ID: 1141330854

View in Genome Browser
Species Human (GRCh38)
Location 16:83109251-83109273
Sequence CAAGTCCTACAGATTCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141330854_1141330858 5 Left 1141330854 16:83109251-83109273 CCAGGTGGAATCTGTAGGACTTG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1141330858 16:83109279-83109301 CGCTCGTGAGTGCAGTATGGTGG 0: 1
1: 0
2: 0
3: 0
4: 36
1141330854_1141330856 2 Left 1141330854 16:83109251-83109273 CCAGGTGGAATCTGTAGGACTTG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1141330856 16:83109276-83109298 AACCGCTCGTGAGTGCAGTATGG 0: 1
1: 0
2: 0
3: 1
4: 40
1141330854_1141330859 6 Left 1141330854 16:83109251-83109273 CCAGGTGGAATCTGTAGGACTTG 0: 1
1: 0
2: 0
3: 7
4: 101
Right 1141330859 16:83109280-83109302 GCTCGTGAGTGCAGTATGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141330854 Original CRISPR CAAGTCCTACAGATTCCACC TGG (reversed) Intronic
900322314 1:2090878-2090900 GAGGTCCTACAAATTCCACAGGG - Intronic
902610072 1:17592046-17592068 CACGTGCTTCAGAGTCCACCAGG - Intronic
904819104 1:33229033-33229055 CAAGCCCTACAGATACCTCGAGG - Intergenic
910681913 1:89875143-89875165 CAATTCCAAAAGATTCTACCGGG - Intronic
915003993 1:152619954-152619976 AAGGTCATGCAGATTCCACCTGG - Intergenic
915027284 1:152842857-152842879 CAAGGCCTCCAGACTCCTCCTGG + Exonic
918410434 1:184253155-184253177 AAAGTGATACAGTTTCCACCTGG + Intergenic
922087796 1:222367830-222367852 CAAGCCCTTCTGATTTCACCAGG + Intergenic
923597116 1:235369188-235369210 CAAGGACTACACATTTCACCTGG + Intronic
923941198 1:238829374-238829396 CAAGTGCGACTGATTCCACTGGG + Intergenic
924863613 1:247953703-247953725 CAAGCTCTAAAGATTCCTCCAGG + Intronic
924872680 1:248065904-248065926 CAAGTTCTAAAGATTCTTCCAGG + Intronic
1063523037 10:6758150-6758172 CAAGTCCTACTGATACAAACAGG - Intergenic
1063639138 10:7813688-7813710 CAAGTCTTAAAACTTCCACCAGG + Intergenic
1065008602 10:21402205-21402227 CAAGTGTTGCAGATTCCACTGGG + Intergenic
1067214957 10:44293726-44293748 GAAGCCGTACAGAATCCACCTGG - Intronic
1070842804 10:79499610-79499632 AAAGTCCTACAGATCCCAGTGGG - Intergenic
1072930039 10:99654440-99654462 CATGTCCTTAAGATTACACCTGG + Intergenic
1073812015 10:107162864-107162886 CAAGTTTTACAGCTTCAACCAGG - Intronic
1073814765 10:107194572-107194594 CCAGTCTTACAGATTCGATCTGG - Intergenic
1076928422 10:133508009-133508031 CAACTTCTACAGCTCCCACCCGG + Intergenic
1077186238 11:1236627-1236649 CGAGTCCCACAGACCCCACCTGG - Intronic
1077644451 11:3911038-3911060 CAAATCCCACAGACTCCAGCAGG - Intronic
1083751209 11:64761666-64761688 CAAGTCCTACAGAGGTCTCCAGG + Intergenic
1084805669 11:71577106-71577128 CAAGTACTACAGCCTCCACGCGG - Intergenic
1086905419 11:92412953-92412975 CAACTCCTACAGTTTCCATTAGG + Intronic
1088285850 11:108186743-108186765 CAAGTCCTACAGTCTGCACTAGG + Intronic
1088592241 11:111413897-111413919 CAAGTCCTTCATATTACAACTGG + Intronic
1088810109 11:113386670-113386692 CAAGTTCTCCAGCTTCCACAGGG + Intergenic
1089571056 11:119410066-119410088 GAAGTCTTGCAGCTTCCACCTGG - Intergenic
1090661282 11:128883620-128883642 GAAGTCCTACTGATTCCATCTGG - Intergenic
1103157118 12:118695008-118695030 CAAATCCTGTAGATTCCATCTGG + Intergenic
1105347602 13:19588291-19588313 CAAGGCCTGTAAATTCCACCAGG - Intergenic
1106337767 13:28799306-28799328 GAAGAGCAACAGATTCCACCTGG + Intergenic
1107406376 13:40117811-40117833 CAAATCCTCCATATTCCCCCAGG - Intergenic
1108141969 13:47433204-47433226 CAAGTCATAAAGATTCCTCTGGG + Intergenic
1109892133 13:68629700-68629722 CAAGTCTTACAGACTCCATCTGG + Intergenic
1121908477 14:97768460-97768482 CAGGTCCTGCTGATTCCAGCAGG + Intergenic
1124556688 15:30732462-30732484 CAATTCCTAAAGAATCCACAAGG - Intronic
1126585861 15:50286070-50286092 CTATTTCTGCAGATTCCACCCGG + Exonic
1127311441 15:57755151-57755173 CAAGTCCTACTGATCCTACTTGG - Intronic
1128235824 15:66066408-66066430 AAATTCCTATAGATTCCCCCTGG - Intronic
1130564043 15:84980067-84980089 CAAGAGCTCCAGATTCTACCTGG + Intergenic
1132929950 16:2454031-2454053 GAACTCCTACTGATTCCACAAGG + Intronic
1135740419 16:24970426-24970448 CAGGTCCTACATACACCACCTGG + Intronic
1137483923 16:48876058-48876080 CAACTCCTGCAGAATCCACTTGG - Intergenic
1138763092 16:59567594-59567616 CAGTTCCTTCAGAATCCACCCGG + Intergenic
1139476356 16:67204428-67204450 CAAGTCCTACAAAGGACACCAGG - Intergenic
1141330854 16:83109251-83109273 CAAGTCCTACAGATTCCACCTGG - Intronic
1143756462 17:9071568-9071590 CAAGTCCTTTGGCTTCCACCAGG - Intronic
1145858891 17:28189696-28189718 CGATTCCTAGAGATTCCACTGGG - Intronic
1148253367 17:46106020-46106042 CCAGTCCCACATATTCCACAGGG + Intronic
1165063733 19:33217557-33217579 CAGGACCTACAGGTTCTACCAGG - Intronic
1165933882 19:39377553-39377575 CAAGGCCTACAGTGTCCTCCAGG + Exonic
1166650679 19:44572098-44572120 CCAATTCTACAGATTCCTCCAGG + Intergenic
925061359 2:893380-893402 CATGGGCTACAGACTCCACCTGG + Intergenic
932594611 2:73086347-73086369 CAAATCCTCCAGATTCCAAGAGG + Intronic
934976886 2:98809011-98809033 GAAGTCTTACAGTTTCTACCTGG - Intronic
938717637 2:134035560-134035582 CAAGTTCAACAGAACCCACCTGG + Intergenic
940800681 2:158129340-158129362 CAAGTCCTCGAGATTACATCTGG + Intronic
946231875 2:218296451-218296473 CATGTCCTTCAGGTTCCACCTGG - Intronic
1168859294 20:1034448-1034470 AAGGCCCTACAGTTTCCACCTGG + Intergenic
1170733607 20:18994638-18994660 AAAGTCACACAGCTTCCACCAGG - Intergenic
1176175498 20:63721420-63721442 CAAGTCCTTCAGTGTCCGCCAGG + Intronic
1179306552 21:40158567-40158589 CACGTGCCACAGATTCCACACGG + Intronic
1179714931 21:43281702-43281724 CAAGTGCCTCAGTTTCCACCTGG - Intergenic
1181405028 22:22678285-22678307 CAAGTCCTTCTGAGGCCACCTGG - Intergenic
1181408184 22:22699933-22699955 CAAGTCCTTCTGAGGCCACCTGG - Intergenic
1181413502 22:22743242-22743264 CAAGTCCTTCTGAGGCCACCTGG - Intronic
949390983 3:3561919-3561941 CAAATCCTAGAGTTTCCACAAGG - Intergenic
952493072 3:33890584-33890606 CAGGTCCTACAGAGACCTCCAGG - Intergenic
953007648 3:38993154-38993176 CAAGTGCTTGAGAATCCACCTGG + Intergenic
957329380 3:78741223-78741245 CAATTCCTGCAGCTACCACCAGG + Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
963067930 3:141278595-141278617 CAAGTCCTGCAGTTGCCACCAGG + Intronic
970016262 4:11515962-11515984 CAAGACCTACAGCATCCCCCAGG - Intergenic
979365878 4:119822635-119822657 CCAGTCCTACAGAGTCAAGCTGG - Intergenic
982759505 4:159264516-159264538 CAAGTTCTACACCTTCCATCTGG - Intronic
985786531 5:1898255-1898277 CAGGTGCTCCAGGTTCCACCTGG + Intergenic
987009948 5:13752250-13752272 CAAGTACTTCAGAAACCACCTGG - Exonic
993248325 5:85481384-85481406 CACCTCCTGCAGATCCCACCAGG + Intergenic
996038125 5:118781349-118781371 CAAGACCTAGAAATTACACCAGG + Intergenic
997185443 5:131877347-131877369 AAAGGCCTCCAGATTCCAGCTGG + Intronic
997672351 5:135685879-135685901 CAAGTCCTGCAGATTCCCTGGGG + Intergenic
998209295 5:140182194-140182216 CAAGTTCCACATATCCCACCTGG + Intronic
1001071486 5:168588872-168588894 CAGGTCCTTCAGATGCAACCTGG + Intergenic
1008368919 6:50712076-50712098 CAAGTCCTACATATTCTTCCAGG + Intergenic
1011908947 6:92410490-92410512 CAACTTTTACAGCTTCCACCTGG - Intergenic
1013604974 6:111739166-111739188 AAAGCTCTACAGATTCCACTGGG + Intronic
1016870527 6:148811749-148811771 CGAGTCCTACAGCTTCTGCCTGG - Intronic
1026887430 7:73960779-73960801 CAAGAGCTTCAGTTTCCACCTGG - Intergenic
1030691514 7:112539793-112539815 CAGGTCCTGCTGATTCTACCTGG + Intergenic
1032219616 7:129984140-129984162 CAAGTACCACGGATTCCACCTGG - Intergenic
1032246224 7:130215632-130215654 GAAGTCTTACAGATTCAAGCAGG - Intronic
1035118961 7:156549068-156549090 AAAGTTCCACAAATTCCACCAGG + Intergenic
1041521752 8:58764416-58764438 GAAGTCATGCAGCTTCCACCAGG - Intergenic
1042424626 8:68632795-68632817 CAAGTCTTACAGCTTCCACGTGG + Intronic
1048252224 8:132876271-132876293 CAAGTTCTGTGGATTCCACCTGG - Intronic
1051251331 9:15161843-15161865 TTAGTCTTACAGCTTCCACCTGG - Intergenic
1056287734 9:85108231-85108253 TCAGTCCTGCAGATACCACCTGG + Intergenic
1056932320 9:90889502-90889524 CAAATGCTGCAGATGCCACCTGG + Intronic
1060709837 9:125849152-125849174 CAAGTCCTTCTGATTCCAAAGGG + Intronic
1187089449 X:16080001-16080023 CAAGTCCTACACATACCCCAAGG + Intergenic
1189181815 X:39011788-39011810 CAAGTCCTGCAGCTGCCTCCTGG - Intergenic
1194986489 X:100495414-100495436 CAAGTACTACAATATCCACCTGG + Intergenic
1198493071 X:137163295-137163317 GAAGCCTTACAGTTTCCACCTGG + Intergenic
1200675465 Y:6142301-6142323 CAAGTCTTACAGATTCGTTCAGG + Intergenic
1202342580 Y:23885654-23885676 TAAGTACCACAGATTCCAGCAGG + Intergenic
1202528189 Y:25784431-25784453 TAAGTACCACAGATTCCAGCAGG - Intergenic