CTCCATGGGAACATGTGCCTGGG - Intergenic
1133099666 16:3471559-3471581 CTCCGTGGATGCCTGGGGCAGGG - Intronic
1133805702 16:9124644-9124666 CTACGAGGGAAGCTGGACCAAGG + Intergenic
1134169924 16:11960465-11960487 CTACGTGGGAGCCTGAGGCAGGG - Intronic
1137576773 16:49605128-49605150 CTCGGTGGGAACCTGGGAGCTGG - Intronic
1138441496 16:57037611-57037633 CTCCCTGGGAGACTAGGCCAAGG + Intronic
1139516056 16:67453026-67453048 CTCCCTGAGACCCAGGGCCATGG + Intronic
1141324061 16:83039103-83039125 CTCCGTGGGAACCTGGGCCATGG - Intronic
1141478754 16:84292304-84292326 CTCAAATGGAACCTGGGCCAAGG + Intergenic
1142204499 16:88776492-88776514 CTCCAAGGGAAGCTGGGCCCCGG - Intronic
1142305279 16:89281019-89281041 CTCCGCGGGAACCGGGGGCAGGG + Exonic
1143166429 17:4899373-4899395 CTCCAGGAGAACCTGGGGCAGGG + Exonic
1143628786 17:8125474-8125496 CTCCTTGGGAACCTGGGCTCGGG + Intergenic
1144639611 17:16930330-16930352 CTGCGTGGGAGACTGGTCCAGGG - Intronic
1144858616 17:18285418-18285440 CTCCCTGGGCACCTGGGCATGGG - Exonic
1146186508 17:30727824-30727846 CGCAGAGGGAACCAGGGCCAGGG + Intergenic
1147448854 17:40491509-40491531 CTCCTTGGGAACCTGCTCCAAGG + Intronic
1151608123 17:75153461-75153483 CTGCAAGGGAACCAGGGCCAGGG + Intronic
1152600050 17:81257757-81257779 CTCCGTGGGAAAATGAGGCAGGG - Intronic
1155113262 18:22737361-22737383 CTCCGTGGGAAGCAGTGCCAAGG + Intergenic
1156460848 18:37320564-37320586 CTCTGTGGGAACTTGGGCTGGGG + Intronic
1159655705 18:71028627-71028649 CTCTGTGGAAGCCAGGGCCAGGG - Intergenic
1160056088 18:75482344-75482366 CTCCATGGGAACCAGAGCCCAGG + Intergenic
1160375401 18:78407627-78407649 CTCCTTGGAAACCTTGCCCAGGG - Intergenic
1160537919 18:79604778-79604800 CCCCAGGGGAACCTGGGCCGTGG + Intergenic
1160753075 19:743944-743966 CTCCTTGGCAGCCTGGGCCACGG - Intronic
1161294541 19:3513068-3513090 CTGGGAGGGCACCTGGGCCAGGG + Intronic
1162972334 19:14188233-14188255 CGCAGAGGGAACCAGGGCCAGGG - Intronic
1163023241 19:14495111-14495133 CCCCCTGGCAACCTGGGCCGAGG - Intronic
1163528891 19:17838044-17838066 CAGCATGAGAACCTGGGCCATGG - Exonic
1165460784 19:35943109-35943131 CTCCGTGGCCGCCTGGGGCAGGG - Intronic
1165749889 19:38253246-38253268 CTCTGTGGGAACTAGAGCCAAGG - Intronic
1165953695 19:39488983-39489005 CTCCCTGGGCACGTGGCCCAAGG + Intronic
1166720336 19:44992716-44992738 TGCTGTGGGAACCTCGGCCACGG - Exonic
1167072857 19:47230773-47230795 CCGCGAGGGACCCTGGGCCAGGG - Intronic
1167525134 19:49978958-49978980 CTCCCTGGGAAGCTGGGCCCTGG + Intronic
1167648138 19:50716789-50716811 CCCCGGGGGACCCGGGGCCAGGG - Exonic
1168406153 19:56111663-56111685 CACCGTGGCGACCTGGGACAGGG + Intronic
928490330 2:31777408-31777430 CTCCAAGGGAACCAGTGCCAGGG + Intergenic
929954845 2:46449124-46449146 CTCTGTGTGATCTTGGGCCATGG + Intronic
930036452 2:47088477-47088499 CTCAGTGGGAGCCTGGGCATGGG + Intronic
931823940 2:65979817-65979839 CTCCTTTAGAGCCTGGGCCAGGG + Intergenic
932471275 2:71961048-71961070 CTCCAAGGGAACCAGGGCCAGGG - Intergenic
932892499 2:75609150-75609172 CTCAGTGGTAACCTCAGCCAGGG - Intergenic
933252298 2:80042616-80042638 CTCTGTGGGAAAATGGACCATGG + Intronic
933354678 2:81196743-81196765 CTCCACGGGAACCGGGGGCAGGG + Intergenic
934495027 2:94789145-94789167 ATCAGTGGGAACCTGGTCCTGGG - Intergenic
934913178 2:98277378-98277400 CTCCCTGGGAGCCTGGTCTAGGG + Intronic
937264598 2:120607940-120607962 TTCTTGGGGAACCTGGGCCAGGG + Intergenic
937311544 2:120906094-120906116 CTACTTGGGGAGCTGGGCCAGGG + Intronic
937993580 2:127677276-127677298 CTCCATGAGAGCCTGGTCCATGG - Intronic
938128662 2:128692637-128692659 CTCCGTGGGACCTGGGGACAAGG - Intergenic
942450067 2:176103700-176103722 CTCTGCGGGAACCCGGGCTATGG - Intergenic
944413635 2:199463688-199463710 CCCGGTGGTACCCTGGGCCAGGG - Intronic
947837008 2:233183183-233183205 CTCCCTGGTCACCTAGGCCAAGG - Intronic
948197578 2:236106951-236106973 CAACGTGGGAAGCTGGGCCAAGG + Intronic
948467793 2:238160422-238160444 CTCCGTGGAAACATGGGGCGAGG - Intronic
948595445 2:239076621-239076643 CTCCGTGGGAACTGGGCTCAGGG + Intronic
948878077 2:240840806-240840828 TTCTGTGGGCACCTGGGCCTGGG - Intergenic
1168931391 20:1627167-1627189 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1168935558 20:1662211-1662233 CTCTGTGGGAACCAGTGCCGGGG + Intergenic
1169488971 20:6055627-6055649 CTCCCAGGGAGCCTGGGCCCAGG + Intergenic
1170728016 20:18947192-18947214 CTCCGTGGGTGCCTGGGTGAAGG + Intergenic
1171838527 20:30180416-30180438 CTACGTAGGAACCCTGGCCATGG + Intergenic
1172169251 20:32918925-32918947 CTCCCTCTGCACCTGGGCCAAGG - Intronic
1172530260 20:35626229-35626251 CTCCAAGGGAACCTAGGCCTGGG + Exonic
1172867110 20:38108758-38108780 CACAGTGGGCCCCTGGGCCAAGG - Intronic
1172939700 20:38645937-38645959 CCCTGTGGGACGCTGGGCCAGGG + Intronic
1172977498 20:38918023-38918045 CTCCCTGGGTATCGGGGCCAGGG - Intronic
1174078777 20:47956538-47956560 CATCGAGGGAACCTGGGCCAGGG + Intergenic
1174834793 20:53846772-53846794 CTCCGTGGGAACCGGTGCCAGGG - Intergenic
1175824850 20:61931253-61931275 CTCCGTGAGAACCTGGAGCCTGG - Intronic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1178890974 21:36520933-36520955 CCCCGTGGGGACCTAGTCCAAGG + Intronic
1178891789 21:36526039-36526061 CTCTGTAGGAACCTGGGTGAAGG - Intronic
1179204431 21:39261112-39261134 CTACGTGGGAAGCTGAGGCAGGG + Intronic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1179456938 21:41506902-41506924 CTCCGTGCGAACCTGTGCAGTGG - Intronic
1179496347 21:41773818-41773840 CTACGTGGGAAGCTGAGGCAAGG - Intergenic
1179819977 21:43930941-43930963 CTACGTGAGATCCTGGGGCAGGG + Intronic
1180622503 22:17171563-17171585 CTCCGAGGGCACCCGGGCCGGGG + Intergenic
1181037057 22:20174770-20174792 CTCCCTGGGAAACAGGACCAGGG - Intergenic
1181052817 22:20245795-20245817 CTCCGTGAGAACTGGGGCCAGGG - Intronic
1182285019 22:29241192-29241214 CTCCAGAGGAACCAGGGCCAGGG - Intronic
1184383990 22:44163938-44163960 TCCCGGGGGAACCTGAGCCAGGG - Intronic
1184461533 22:44640549-44640571 TCCCGTGGGAGCCAGGGCCAGGG + Intergenic
1184643603 22:45884756-45884778 CCTCGTGGGAACCAGGGCAAGGG + Intergenic
1185389079 22:50549167-50549189 CTCCTCGGGCACCTGGGTCAGGG - Exonic
950576649 3:13836245-13836267 GTCCCTAGGAACTTGGGCCATGG + Intronic
960935704 3:122900145-122900167 TTCCTGGGGAACCAGGGCCATGG + Intergenic
961040560 3:123675282-123675304 CTCCTGGGAAACCTGGGGCAGGG + Intronic
962677978 3:137770391-137770413 CTCTGCGGGACCCAGGGCCAGGG - Intergenic
963067570 3:141275446-141275468 CTCCCTTGGAGTCTGGGCCAGGG - Intronic
967871863 3:194236462-194236484 AACTGTGGGAACCAGGGCCAGGG + Intergenic
969271463 4:6106079-6106101 ATCCATGGGAACGTGGGCCCAGG - Intronic
973547265 4:51994590-51994612 TTCCCTGGTGACCTGGGCCAGGG + Exonic
978091680 4:104725297-104725319 CTCTGTTGGAACTTTGGCCAAGG - Intergenic
982088756 4:151862284-151862306 CACCCTGGGAACATAGGCCAGGG - Intergenic
984321222 4:178198894-178198916 CTCTGTGGGAACCAGTGCCTTGG + Intergenic
984480437 4:180294220-180294242 ATCCTTGGGCACCCGGGCCAAGG - Intergenic
985642266 5:1069248-1069270 CTCCATGGGATCCTGGCCCTAGG + Intronic
985816457 5:2131637-2131659 CTCCTTGGGAACAAGGGCCAGGG - Intergenic
986115606 5:4770882-4770904 CTCAATGGGAACCTGGGGCATGG - Intergenic
992784131 5:80154134-80154156 CTCTCTGTGAACCTGGGGCATGG + Intronic
992877054 5:81066886-81066908 CTCTTTGGGAACTTGGGCCATGG - Intronic
993389221 5:87297894-87297916 TTCCTTGGGAACCAGTGCCAGGG - Intronic
995024027 5:107398314-107398336 CTCTGTGGGAACCTGGAAGAGGG - Intronic
997184674 5:131869807-131869829 CTCCATGGGAACCATTGCCAGGG - Intronic
997190943 5:131934943-131934965 CTACCTGGGAACCTGAGGCAGGG + Intronic
997368876 5:133343381-133343403 CTCCCTGGGAGGCTGGCCCACGG + Intronic
999189931 5:149739701-149739723 GGCCGTGGGACCCTGGGGCAAGG + Intronic
1001589002 5:172852880-172852902 CTTTGTGGGAACCTGCGTCAAGG - Intronic
1003035929 6:2640156-2640178 CTCCCTGGGAGCCTGGGAAAAGG + Intergenic
1003192570 6:3887477-3887499 TTCCCTGGGAACCTGGGCCACGG - Intergenic
1003551562 6:7106682-7106704 CTCCGTGATAACTTGGGGCAAGG + Intergenic
1004176794 6:13347155-13347177 CTCCGTGGCAACCTGGACCATGG + Intergenic
1007194974 6:40052539-40052561 CACCGTGGTAAGCTGGCCCAGGG - Intergenic
1007819668 6:44551958-44551980 CCCCCTTGGAACCTGTGCCAGGG + Intergenic
1009477237 6:64108275-64108297 CTCCGTGAGAACCAGTCCCAGGG - Intronic
1010378856 6:75204941-75204963 CTCCCTGGGACTCTGGGCCAGGG - Intronic
1012509013 6:99981456-99981478 CTCTGTGGGAATCTGGCCAATGG + Intronic
1016340926 6:143060828-143060850 CGCCGTGGGAACCCGGGCGCGGG - Intronic
1017719880 6:157236618-157236640 TTCCGTGGGGTCCGGGGCCAGGG + Intergenic
1017844328 6:158242894-158242916 CTACTTGGGAAGCTGGGGCAAGG - Intronic
1018064740 6:160117102-160117124 TTCCTAGGGAACCTGGGCCAGGG - Intergenic
1018645982 6:165948853-165948875 CTCACTGGGACTCTGGGCCAAGG - Intronic
1019171567 6:170136082-170136104 CTATGTGGGAACCAGGCCCACGG + Intergenic
1019611072 7:1936925-1936947 CTGCGTGTGTGCCTGGGCCATGG - Intronic
1020643112 7:10780094-10780116 TTCAGTGGGAACCTGGGAGAGGG - Intergenic
1023412650 7:39903046-39903068 CTCCATGGGAACCAGTGCCAGGG + Intergenic
1024170305 7:46778182-46778204 CTCTTTGGGTACCTGAGCCAAGG + Intergenic
1024765028 7:52647687-52647709 CTCAGTGGGAAACTTGCCCAGGG - Intergenic
1028600209 7:92592711-92592733 CTCTGAGGGAAGCTGGCCCAGGG - Intergenic
1034434378 7:151056220-151056242 CTCCCCTGGAACCTGGACCAAGG + Intronic
1034437122 7:151068033-151068055 CTCCGCAGGACCCTGGCCCATGG + Exonic
1034901224 7:154909283-154909305 GTCGGTGGGAATGTGGGCCAGGG - Intergenic
1036001352 8:4608330-4608352 CACCGTGGCTACCTGGGTCAGGG - Intronic
1037288371 8:17324758-17324780 CTATGTGGAAACCTAGGCCAAGG + Intronic
1038255258 8:25945359-25945381 CTCCGTGGGTAGCTGGGCTAAGG + Intronic
1039131989 8:34275593-34275615 CTCCTTGGGAACCAGGGCCAGGG + Intergenic
1039731264 8:40281058-40281080 CTCCGTGGGAACCGGTACCAGGG - Intergenic
1039901766 8:41757848-41757870 CTCTGTGGGGCCCTGGGCCACGG + Intronic
1040535363 8:48304472-48304494 CACCGTGGGACCCTGAGCCTTGG + Intergenic
1043412687 8:80015002-80015024 CTCTGTGGGAACCAGTGCCGAGG + Intronic
1044543201 8:93430610-93430632 CTCTGTGGGAACCTGGGAACTGG - Intergenic
1045257240 8:100536734-100536756 TTCCTTGGGAACCAGGGCCCTGG - Intronic
1047433979 8:124819076-124819098 CTCAGTGGGAAACTGGGTGAAGG - Intergenic
1047526896 8:125641490-125641512 CTCCCAGGGAGCCAGGGCCAAGG + Intergenic
1049419759 8:142511366-142511388 CTCCGAGGGAGCCTGGGCCTGGG + Intronic
1049447946 8:142640210-142640232 CTCTGTGGGACCCTGGGGCCAGG - Intergenic
1049604804 8:143524325-143524347 CTCCCTGGGAGTCTGGGCTAAGG + Intronic
1051136898 9:13932932-13932954 CTCTGTGGGAACGTGGGTGAGGG - Intergenic
1053514804 9:38721832-38721854 CCCATTGGGACCCTGGGCCACGG - Intergenic
1056578074 9:87870860-87870882 CTCCCTGGGAACCTGGACTATGG - Intergenic
1056591561 9:87969338-87969360 CTCAGTGAGCTCCTGGGCCAGGG + Exonic
1057667877 9:97060905-97060927 CTCTGTGGCAACCTGGGCGGTGG - Intergenic
1059539090 9:115112867-115112889 CTCAGTTGGAACCTGGAGCAGGG + Intronic
1061201553 9:129141099-129141121 CTTTTTGGGAACCTGGGCCAGGG + Intronic
1061551433 9:131337027-131337049 CTCCATGGCCACCTGGGCCAGGG - Intergenic
1185445393 X:255155-255177 CTCGGTGGGAAGCTCGGGCAGGG + Intergenic
1188716868 X:33469389-33469411 CTGCATGTGACCCTGGGCCAAGG - Intergenic
1190685356 X:52868208-52868230 TTCAGTGGGAACCTGGGAGAGGG - Intergenic
1195700216 X:107699475-107699497 CTCTGTGGGAACCAGTGCCAGGG - Intergenic
1200125902 X:153814735-153814757 GTCGCTGGGAACCTGGGCGAGGG - Intronic