ID: 1141338969

View in Genome Browser
Species Human (GRCh38)
Location 16:83185125-83185147
Sequence CGACCAGCTGTAGGACCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 59}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141338969_1141338972 11 Left 1141338969 16:83185125-83185147 CCTAAGGGTCCTACAGCTGGTCG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1141338972 16:83185159-83185181 AGATTTGTATCCAAGCAGCCTGG 0: 1
1: 0
2: 7
3: 39
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141338969 Original CRISPR CGACCAGCTGTAGGACCCTT AGG (reversed) Intronic
902663728 1:17923055-17923077 CGAGCAGCTGCAGAACCCCTGGG - Intergenic
904912315 1:33944596-33944618 CTACTAGCTGTGTGACCCTTCGG - Intronic
906304498 1:44708180-44708202 GGACCACATGTAGGACCCGTAGG - Intronic
910449103 1:87328939-87328961 CGAGCAGCTGCAGGAGCCCTCGG - Exonic
910770541 1:90826944-90826966 AGACCAGCTGTATGTCCCTGAGG - Intergenic
910944046 1:92569228-92569250 TGACCATCTGTATGACTCTTAGG - Intronic
913685942 1:121232123-121232145 AGACCAGCTGCAGGCCCTTTGGG + Intronic
914037793 1:144019726-144019748 AGACCAGCTGCAGGCCCTTTGGG + Intergenic
914151660 1:145048206-145048228 AGACCAGCTGCAGGCCCTTTGGG - Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
920473265 1:206250680-206250702 AGACCAGCTGCAGGCCCTTTGGG + Intronic
923055592 1:230424532-230424554 GCACCAGCTGGAGGTCCCTTGGG + Intronic
1069511530 10:69046216-69046238 GGAGCAGCTGTAGCAGCCTTGGG - Intergenic
1071226730 10:83539249-83539271 CGTCCAGCTGAAGGGCCATTGGG + Intergenic
1079593305 11:22208276-22208298 TCACCTGCTGTAGGACACTTAGG - Intronic
1082102278 11:48182504-48182526 CTACCAGCTGAATGACACTTTGG - Intergenic
1082286573 11:50324062-50324084 AGACCAGCTATAGGCCCTTTGGG + Intergenic
1085055441 11:73400607-73400629 CCAGCAGCTGTGAGACCCTTAGG + Intronic
1090852431 11:130582329-130582351 AGACCAGCAGTAGGACACCTGGG - Intergenic
1093260049 12:16924768-16924790 TGACCACCTGAAGGTCCCTTGGG - Intergenic
1100466316 12:94848958-94848980 CAACCATCTGGAAGACCCTTGGG - Intergenic
1102082325 12:110108438-110108460 CCACCAGCGGTATGACCTTTAGG + Intergenic
1103597820 12:122034899-122034921 CCACCAGCTGCAGGCCCCCTGGG - Intronic
1122097389 14:99381667-99381689 CCACCAGCCCTAGGACCCTTCGG + Intergenic
1122370081 14:101224892-101224914 CGAGCAGCTGGAGGAGGCTTTGG - Intergenic
1125584929 15:40813399-40813421 CCACCTGCTGCAGGACTCTTTGG - Exonic
1133563087 16:6967750-6967772 CGTGCAGCTGTGGGACCCTGGGG + Intronic
1138118733 16:54381169-54381191 TGACCAGATATAGGACCGTTAGG - Intergenic
1141338969 16:83185125-83185147 CGACCAGCTGTAGGACCCTTAGG - Intronic
1142231198 16:88901065-88901087 TGACCTGCTGTATGACCCTGCGG + Intronic
929572724 2:43032847-43032869 CAGCCAGCTGGAAGACCCTTGGG + Intergenic
932419600 2:71593765-71593787 CGCCCAGATGGAGGACCCTCAGG + Intronic
945391823 2:209273990-209274012 GGAACAGCTGTAGCTCCCTTGGG - Intergenic
947938828 2:234030905-234030927 GGAGCTGCTGTAGGACCCATGGG + Intergenic
1172430491 20:34887186-34887208 CAAACAGGTGTATGACCCTTAGG - Intronic
1173004190 20:39127103-39127125 CTACCAGCTGAAGAGCCCTTTGG - Intergenic
1178791643 21:35705664-35705686 CTACCAGCTGTTGGACATTTAGG + Intronic
1179602536 21:42489762-42489784 CCACCAGCTGTGGGACCTTGGGG - Intronic
1181787514 22:25237731-25237753 TGACCATCTGTATGAGCCTTGGG + Intergenic
1182360417 22:29743304-29743326 CCACCAGCTGTAGGGCACTCAGG + Intronic
950094133 3:10318560-10318582 ACACCAGCTGTAGCTCCCTTGGG - Intronic
954573299 3:51660082-51660104 CGACCATCTTCAGGAACCTTTGG - Exonic
961392209 3:126558813-126558835 GGACAAGCTGCAGGACCCTGTGG + Exonic
968652736 4:1766656-1766678 CGACCTGCTGAAGGGCCCTGTGG - Intergenic
968730507 4:2267319-2267341 CTCCCAGGTGTAGGACCCTGAGG + Intergenic
977163150 4:93661938-93661960 CCACATGCTGTAGGACCATTGGG - Intronic
985602528 5:842757-842779 CGTCCAGCTGCAGGACAGTTGGG + Intronic
992110172 5:73485297-73485319 TAAACAGCTGTAGGTCCCTTTGG + Intergenic
997608351 5:135192551-135192573 CTACCAGCTGAAGGCCCCATGGG - Intronic
998459099 5:142296182-142296204 TGACCAGCTGTAAGGCCCTCGGG + Intergenic
1001267211 5:170282484-170282506 CCACCAGCTGTAGGACCTTGGGG - Intronic
1004574266 6:16878585-16878607 CTACCAGCTGAAGGAGCCTTTGG + Intergenic
1006952107 6:37831362-37831384 TGACCAGCTTTTGGCCCCTTTGG + Intronic
1025837320 7:65106377-65106399 AGACCAGCTGCAGGCCCTTTGGG + Intergenic
1025907098 7:65795902-65795924 AGACCAGCTGCAGGCCCTTTGGG + Intergenic
1026040188 7:66861746-66861768 AGACCAGCTGCAGGCCCTTTGGG + Intergenic
1036797270 8:11765353-11765375 CGGCCAGCTGTTGGAAACTTAGG - Intergenic
1055961683 9:81826519-81826541 GACCCAGCTGTAAGACCCTTCGG - Intergenic
1057880710 9:98790821-98790843 CCACCAGCTGCATGACCTTTAGG + Intronic
1061586121 9:131569926-131569948 TCACCAGCTGTTGTACCCTTGGG + Intergenic
1062179899 9:135185686-135185708 GGACCTGCTGTAGGAGCTTTTGG + Intergenic
1186166197 X:6828759-6828781 AGCCCAGCTGTATGACACTTTGG - Intergenic
1196022161 X:111001769-111001791 CTACCAGCTGAGGAACCCTTAGG - Intronic
1200031041 X:153295696-153295718 GGACCAGCAGTAGGACACTTAGG - Intergenic