ID: 1141329579

View in Genome Browser
Species Human (GRCh38)
Location 16:83097488-83097510
Sequence TAATTGCAGCAGAGTTACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 142}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141329579 Original CRISPR TAATTGCAGCAGAGTTACCA AGG Intronic
900754691 1:4425557-4425579 AAATAGCAGCAGCGTTGCCATGG + Intergenic
901107498 1:6768573-6768595 TAACTGCAGCAGGGTTTACATGG + Intergenic
901287829 1:8095464-8095486 TAATTTCACCATTGTTACCAAGG - Intergenic
903024163 1:20415413-20415435 TGGCTGCAGCAGAGTGACCAAGG + Intergenic
903546862 1:24129867-24129889 TAACTCCAGGAGAGTTGCCAAGG + Intronic
907357174 1:53885903-53885925 TAATTGCATCAGGGTAAACAGGG - Intronic
919138858 1:193544855-193544877 TAAATGCAGCAGAATAAACATGG + Intergenic
921329666 1:214022947-214022969 AAGCTGCAGCAGAGTCACCAGGG - Intronic
921426801 1:215012022-215012044 TTATTGTACCAGAGTTACCCTGG - Intronic
923695642 1:236247753-236247775 TAACTGCAGCACAGTCATCAAGG - Intronic
1063830967 10:9952449-9952471 TAAAAGCAGCAGAGTAACCTAGG + Intergenic
1067260929 10:44690830-44690852 CAGTTGCAGCAGTTTTACCAGGG - Intergenic
1068033445 10:51731416-51731438 AAATTGCAGCAGAAATACCAAGG - Intronic
1068301502 10:55147932-55147954 TAATTACTACTGAGTTACCAAGG - Intronic
1070502286 10:77083219-77083241 AAATTGCAGAAGAGTTAAGAGGG - Intronic
1072114207 10:92353864-92353886 AAATTACAGCAAAGTTAGCAAGG - Exonic
1074726287 10:116313229-116313251 TAAATTCTGCAGAGCTACCAGGG - Intergenic
1075854332 10:125615869-125615891 GAATTCTAGCAGAGGTACCAGGG - Intronic
1081956138 11:47095752-47095774 TTATTGCAGAACAGTTCCCAAGG + Intronic
1084361998 11:68674846-68674868 TAATTGCGCCTGAGTTACCTAGG + Intergenic
1085398000 11:76217186-76217208 TAATTGCTCCAAAGTTGCCAGGG + Intergenic
1086595482 11:88566109-88566131 AAATTTCAGAAGAGTTAGCAGGG + Intronic
1086739011 11:90343634-90343656 TAATTGTGGCACAGTTACCCAGG - Intergenic
1087340952 11:96906504-96906526 AAATAGCAGCAGAGTTAAAAGGG + Intergenic
1090737126 11:129619725-129619747 TAATCGCAGCAGCTTCACCATGG - Intergenic
1097203671 12:57301895-57301917 TATTTTAAGCAGAGTTATCAGGG - Intronic
1101054031 12:100894119-100894141 TAATTGTAACAGAATTACAAAGG + Intronic
1103981522 12:124739830-124739852 TAATTGTGCCAGAGTTACCAGGG + Intergenic
1112497168 13:99914514-99914536 TAATTTCAGCAGACTTTGCAAGG + Intergenic
1113117573 13:106889657-106889679 TAATTGCAGCAGAGAAAGTATGG - Intergenic
1115932842 14:38516792-38516814 TAAGTGAAGCAGAGCTACCTTGG - Intergenic
1117337756 14:54769186-54769208 TACCTGCAGCAGAATTACCAGGG + Intronic
1118658353 14:67978825-67978847 AAAATGCAGCAGAGTGATCAAGG - Intronic
1122190821 14:100042098-100042120 TAATTTCAACAGTGTTACTATGG + Intronic
1125426314 15:39553066-39553088 CAATTGCAGCAGAATTCCAAAGG - Intergenic
1127102943 15:55586597-55586619 TAACTGCAGCAAAGTGAGCAAGG - Intronic
1128386893 15:67156004-67156026 TAATTGCAGGTGAGTGAACACGG + Intronic
1128988221 15:72236700-72236722 TACTTCCATCAGAGTGACCAAGG - Intergenic
1131274409 15:90968966-90968988 TAATCTCAGCAGTGTTACAAAGG - Intronic
1131359138 15:91773836-91773858 CTATTGCAGCAGAGTCTCCATGG - Intergenic
1131481362 15:92784709-92784731 TTATCGCAGGAGAGTTCCCAAGG + Intronic
1131607239 15:93919505-93919527 TAGATGCAGAAGAATTACCAAGG + Intergenic
1131875093 15:96797414-96797436 TTATGGCATCAGAGTAACCATGG + Intergenic
1135558628 16:23457681-23457703 AAATTTCAGCAGACTGACCAAGG - Intergenic
1136237864 16:28925461-28925483 TAATTGGAGCAGGGCTTCCAAGG - Exonic
1138988720 16:62363594-62363616 AAATTGGAGCAAAGTTACCCAGG + Intergenic
1140616872 16:76675596-76675618 TAATCGCTGCAGAGATTCCAAGG + Intergenic
1141329579 16:83097488-83097510 TAATTGCAGCAGAGTTACCAAGG + Intronic
1146474087 17:33148120-33148142 TAATAGGAGCACAGTTAGCAAGG + Intronic
1147983064 17:44286905-44286927 TAATTGAAGCAGAGTCTCCAGGG + Intergenic
1148821069 17:50360010-50360032 TACATGGAGCAGAGTTTCCAGGG + Exonic
1150572792 17:66402334-66402356 TAATGGCAGTAGAGTGACTATGG + Intronic
1153452145 18:5241211-5241233 AAATTGCAGCAGAGAAGCCAGGG - Intergenic
1156926262 18:42583789-42583811 TAATTCCAGCAGCTTTCCCATGG + Intergenic
1162795354 19:13084486-13084508 CAATTGCAGAAGGGTTCCCAGGG + Intronic
1166203295 19:41252664-41252686 TGTTTCCAGCAGAGTTCCCAGGG - Intronic
1168410069 19:56134248-56134270 TAATTATAGCAGAGCTACAAAGG + Intronic
926208174 2:10848758-10848780 TAATTGCATGTTAGTTACCATGG - Intronic
928646366 2:33356828-33356850 TACTTTCAGCAGAATTACCCAGG - Intronic
929579403 2:43072087-43072109 AAACTGCAGCATAGTCACCAAGG + Intergenic
930258246 2:49116094-49116116 TAATTGTAGCAGAGTCATCATGG + Intronic
932211381 2:69933900-69933922 TACTTGGAGCAGAGTTCCCTGGG - Intronic
932940398 2:76158252-76158274 TAATCCCAGCATAGTTACCATGG - Intergenic
934529453 2:95075948-95075970 TACTTCCAGCAGGGTTCCCAGGG + Intergenic
936466436 2:112755549-112755571 TAAGTTCAGAAAAGTTACCAGGG - Intronic
936645167 2:114360497-114360519 TAATTGCAGAGGAATTACTAAGG + Intergenic
940473047 2:154123929-154123951 TAATTGGAGCAGTGTTTACATGG + Intronic
940892623 2:159049552-159049574 TAAGTGCATCAGAGTTACCTGGG - Intronic
945049879 2:205813476-205813498 TATCTGCATCAGAATTACCAAGG + Intergenic
945180013 2:207082260-207082282 TAATTTCAGCAGATGTCCCAGGG - Intronic
1169882095 20:10357914-10357936 TAGTTGCAGCAGAGATCTCATGG + Intergenic
1169943823 20:10967247-10967269 TAACTGCATCAGAATTACCTGGG + Intergenic
1171147275 20:22795963-22795985 TAATTGCCTCAGACTTCCCAGGG + Intergenic
1174726959 20:52872664-52872686 TAATTGGACCAGAGGAACCAGGG + Intergenic
1175271373 20:57736474-57736496 TAATTACAGCAAAAATACCACGG + Intergenic
1182542207 22:31049901-31049923 GAACTGCTGCAGACTTACCAGGG + Intergenic
1184108220 22:42380990-42381012 TTCTGGCAGCAGAGTTTCCATGG - Exonic
1185137768 22:49082712-49082734 TAATTTCAGGGGAGTTTCCAGGG + Intergenic
951844247 3:27068579-27068601 TAATTGCAGTAGAGATCCTATGG + Intergenic
952720929 3:36531770-36531792 TAATTGCACCACAGGTGCCAGGG - Intronic
952991006 3:38830691-38830713 AAATAGCAGCAGGGTGACCATGG - Intergenic
953297817 3:41738429-41738451 CAATGGTAGCAGAGTTAGCATGG - Intronic
953516716 3:43600234-43600256 TAATTGCAGCAGAGACCACACGG + Intronic
953557073 3:43954446-43954468 TAATGGCAGCAATGTTACAAGGG + Intergenic
964642693 3:158927148-158927170 TCAATGCAGAAGAGGTACCATGG + Intergenic
966902639 3:184497949-184497971 TAATTGCAGCAGCTTCATCATGG + Intronic
967358814 3:188606220-188606242 TAATTGCAGAGGAGTCACGAAGG - Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968380758 4:93977-93999 TAATTGACTCACAGTTACCATGG + Intergenic
971084355 4:23254038-23254060 TGATTGTGGCAGTGTTACCATGG - Intergenic
974018073 4:56667780-56667802 TAATAGCAGCAGTGATACCTAGG + Intronic
976107573 4:81635516-81635538 TAATTGCAGTAGGGCAACCAGGG + Intronic
978806474 4:112805996-112806018 TAATCACATCAGAGTAACCAGGG + Intergenic
980651990 4:135728518-135728540 TAAATACAGCAGAAATACCAAGG - Intergenic
981213978 4:142140921-142140943 TAATAGCTGCAGAGTAACCCAGG - Intronic
981950529 4:150401124-150401146 CAATTGCAGCAGTGTAACCTCGG - Intronic
984251622 4:177342954-177342976 TGATTGTAGCATAGTTAACATGG + Intronic
985920982 5:2973501-2973523 TAACTGCAGCAGAGTCATGATGG + Intergenic
987193807 5:15505008-15505030 GTAGAGCAGCAGAGTTACCAAGG - Intronic
987673290 5:21042492-21042514 TAATTGCAACAGAGACAACATGG - Intergenic
988518076 5:31922056-31922078 TAATTGGAGGAGATTTCCCATGG - Intronic
988541102 5:32111007-32111029 TAAATGCATCAGAGGTACAAAGG + Intergenic
988619731 5:32810891-32810913 CCAGTGCAGCTGAGTTACCATGG - Intergenic
988933109 5:36056118-36056140 TAATTGCAGGACAGTTCTCAGGG + Intronic
991045561 5:62218908-62218930 TAAAGGCAGCAGAGTTAGGACGG - Intergenic
992972474 5:82076488-82076510 AAATTGAAGAAAAGTTACCAAGG - Intronic
996485323 5:124026884-124026906 TGATTGAAGCAGAGTGAGCAAGG + Intergenic
997447904 5:133955119-133955141 TAATTGCAGCACTGTGACCTAGG + Intergenic
1000555155 5:162717246-162717268 TAATTAAAGGAGAGTTCCCAAGG - Intergenic
1001264220 5:170260846-170260868 TAATTGCAGCTCCATTACCAGGG - Intronic
1002377936 5:178801624-178801646 TTACTGCAGCAGTATTACCAAGG + Intergenic
1002466013 5:179409074-179409096 TAATTGCAGCAAAGTGGACAAGG - Intergenic
1002811075 6:629662-629684 TACTTGCAGCATAGCTAACAAGG + Intronic
1003770273 6:9291465-9291487 TCATTGCAGCAGACTTAATAAGG - Intergenic
1004116400 6:12771911-12771933 CAAATGCAGCAGAGAGACCAGGG + Intronic
1004772285 6:18797152-18797174 TAATTGCATATGAGTTACAAAGG - Intergenic
1005783015 6:29212980-29213002 TAATTTCAGCAGAGCTGCAAGGG - Intergenic
1006379087 6:33687448-33687470 AAATGGCAGCACAGTCACCAGGG - Intronic
1007875448 6:45095200-45095222 TAAAGGAAGCAGAGGTACCATGG - Intronic
1010521376 6:76842405-76842427 TAACTGCAGGAGAGATCCCAAGG - Intergenic
1011668253 6:89656852-89656874 TCAATGCAGCACAGTAACCAGGG - Intronic
1013217386 6:108040151-108040173 TAATAGAAGCTGAGATACCAAGG - Intergenic
1014642923 6:123935783-123935805 TAAATGTAGCACAGTTTCCATGG - Intronic
1016286470 6:142478924-142478946 TCATAGAAGTAGAGTTACCAGGG - Intergenic
1019469573 7:1211554-1211576 GAATTCCAGCAGAGATACCGAGG - Intergenic
1023148818 7:37180158-37180180 GAATAGCAGCAGATTTTCCATGG + Intronic
1023236562 7:38096133-38096155 GAATAGCAGGATAGTTACCAGGG + Intergenic
1024982518 7:55169658-55169680 TCATTTCTGCAGAGTTACCGAGG + Intronic
1027413006 7:77942495-77942517 GAATTGCAACAGAGTTAAAAGGG - Intronic
1030053431 7:105560204-105560226 TAGTTTCAGCAGAAATACCAAGG + Intronic
1032477098 7:132219171-132219193 GATTTGCAGAAGAGTCACCAGGG + Intronic
1032930779 7:136667009-136667031 TATTTTCAACAAAGTTACCAGGG - Intergenic
1035834673 8:2736274-2736296 TTTTAGCAGCACAGTTACCAAGG - Intergenic
1042044688 8:64636286-64636308 TAAATGGACCAAAGTTACCAAGG - Intronic
1043044107 8:75299482-75299504 GCATTGAAGCAGAGCTACCAAGG - Intergenic
1044561855 8:93619986-93620008 TAATACCAGCAGGGTTACAAAGG + Intergenic
1044688340 8:94850653-94850675 TACTGGCAGCAGTGTTACCTTGG - Intronic
1047171062 8:122492626-122492648 TGGCTGCAGCAGAGTTAGCAAGG + Intergenic
1052464537 9:28813921-28813943 TGATTGCAGCAAAGTTACCATGG + Intergenic
1052507526 9:29375140-29375162 TAATTGGAGCAGAGAGAGCATGG + Intergenic
1058195824 9:101973956-101973978 TAAATACAGCAAAGTTACAATGG - Intergenic
1060033923 9:120238839-120238861 TAATTGCAGCAGAGACCACATGG + Intergenic
1186154226 X:6708861-6708883 TAATTGCAGCACAGTTTAGAGGG - Intergenic
1186326394 X:8482077-8482099 TCATTGCAGCTGAGTTGCCAGGG + Intergenic
1186351498 X:8744324-8744346 AAATTGCAGCTGAATTAGCATGG - Intergenic
1188959567 X:36473869-36473891 TAGTTGCAACAGAGTCCCCATGG + Intergenic
1193043308 X:77026124-77026146 TAGTTGGAGCAGAGCTAGCAAGG + Intergenic
1195511024 X:105715335-105715357 TAATTTCACCAGTCTTACCAAGG - Intronic
1195661252 X:107380888-107380910 TGATTGGAGCAGAGTAAGCAAGG + Intergenic
1198053168 X:132968545-132968567 GAATTGCAAAAGAGTTACAATGG - Intergenic
1201640692 Y:16173470-16173492 TAATTGCAGCTAAGTTATAATGG + Intergenic
1201662123 Y:16411856-16411878 TAATTGCAGCTAAGTTATAATGG - Intergenic