ID: 1141334832

View in Genome Browser
Species Human (GRCh38)
Location 16:83144905-83144927
Sequence GGGTAGGTTAATGGAGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141334829_1141334832 -9 Left 1141334829 16:83144891-83144913 CCCTGGGCTGCAGAGGGTAGGTT 0: 1
1: 0
2: 2
3: 48
4: 485
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data
1141334830_1141334832 -10 Left 1141334830 16:83144892-83144914 CCTGGGCTGCAGAGGGTAGGTTA No data
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data
1141334821_1141334832 22 Left 1141334821 16:83144860-83144882 CCTAACAGACAGCAGCTACAGAG 0: 1
1: 0
2: 0
3: 15
4: 189
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data
1141334824_1141334832 -1 Left 1141334824 16:83144883-83144905 CCTCCTTTCCCTGGGCTGCAGAG 0: 1
1: 0
2: 4
3: 36
4: 447
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data
1141334820_1141334832 30 Left 1141334820 16:83144852-83144874 CCTTCTCTCCTAACAGACAGCAG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data
1141334827_1141334832 -4 Left 1141334827 16:83144886-83144908 CCTTTCCCTGGGCTGCAGAGGGT 0: 1
1: 1
2: 16
3: 38
4: 351
Right 1141334832 16:83144905-83144927 GGGTAGGTTAATGGAGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141334832 Original CRISPR GGGTAGGTTAATGGAGACTG AGG Intronic
No off target data available for this crispr