ID: 1141336071

View in Genome Browser
Species Human (GRCh38)
Location 16:83156591-83156613
Sequence CCATGGTGCCTTTTATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141336071_1141336076 0 Left 1141336071 16:83156591-83156613 CCTCCAGATAAAAGGCACCATGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1141336076 16:83156614-83156636 GCAGCTAACAAGCCCCTAATAGG 0: 1
1: 1
2: 0
3: 7
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141336071 Original CRISPR CCATGGTGCCTTTTATCTGG AGG (reversed) Intronic
901062069 1:6476132-6476154 CCTTGCTACCTTTAATCTGGGGG - Intronic
906030822 1:42718580-42718602 CCATGGTGCATGTCATCTGCTGG + Intergenic
907188867 1:52632748-52632770 TCATGGTGCCTCTTTTCTAGCGG - Intergenic
907427019 1:54386343-54386365 CCGTGGGGCATTTTATCTGAAGG - Intronic
909527538 1:76643616-76643638 CCTTGGTGGCTGTTAGCTGGAGG + Intergenic
910362758 1:86430652-86430674 TCATGCTGCCTTTTTTATGGTGG + Intronic
911229893 1:95349843-95349865 CCGTGATGCCTCTTCTCTGGAGG - Intergenic
913022059 1:114798115-114798137 CCATTTTTCCTTTTATGTGGTGG - Intergenic
915609424 1:156979271-156979293 CCATGGTGCCGTTGACCTGTTGG + Exonic
915906671 1:159883171-159883193 TCATGGTGCCATTTAACTTGTGG - Intronic
922058615 1:222065723-222065745 CGATGGTGGATTCTATCTGGAGG - Intergenic
924148724 1:241105317-241105339 CAATAGTGCCTTTCATCTTGAGG - Intronic
1063345779 10:5311257-5311279 CCATGGTGCTTTTTCTCTCAAGG - Intergenic
1064031512 10:11886032-11886054 CCGAGGGGGCTTTTATCTGGGGG - Intergenic
1064943563 10:20761975-20761997 CCGTGGTTCCTTCTATCTTGGGG + Intergenic
1064969951 10:21055071-21055093 CCATAGTTCATTATATCTGGGGG + Intronic
1066188326 10:33031983-33032005 AAATGCTGCCTTTTATCTGGTGG + Intergenic
1069153311 10:64993282-64993304 GCATGGTGACTCTTTTCTGGAGG + Intergenic
1071918655 10:90325131-90325153 ACATGGGGCCTTTTATTTGGGGG - Intergenic
1072020232 10:91392011-91392033 CCATCTGGGCTTTTATCTGGAGG + Intergenic
1075082452 10:119393065-119393087 CCATGGTACCTTTCCTCTGTAGG + Intronic
1075513285 10:123089239-123089261 CCATAGTGCCTTTTGTCTTGAGG - Intergenic
1075593832 10:123712850-123712872 TCATGTGGCCTTTTATGTGGAGG + Intronic
1081301149 11:41453523-41453545 CCATGGTTTCTTTTATTTGTAGG - Intronic
1084875755 11:72131514-72131536 TCAGTGTGCCTTTTATCTAGAGG + Intronic
1085389560 11:76175582-76175604 CCATGGTCCATTTTATGGGGTGG - Intergenic
1087691289 11:101323461-101323483 CCATGGGGCCTTGTATCAGAAGG + Intergenic
1089147035 11:116336616-116336638 CCATGGAGCCATTTATCTCCTGG + Intergenic
1090423625 11:126592373-126592395 CCATTGTTCCCTTTATATGGAGG + Intronic
1091754250 12:3041313-3041335 CCAGGGTGCCTGTTAGGTGGAGG + Intergenic
1093962841 12:25294070-25294092 TCATGGTGCTTTATATCTGGTGG - Intergenic
1099907574 12:88790366-88790388 CCATGGCCCCTTTTAGCTGGAGG + Intergenic
1102132899 12:110546804-110546826 CTATGTTGCCATTTTTCTGGTGG - Intronic
1102414056 12:112745230-112745252 CCCCAGTGCATTTTATCTGGAGG + Intronic
1108690604 13:52856131-52856153 CCCTGGAGCCTTTTGGCTGGAGG + Intergenic
1109132315 13:58602730-58602752 CCATGGTAACTTTTCTCTGATGG - Intergenic
1111682366 13:91459360-91459382 CCACGGTGCCTCTTTTCTGTAGG - Intronic
1113784202 13:112993924-112993946 TGATTGTGCCTTTTATCTGAAGG - Intronic
1116396793 14:44455989-44456011 CCAGGGTGCATTTTTGCTGGGGG - Intergenic
1119471185 14:74900612-74900634 AAATTGTGCCTTTTCTCTGGTGG + Intronic
1121495968 14:94391447-94391469 CCATGATGCATTTCCTCTGGGGG - Intergenic
1122570655 14:102697394-102697416 CTGTGCTGCCTTTTATCTTGTGG + Intronic
1123006356 14:105325651-105325673 CCAGGATGCCTTTCATCTTGGGG + Intronic
1126937503 15:53727703-53727725 CCATGGTAGATTTTCTCTGGAGG - Intronic
1128320674 15:66691709-66691731 CTCTGGTCCCTTTTATCTGGGGG + Intergenic
1131926346 15:97388102-97388124 CCATGATGCCTTTTATTTACTGG + Intergenic
1132986852 16:2771779-2771801 CCATGGTGCCTTTAAGCAGCAGG + Intronic
1133331957 16:4980392-4980414 CCTCCGTGCCTGTTATCTGGGGG + Intronic
1134253009 16:12587908-12587930 CCCTCCTGCCTTTTTTCTGGGGG + Intergenic
1136654775 16:31703287-31703309 GAATGGTGACTTCTATCTGGTGG - Intergenic
1138461507 16:57151024-57151046 CCATGGAGCTGTTTTTCTGGAGG + Intergenic
1139264679 16:65627743-65627765 GCATGGTGCCTGTTCTCAGGGGG + Intergenic
1140300417 16:73752121-73752143 CCATGGTGCCATTTATACGTAGG + Intergenic
1140390959 16:74586206-74586228 CCCAGGTTCCTTTTATCTTGTGG - Intronic
1140433061 16:74921379-74921401 CCATGTTGTCTTTAAGCTGGTGG - Intronic
1140478211 16:75249468-75249490 CCCTGCAGCCCTTTATCTGGGGG + Intronic
1141336071 16:83156591-83156613 CCATGGTGCCTTTTATCTGGAGG - Intronic
1141472398 16:84247919-84247941 CCATGGTGCCTTGTAAATGTCGG - Intergenic
1149623943 17:58066484-58066506 CCATGGTGCCTTTTAAAAGGCGG - Intergenic
1153811365 18:8754917-8754939 CCCTGGTCCTTTTTACCTGGTGG + Intronic
1156495362 18:37522081-37522103 AAATGGTGCCTTTCTTCTGGTGG + Intronic
1158470372 18:57730591-57730613 CCATGATGCCTTTTCTTTTGTGG - Intronic
1158770206 18:60507159-60507181 CCCTGGTGCCTTTGATAAGGAGG + Intergenic
1161524798 19:4747240-4747262 TCTTGGTGCCTTCTGTCTGGGGG + Intergenic
1162667078 19:12222844-12222866 CCATGTTGCCTTTTATAGTGAGG + Intergenic
1163387697 19:17009871-17009893 CCCCGGTGCCTTGTATCAGGAGG - Intronic
1164842847 19:31406413-31406435 CCATGGTGTCTTTTATCTTCAGG - Intergenic
1165916450 19:39264097-39264119 CCATGCTGGCTTTTATGTGCAGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
1166439034 19:42794455-42794477 CCATTGTGGCTTCTACCTGGTGG + Intronic
1167479473 19:49720818-49720840 CCTTGGTGACTGATATCTGGAGG + Intergenic
925764162 2:7214844-7214866 CAATGATGCCTTCTACCTGGAGG + Intergenic
932131591 2:69192484-69192506 CCATGGTGGCTTTTGGCAGGAGG - Intronic
934510721 2:94939722-94939744 GCATGGTGCCTTCTTTGTGGTGG - Intergenic
936837920 2:116730434-116730456 CCATGGAGACTATGATCTGGAGG + Intergenic
938159684 2:128973942-128973964 CCCAGGTGCCTTTTATCTTGGGG - Intergenic
938766926 2:134466081-134466103 CCAGGGTGCCTAATCTCTGGGGG - Intronic
942442489 2:176050693-176050715 CCAGGGTGCCTGTGAACTGGGGG + Intergenic
946595196 2:221298324-221298346 CCATGGTGCCTTCCATGTGCTGG - Intergenic
949030505 2:241794687-241794709 CCCTGCTGCCTTTGCTCTGGGGG - Intronic
1170481887 20:16774291-16774313 CCTTGGTGGCTTTCATGTGGTGG + Intergenic
1172384318 20:34523012-34523034 CCAGGGTGCCTTGCGTCTGGAGG + Intronic
1173453170 20:43183301-43183323 CCTTGGTGCCTGTTTTCTGCCGG + Intronic
1173857777 20:46261879-46261901 CCATCGTGCCTTATACCTAGGGG - Intronic
1178571340 21:33739943-33739965 CAATGGTGATTTATATCTGGTGG + Intronic
1183403784 22:37620001-37620023 CCATGGTGCCATCTAGCAGGTGG + Intronic
1183522655 22:38304323-38304345 CCATGGTGTCTTTTCTCAGGTGG - Intronic
1185100468 22:48838173-48838195 CCATTGTGTCTTCTAGCTGGTGG + Intronic
949937995 3:9131797-9131819 CCATGGAGAATTTTATCAGGAGG - Intronic
951532666 3:23712371-23712393 TCATGGTGTCATTTATCTAGAGG + Intergenic
952855257 3:37765009-37765031 TCATGGTGTTTTTAATCTGGTGG - Intronic
955605946 3:60703817-60703839 GCCTGGTGCCTTTTTTCTAGTGG + Intronic
956121142 3:65967139-65967161 CCATGGTGCCTTTGAAATGCTGG + Intronic
957538688 3:81539968-81539990 CCATGGCGTTTTTTCTCTGGTGG - Intronic
962081824 3:132147921-132147943 CCATAGTGCCTGGGATCTGGAGG + Intronic
962344697 3:134610532-134610554 CCTTGATGGCTTTTATCTCGGGG + Intronic
962806620 3:138932028-138932050 CCATGGTTCTTTTTTTGTGGGGG + Intergenic
966313914 3:178624865-178624887 CCATGGTCTTTTTTCTCTGGTGG + Intronic
968113468 3:196069799-196069821 CCATGCTGCCTTTCATCTGAAGG + Intronic
972655824 4:41062712-41062734 ACTTTGTGCCTTTTTTCTGGTGG - Intronic
973288796 4:48449149-48449171 CCATGGTCCCTTCTTTGTGGTGG + Intergenic
974293259 4:59961833-59961855 CCATGGTGCCTACTCTCTGTAGG + Intergenic
975968705 4:80007603-80007625 CCATGGTTCCTTAAAACTGGAGG + Intronic
976249612 4:83036426-83036448 CTAGGCTGCCTTTTCTCTGGTGG + Intronic
978952705 4:114580508-114580530 CTCTTGTGCCTTTTAACTGGGGG + Intergenic
986063737 5:4215946-4215968 AAATGGTGCCTTTTATCTCTGGG - Intergenic
986633798 5:9800651-9800673 CCAAGCTGGGTTTTATCTGGTGG + Intergenic
990538424 5:56747598-56747620 CCATGGTGCCTTTTAGTTACAGG + Intergenic
993730989 5:91422655-91422677 CCATTCTGCCTTATATCTGTTGG + Intergenic
994965461 5:106664209-106664231 CCATGGTGCCTTCTCTCTCATGG + Intergenic
994976513 5:106814586-106814608 TAAAGGTGCCTTTTATCTGAAGG + Intergenic
995960876 5:117837642-117837664 CTAATGTGCCTTTTATGTGGAGG + Intergenic
996229102 5:121039383-121039405 CCATGGTTCCGATTCTCTGGAGG - Intergenic
999423270 5:151463571-151463593 CAATGTTGCCTTTTAACAGGTGG - Exonic
999843048 5:155449652-155449674 CCTTGGTGGCTTCTATGTGGTGG - Intergenic
1000489544 5:161893627-161893649 CCATGCTGTCTCTCATCTGGAGG + Intronic
1000731040 5:164834505-164834527 CCATGGTGCCTTAGATGTAGAGG + Intergenic
1001757717 5:174183765-174183787 CCATGGTGTTACTTATCTGGTGG - Intronic
1002979704 6:2124499-2124521 CCATTGTGCTGTTTATCTGCTGG - Intronic
1003080243 6:3015821-3015843 TCATGGAGCTTTTTGTCTGGTGG + Intronic
1003155953 6:3594584-3594606 GCATGGTGTGTTTTATCTGAGGG - Intergenic
1004354868 6:14922053-14922075 CCCTGGTGCCTTTTCTCAGTCGG + Intergenic
1009835395 6:68994213-68994235 CTATAGTGCCTTTTATCTGGGGG - Intronic
1013729263 6:113144132-113144154 CTATGGTCCCTTTAATCTTGGGG + Intergenic
1017602819 6:156102046-156102068 CAATGCTTCCTTTTACCTGGTGG - Intergenic
1019470935 7:1220364-1220386 CCATCGTGTCTCTGATCTGGGGG + Intergenic
1021155654 7:17206621-17206643 GCATGGTGCCTCATATATGGTGG + Intergenic
1022297080 7:29066331-29066353 CCATGGAGCTTTTATTCTGGTGG + Intronic
1022468203 7:30665414-30665436 CCACGGGCCCTTTTATCTGCTGG + Intronic
1027538799 7:79441370-79441392 CCATGATGCCTTTTATCATTGGG - Intronic
1027677296 7:81176145-81176167 ACATGATGCCTTCTATTTGGAGG + Intronic
1029126221 7:98296831-98296853 ATACGGTGCCTCTTATCTGGTGG + Intronic
1030775412 7:113528874-113528896 ACATGCTGCCATTTATCTGATGG - Intergenic
1032821712 7:135530051-135530073 CCATGGTGCCTGATATATTGTGG - Intergenic
1033473422 7:141668649-141668671 CCATGTTGCCTCTTACCTGCAGG - Intronic
1034113360 7:148560061-148560083 CCAGAGGGGCTTTTATCTGGAGG + Intergenic
1034455051 7:151165566-151165588 CCCTGGGCCCTTTTATCTTGTGG + Intronic
1036222778 8:6934578-6934600 CCATGGCTCCTCTTATCTGGAGG - Intergenic
1038770193 8:30471479-30471501 TCATGGTGCCATTTATCTAGTGG - Intronic
1042285806 8:67109137-67109159 CCAGGCTGCCTTTTAACCGGAGG + Intronic
1044951051 8:97435583-97435605 CCATGGTTCCTTCTGTGTGGAGG - Intergenic
1049084370 8:140466573-140466595 CCTTGGTGCATTATATCAGGAGG + Intergenic
1049275823 8:141719694-141719716 CCATGGTGCTTGTTATCTGCAGG - Intergenic
1050755783 9:9001508-9001530 CTGTGGTGCCATTTATCTAGAGG - Intronic
1053575515 9:39355384-39355406 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1053840021 9:42183323-42183345 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054097075 9:60914071-60914093 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054118482 9:61189700-61189722 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1054589274 9:66992864-66992886 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1055987270 9:82063983-82064005 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1056041457 9:82671844-82671866 CCATGTTGCTTATTATCTGAAGG - Intergenic
1056613233 9:88138730-88138752 ACCTGGTTCCTTTTATCTGTTGG + Intergenic
1056663122 9:88559193-88559215 GCTTGGTGCCTTTTCTCTGTTGG + Intronic
1057159907 9:92882297-92882319 ACCTGGTTCCTTTTATCTGTTGG - Intergenic
1058123774 9:101168315-101168337 CCTTGGTGTCTTTTATGTGCTGG + Intronic
1059433439 9:114263331-114263353 CCCCAGTTCCTTTTATCTGGGGG + Intronic
1062702147 9:137912890-137912912 AGATGGTGCCTTTGAACTGGAGG + Intronic
1188934398 X:36155480-36155502 CCATCTTGCCCTTTATGTGGTGG + Intergenic
1189739291 X:44101887-44101909 TGATGGTGCCTTTTATCAAGAGG + Intergenic
1194856723 X:98939786-98939808 CCTTGCTGGCTTTTACCTGGGGG + Intergenic
1194966244 X:100291728-100291750 CATTGTTTCCTTTTATCTGGTGG - Exonic
1196226464 X:113173301-113173323 ACATAGAGCCTTTTTTCTGGAGG + Intergenic
1197498238 X:127212059-127212081 TCATCTTGCCTTTTATGTGGTGG + Intergenic
1199688754 X:150290234-150290256 CTAAGGTGCTTTTTGTCTGGTGG - Intergenic
1199924087 X:152444499-152444521 CCAAGCTGTCTGTTATCTGGTGG + Intronic
1200843918 Y:7811944-7811966 CCATGGTGCCTTTTGTAGGCAGG + Intergenic