ID: 1141343116

View in Genome Browser
Species Human (GRCh38)
Location 16:83221677-83221699
Sequence TGGGCTCTGCAGGAGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 457
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141343099_1141343116 26 Left 1141343099 16:83221628-83221650 CCATCTGTTAGGCGAGTGGGGGA 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG 0: 1
1: 0
2: 1
3: 45
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141343116 Original CRISPR TGGGCTCTGCAGGAGGTGCA GGG Intronic
900241012 1:1617224-1617246 TAGGCACAGCTGGAGGTGCAAGG + Intronic
900398913 1:2464922-2464944 TCGGCTCTGCAGGAGGCGTTAGG + Intronic
900426237 1:2580693-2580715 TGGGCTTTGCTGGAGGGGGATGG + Intergenic
900745924 1:4360734-4360756 TGTGGCTTGCAGGAGGTGCATGG - Intergenic
900761787 1:4477415-4477437 TGGGCTCTGTGGGAGGAGAAGGG - Intergenic
900934438 1:5756247-5756269 TGGGTTCTGCAGGCGGAGGAAGG - Intergenic
901023869 1:6268979-6269001 TGGGCTGTGCACGTGGGGCAGGG + Intronic
901126248 1:6930777-6930799 TTGGCTCTGCATGAGGAGTAAGG + Intronic
901194746 1:7434050-7434072 GGGACTCTCCAGGAGGTGGAAGG - Intronic
901529847 1:9846046-9846068 GGGGCTCTGGAAGAGGAGCAGGG + Intergenic
901534470 1:9873298-9873320 TGGGCCCAGGAGGAGGTGGAAGG - Intronic
902060178 1:13635262-13635284 TGGGCTCTGCTGCAGCTGGAGGG - Intergenic
902161259 1:14532230-14532252 TGGGCTTTGGAGGGGGTGGATGG - Intergenic
902740620 1:18435693-18435715 TGGGCTATGAGGGAGGTGGATGG - Intergenic
902805886 1:18861155-18861177 TGGGCCCTGAAGGAGGAGCAGGG - Intronic
903405434 1:23091567-23091589 TTGTCTCCGCTGGAGGTGCATGG + Exonic
904266406 1:29320716-29320738 GGTGCTCTGCAGCGGGTGCAGGG - Exonic
904678986 1:32215785-32215807 TGCCCTCTGCAGGAGGTGGAAGG - Exonic
904813843 1:33181296-33181318 TGGGTGCGGCAGGAGGCGCAGGG - Exonic
905548332 1:38817462-38817484 TGGGATCTGCCTGACGTGCAGGG - Intergenic
906640605 1:47438545-47438567 GGGGCTCTGCAGGATGGCCATGG - Exonic
906667498 1:47631997-47632019 TGGGCTCTCCAGGATGAGAAGGG + Intergenic
907272280 1:53298127-53298149 TGGGGCCTGGAGGAGGTGCTTGG - Intronic
907274743 1:53310968-53310990 CGGGCTCTGAAGCATGTGCAGGG - Intronic
908355721 1:63323510-63323532 CGGGCTCTGCAGGATGGCCATGG - Exonic
910216313 1:84848159-84848181 TGAGCTCTGCAGTGGGTGGAAGG - Intronic
913089269 1:115465643-115465665 TGGGCCCTGAAGAAGGAGCAGGG + Intergenic
913609144 1:120493473-120493495 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
913986301 1:143569191-143569213 TGGGTTCTGCAGGTGGAGAAAGG + Intergenic
914204685 1:145516976-145516998 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914327485 1:146634559-146634581 TTGGCTCTGCTGGAGCTGAAAGG - Intergenic
914348626 1:146821010-146821032 TGGTCTCTGCAGGAGCTGAAGGG + Intergenic
914358352 1:146908278-146908300 TGAGATCTGCTGGAGGTTCAGGG + Intergenic
914370875 1:147023250-147023272 TGGGTTCTGCAGGTGGAGGAAGG - Intergenic
914483808 1:148090163-148090185 TGGGTTCTGCAGGTGGAGGAAGG + Intergenic
914495073 1:148188729-148188751 TGAGATCTGCTGGAGGTTCAGGG - Intergenic
914582048 1:149028366-149028388 TGGGTTCTGCAGGTGGAGGAAGG + Intronic
916852188 1:168714844-168714866 TGGGCTTTGCATGCTGTGCAGGG - Intronic
917630211 1:176884212-176884234 AGGGCAATGCAGGAGGAGCAGGG - Intronic
919124641 1:193379959-193379981 AAGGCTCTGCAGCAGGTCCAGGG - Intergenic
919861459 1:201741488-201741510 TGGGCCCTGGAGAAGGTGAAGGG + Intronic
921266613 1:213425910-213425932 TGGCCTCTGCAGGAGACGCTTGG + Intergenic
922336959 1:224625577-224625599 TGGGCTCTGCTGAAGGCCCATGG + Intronic
923083245 1:230680420-230680442 TGGGAGCTCCAGGAGGTGCAGGG - Intronic
924101734 1:240610753-240610775 ATGGCTCTGCAGCAGGTGCAGGG - Intronic
924671883 1:246136597-246136619 TGGGCTCTGCAGACTGGGCAGGG + Intronic
924741935 1:246799243-246799265 TGGTCTGTGCAGGGGCTGCAGGG + Intergenic
1062815032 10:493116-493138 GGGGCTCTGCACGAGGTCCCCGG + Intronic
1063484151 10:6403413-6403435 TGGGCTCTGCAGGTGTTGGATGG - Intergenic
1063653878 10:7967529-7967551 TGGGCTATGGAGCAGGTACATGG + Intronic
1064168405 10:13006430-13006452 TGGGCTGTGCAAAAGTTGCATGG - Intronic
1064909087 10:20380532-20380554 CAGGATCTGCAGGAGGTGCTTGG + Intergenic
1065831865 10:29621735-29621757 TGGGCTATGTAGGAAATGCAGGG - Intronic
1066442787 10:35454658-35454680 GGGGCCCTGCATGAGGTGCCCGG + Intronic
1067204011 10:44198342-44198364 TGGGCTCTGGAGGAAGGGCCTGG + Intergenic
1067507798 10:46871496-46871518 TGGGATCTGGAGTAGGTGTATGG + Intergenic
1067654453 10:48180349-48180371 TGGGATCTGGAGTAGGTGTATGG - Intronic
1067751307 10:48973590-48973612 TGGACTCAGCCGGAGGGGCACGG - Intronic
1068408629 10:56625921-56625943 GGGGCACTACAGGAGGTGCTTGG - Intergenic
1069710177 10:70483005-70483027 TGGGTTCAGTATGAGGTGCAGGG + Intronic
1070476750 10:76836418-76836440 TGGGCTGAGCAGGGGCTGCAGGG + Intergenic
1070692122 10:78534636-78534658 TGGCCTCAGCAGAAAGTGCATGG + Intergenic
1071148654 10:82606681-82606703 TGGGTTATGCAGCAGCTGCAGGG - Intronic
1072704819 10:97673621-97673643 TGGCATCTGGACGAGGTGCAGGG - Exonic
1073936515 10:108639184-108639206 AGGGCTCTGAAGGAGCTGAAAGG - Intergenic
1075173167 10:120134608-120134630 GTGGCTCTGCAGGAGATGAAAGG - Intergenic
1075399989 10:122154013-122154035 TGGGCTCTGCATGTGGTACCTGG + Intronic
1075779271 10:125006335-125006357 CGTGCCCTGCATGAGGTGCAGGG + Intronic
1075967916 10:126628770-126628792 TGGTTTCTGCAGAAGCTGCAGGG - Intronic
1076101629 10:127784935-127784957 GGGGCTCTTCAGAAGGTGGAGGG + Intergenic
1076485910 10:130816844-130816866 TGGGAACTGCAGCAGGTGGAGGG - Intergenic
1076679205 10:132163049-132163071 TGGCCTCTGCAGAAGGACCAGGG - Intronic
1076699711 10:132265142-132265164 TGGGCTCTGGGGGAGCTGCCAGG + Intronic
1076699731 10:132265205-132265227 TGGGCTCTGGGGGAGCTGCCAGG + Intronic
1076799139 10:132812579-132812601 TGGGCCAGGCAGGGGGTGCAGGG + Intronic
1076896110 10:133313092-133313114 TGGGCCCTGCAGGAGGAGACAGG - Exonic
1077169760 11:1160899-1160921 TAGGCTCTGAAGGAGCTGCAGGG + Intronic
1077216430 11:1397066-1397088 TGTGCTCTGCAGGAAGTTAACGG + Intronic
1077295999 11:1826572-1826594 TGGGCTCTCTGGGAGGTGGATGG - Intergenic
1077553697 11:3215757-3215779 TGGGCTCAGCAGTGGGTGCCGGG + Intergenic
1078157936 11:8814752-8814774 TGGGCCCTGCACAAAGTGCAGGG - Intronic
1079361201 11:19771898-19771920 TGGGGTCTGCAGGGGGTTGAAGG - Intronic
1081853638 11:46290607-46290629 TGGGGTCTGCAGGAGGGGAAGGG + Intronic
1082280692 11:50268139-50268161 TGGCCTCGGCCGGAGGGGCAAGG - Intergenic
1083304081 11:61753786-61753808 GTGGCCCTGCAGGAGGGGCAGGG - Intronic
1083310140 11:61779761-61779783 TGGGCTCTGCTGGAGGTCGGAGG - Intronic
1083546004 11:63549905-63549927 AGGGCTCTGCAGGAAGGGCCAGG - Intergenic
1083745409 11:64733448-64733470 TGGGGCCTGCAGGAGGTGGAGGG + Intronic
1083878572 11:65537390-65537412 TGGGCACTGGAGGAGGGGAAAGG - Intronic
1083924228 11:65796319-65796341 TTGGCTCAACAGGATGTGCAGGG - Exonic
1084480309 11:69416095-69416117 TGGGCTCTGCAGGAGGGCCAGGG - Intergenic
1084548445 11:69826119-69826141 TGAGCTCTGGAGCAGGTGGACGG + Intergenic
1084566272 11:69930767-69930789 GGGGCTATGCAGGAGGACCAGGG - Intergenic
1085357256 11:75849944-75849966 GGGGCTCTCCAGGGGCTGCAAGG - Intronic
1085533004 11:77202789-77202811 TGAGCTCTACAGGGGGCGCAGGG + Intronic
1087153410 11:94878771-94878793 TGGGCTCTGCAGTAGAAGCCAGG + Intergenic
1087905673 11:103694256-103694278 TGTGCTCTGCAGTATGGGCATGG - Intergenic
1088579072 11:111299090-111299112 TGGGCCCTGCGGGCGGGGCACGG + Intronic
1089104248 11:115988995-115989017 TTGGCTTTGCTGGAGATGCAAGG + Intergenic
1089310441 11:117554999-117555021 TGGGGTCTACAGGAGATGCAAGG - Intronic
1089466577 11:118689892-118689914 TGGGCACTGCAGGGGCTGCTGGG - Intergenic
1089593452 11:119559868-119559890 TGGGGGCTGCAGGAGCAGCAAGG - Intergenic
1090334238 11:125951969-125951991 TTGGGCCTGCAGGAGGTGAACGG - Intergenic
1090362483 11:126183191-126183213 TGGGCACTGAAGGAGGTGGGAGG - Intergenic
1091351435 11:134900309-134900331 TGGGCTCTGCAGGGAGAGCAGGG - Intergenic
1091662257 12:2393165-2393187 TGGGCTCACTAGGAGGGGCAAGG + Intronic
1091910805 12:4229315-4229337 TGGGGACTGCATGAGATGCATGG - Intergenic
1092428323 12:8390776-8390798 TGGGGTGGGGAGGAGGTGCAGGG - Intergenic
1092535164 12:9380068-9380090 TGGGCTCAGCTGGATGTGCAAGG + Intergenic
1094056764 12:26275964-26275986 TGGGTGCTGCAGGAAGTTCAGGG + Intronic
1096197738 12:49659336-49659358 TAGCCTCTGCAGGAGTTGAATGG + Intronic
1096595535 12:52692700-52692722 AGGGCATTGTAGGAGGTGCAGGG + Intronic
1096615604 12:52831562-52831584 TGGGCACTGCTGCAGGAGCAGGG - Exonic
1096875964 12:54630761-54630783 TGGGCCCTGGAGGAAGTGCAGGG - Intergenic
1097615646 12:61880805-61880827 TGGGCTCTGGGGCAGCTGCAGGG - Intronic
1097959078 12:65514803-65514825 TGGGGTCTCCAGGAGTAGCAAGG + Intergenic
1098381982 12:69879279-69879301 GGTGCTCTGCAGCGGGTGCATGG - Intronic
1100262189 12:92942678-92942700 TGAGGTCTGCAAGAGGTGCCAGG - Intergenic
1101416603 12:104513983-104514005 TGGGCTTAGCAGGGGCTGCAGGG + Intronic
1101957337 12:109222929-109222951 TGTGCTCTGCAGATGGTGAAAGG - Intronic
1102539485 12:113608345-113608367 TGAGACCTGAAGGAGGTGCAGGG - Intergenic
1102551401 12:113694718-113694740 TGACCCCTGCAGGAGGGGCATGG - Intergenic
1103564773 12:121810166-121810188 TGGGCTCTTCCGGGGGTGGAGGG - Exonic
1103701798 12:122851915-122851937 TGGGCTCTGCAGATGGCCCAAGG - Intronic
1103706196 12:122874337-122874359 TGAGCTCTTCAGGAGGGGCCAGG + Intronic
1105833861 13:24191827-24191849 TGAGGTATGCAGGAGATGCAAGG - Intronic
1106435503 13:29720202-29720224 TGGCCTCTGCAGGAGGAGGGAGG + Intergenic
1107997195 13:45872691-45872713 TGGTCTCTGCAGGGAGGGCAGGG - Intergenic
1108478308 13:50843003-50843025 GGGACTCAGCAGGAGGGGCAGGG - Intronic
1112378437 13:98865682-98865704 TGGGCTCTGTACCAGGTGGAAGG + Intronic
1113927965 13:113951674-113951696 TGGGGCCTGGAGGAGGAGCAGGG - Intergenic
1116648369 14:47559392-47559414 TGCGCTTTGCAGGAGGAACATGG - Intronic
1117519359 14:56534842-56534864 TGGGCTCTGCTGGCGGTGCTGGG + Intronic
1118759580 14:68871835-68871857 TGGGCCCAGCAGGAGATGTAAGG - Intergenic
1119115642 14:72018677-72018699 TGGGCTCTGCCCGAGGTAGAAGG - Intronic
1119382684 14:74239258-74239280 TGGGCTCTGCAGGATGCCCATGG - Intergenic
1121333284 14:93061357-93061379 TGGGCTCTGGAGGAGGTGGGTGG - Intronic
1121850794 14:97219557-97219579 TGGGCGCTGCAGGATGCGCCTGG + Intergenic
1121940944 14:98070050-98070072 TGGGCTTGGCAAGAGGTGAAAGG + Intergenic
1122152385 14:99732039-99732061 TGGGCTCAACAGCAGGGGCAAGG - Intergenic
1122257108 14:100486577-100486599 TGGACTCGGCAGGAGGACCAGGG + Intronic
1122301395 14:100733239-100733261 TGGGCTCTGAAGGAATTTCAAGG - Intronic
1122783128 14:104152142-104152164 AGGGGCCTGCAGCAGGTGCATGG - Exonic
1123687150 15:22806852-22806874 TCTGCCCTGCAGGAAGTGCATGG - Intronic
1123701400 15:22917169-22917191 CTGGCTCTGCAGGAGGGTCAGGG - Intronic
1123990001 15:25676085-25676107 TGGGCTCTGCAGCAGTGGCAGGG + Intergenic
1124175401 15:27419187-27419209 TGGAAGGTGCAGGAGGTGCAGGG - Intronic
1124686652 15:31788666-31788688 TGGCAGCTGCAGGAGGTGGAAGG + Intronic
1125543814 15:40488253-40488275 TGGGCTCTGCAGCAGGCGCGGGG + Intergenic
1125599549 15:40907694-40907716 TGGGCCCTGCAGCAGGTTGAGGG + Intergenic
1127361343 15:58247422-58247444 TGGGCTCTGGAGGAGCTTAAAGG + Intronic
1129172898 15:73818595-73818617 TGCTCTCTGCAGCAGCTGCAGGG - Intergenic
1129325666 15:74799044-74799066 GGGCCTCAGGAGGAGGTGCAGGG + Intronic
1129539657 15:76339769-76339791 TGGGCTCTGAAGGAGGGGAAGGG + Intronic
1129590918 15:76914411-76914433 AGGGCTCTGTAGCAGGTCCAGGG + Intergenic
1130420329 15:83739740-83739762 TTGGCACTGGAGGAGGTGAAGGG - Intronic
1131111485 15:89767559-89767581 TGGGCCCTGAGGGAGCTGCAGGG - Intronic
1132534005 16:468005-468027 GGGGCGTTGGAGGAGGTGCAGGG + Intronic
1132534017 16:468047-468069 GGGGCGTTGGAGGAGGTGCAGGG + Intronic
1132539816 16:503481-503503 TTGGCTCTGCAGTAACTGCAGGG - Intronic
1132607712 16:800441-800463 TGGGCACTGCAGGCGGCGCACGG + Intronic
1132891539 16:2207180-2207202 TGAGCTCTGCCTGGGGTGCAGGG - Exonic
1133019952 16:2963021-2963043 TGTGCTCTGGAGGAGGGGCGTGG - Intergenic
1133026546 16:2991193-2991215 TGGGCTCTGGAGGGAGGGCAGGG + Intergenic
1133239316 16:4405053-4405075 TGGGCTCTGCAAGAGGGACATGG - Intronic
1133390546 16:5406750-5406772 TGGGTCCTGCAGGAGGGGCTGGG + Intergenic
1133404855 16:5515318-5515340 GGGGCTTTGCAGCAGGTGCTGGG - Intergenic
1136098459 16:27975517-27975539 TGTCCTCTACAGGACGTGCAGGG + Intronic
1136275217 16:29175783-29175805 TGGTCCCTTCTGGAGGTGCAGGG - Intergenic
1137486635 16:48896541-48896563 TGGTATCTGCAGGAGCTGGAAGG - Intergenic
1137774184 16:51041792-51041814 TTGGCTCTGCAGGAGCTGCCGGG - Intergenic
1139402059 16:66690517-66690539 TGTTCTCTGGAGGATGTGCAGGG - Intronic
1139433097 16:66921631-66921653 TGGGCGCTTCAGGAGCTGGAAGG - Intergenic
1139438726 16:66952962-66952984 TGGGGACTTCAGGAGGTGAAGGG - Intergenic
1139985412 16:70894538-70894560 TGGTCTCTGCAGGAGCTGAAGGG - Exonic
1140006076 16:71076381-71076403 TTGGCTCTGCTGGAGCTGAAAGG + Intronic
1140808342 16:78553786-78553808 GGGGGTCTGCAGGACCTGCAGGG - Intronic
1140853457 16:78956074-78956096 AGGGCTCTGCCGGAGGTATACGG - Intronic
1141343116 16:83221677-83221699 TGGGCTCTGCAGGAGGTGCAGGG + Intronic
1141629035 16:85276904-85276926 CGGGCTCTGGAGAAGGTGCTGGG + Intergenic
1141675329 16:85514463-85514485 TTGGCTCTGGAGGAGGGACAGGG + Intergenic
1142137681 16:88459143-88459165 GGGCCTCTGAAGGAGCTGCATGG - Intronic
1142280739 16:89146366-89146388 AGGCCCATGCAGGAGGTGCATGG + Intronic
1142282062 16:89153883-89153905 TGGTGACTGCAGGAGGTGCCCGG - Intronic
1142312808 16:89323708-89323730 AGGGCTCTTCAGAACGTGCAGGG - Intronic
1142417371 16:89949759-89949781 TGGGCTCTAGAGGAGGGGCAGGG + Intronic
1142743593 17:1943837-1943859 TGGGGTGTGCAGGATGGGCAGGG + Intronic
1143639713 17:8189131-8189153 CGGGCTCTGCAGCCGGTTCAGGG - Exonic
1143860653 17:9888200-9888222 CTGGCTCTGCTGGAGATGCAAGG + Intronic
1143914187 17:10276647-10276669 TGGGCTCTCCAGGGGAGGCAGGG + Intergenic
1143919235 17:10317753-10317775 TGGGAGCTGCAGAAGGTTCAAGG + Intronic
1145086515 17:19946753-19946775 TTGGCACAGCTGGAGGTGCAAGG - Intronic
1145828627 17:27897194-27897216 TGGGATCTAAAGGAGGAGCAGGG - Intergenic
1146675496 17:34770931-34770953 TGGGGATTGCAGGAGGTCCATGG + Intergenic
1146693626 17:34893028-34893050 CGGGCTCTGCAGAGGGTGCGTGG + Intergenic
1147574286 17:41589540-41589562 TGGGCTCTGGAGGTGCTGCCTGG - Intergenic
1148552730 17:48560154-48560176 TGGGGGCTGCAGGGGGTGCTGGG + Intronic
1148759079 17:49990150-49990172 TGGGTTTTGTGGGAGGTGCAGGG - Exonic
1150480351 17:65504250-65504272 TGGGCCTGGCAGGAGGTGCTTGG - Intergenic
1151320044 17:73347575-73347597 CTGGCTGTGCAGGAGGTGCCAGG - Intronic
1151325807 17:73379287-73379309 TGGGCACTGGAGGGCGTGCAGGG + Exonic
1151576141 17:74953469-74953491 TGGTCTCTGCAGTAGGGGCTGGG - Intronic
1152571961 17:81124887-81124909 TGGGCTGGGCATGAGGGGCAGGG - Intronic
1152678944 17:81655877-81655899 CGGGCTCTGCAAGGGGTGCTGGG + Intronic
1152970816 18:159038-159060 TGGGCCAGGCTGGAGGTGCAGGG + Intronic
1153692142 18:7604516-7604538 TGGGCCCTGGAGGGGCTGCATGG + Intronic
1153971575 18:10231895-10231917 TGGTCTCTGCATGAGAGGCAGGG - Intergenic
1157309036 18:46538128-46538150 TGGGCTCAGCAGGCTGTCCAGGG - Intronic
1157454208 18:47811590-47811612 TGGGGTCTGGAGGAGATGCATGG - Exonic
1157570198 18:48707104-48707126 TGGGGAGTGCAGGAGGTGGAGGG + Intronic
1158301947 18:56062377-56062399 TAGGCACTGCAGGAGCTCCAGGG + Intergenic
1158635334 18:59151171-59151193 TGGCCTCTGCAGTCTGTGCAGGG + Intronic
1160508650 18:79441225-79441247 CGGGCCCTGAAGGAGGGGCAGGG + Intronic
1160818573 19:1047495-1047517 CTGGCTCTGCTGGAGGAGCAGGG + Exonic
1160971088 19:1768065-1768087 AGGGTCCTGGAGGAGGTGCAGGG + Intronic
1161318813 19:3631708-3631730 TGGGCTGTGCAGGAGGCCGACGG + Exonic
1161843147 19:6694401-6694423 TGGGGTCTCCAAGAGGGGCAGGG + Intronic
1161878201 19:6928242-6928264 TGTGTTCTGAAGGAGGAGCAAGG + Intronic
1162026761 19:7898766-7898788 GGGGCCCTGCAGGAGGTTAAAGG + Exonic
1162802517 19:13118907-13118929 TGGGCGCTGGAGGAGGTGGGTGG + Intronic
1163168563 19:15514819-15514841 TGGGCACTGCAGGAAGTGGTGGG + Intronic
1163573502 19:18097610-18097632 TGCGCTCTGCTGGAGGGGCGGGG + Intronic
1164017022 19:21262343-21262365 GTGGCAATGCAGGAGGTGCAAGG + Intronic
1164557658 19:29266098-29266120 TGTGCTGTGCTGGAGGAGCAGGG - Intergenic
1164675663 19:30098864-30098886 TGGCCCCAGAAGGAGGTGCATGG - Intergenic
1165124541 19:33584343-33584365 TGGCCTCAGCAGGAGGTGAGTGG - Intergenic
1165508895 19:36254615-36254637 TGGCCTCTGAAGGAAGTGCTTGG - Intergenic
1165941040 19:39414984-39415006 TGGGGGCTGCAGGAGCTGCTGGG - Exonic
1167377582 19:49119930-49119952 TGGGCCCTGGAGGAGGCGCGAGG - Intronic
1167410038 19:49339084-49339106 CGGGGTCTGCAGGAAGGGCAGGG + Intronic
1167590831 19:50403384-50403406 TGGGTTCTGCAGGATTTTCAGGG + Intronic
1168703473 19:58455033-58455055 CTGGCTCTGCAGGAGGGGCTGGG - Intronic
925182703 2:1827300-1827322 TGTGATCTGCAGGAGGTGGAAGG - Intronic
925208687 2:2028266-2028288 CAGGCTCTGCAGGAGGAGCCTGG + Intronic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
927054442 2:19356235-19356257 TGGGCTCCGTAGGGGGTGCCGGG + Intronic
927212424 2:20646967-20646989 TGGGCTCTGGAGCAGCTGCCTGG - Intronic
927484367 2:23478669-23478691 CGGGCTCTGGAGGTGGTGAAGGG + Intronic
929074654 2:38070522-38070544 TGGGCTATGCAGGAGCTTCTGGG - Exonic
929544398 2:42846240-42846262 TGGGCTGGGCAGGAGGGTCACGG + Intergenic
930116212 2:47720570-47720592 TGGGCTCTGACTGAGGAGCAAGG - Intronic
930664018 2:54084123-54084145 TGGGCTTTGGTGGAGGTGAAAGG + Intronic
931829125 2:66032371-66032393 TGGGCTCTGCAGCTGCTGCAAGG - Intergenic
932558959 2:72850680-72850702 TGGGAGCTGAAGGAGGTGGAAGG - Intergenic
932837035 2:75047389-75047411 TAGGCTCTTCAAGAGCTGCAGGG + Exonic
933701379 2:85257681-85257703 TGGGCTCCCCAGGGGATGCAAGG - Intronic
934515009 2:94981021-94981043 TGGTCTCTTCAGGAGGTGATGGG - Intergenic
934947013 2:98549685-98549707 TGGGCCCTGCTGGAGGTGTCAGG + Intronic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
936145575 2:109978510-109978532 TGGGCGGGGCAGGAGGTGGAGGG - Intergenic
936199111 2:110392968-110392990 TGGGCGGGGCAGGAGGTGGAGGG + Intergenic
937017440 2:118618885-118618907 GGGGCACAGCAGGAGGGGCAGGG - Intergenic
937120702 2:119438345-119438367 TGGACTCTGCAGGGGGTGAGGGG + Exonic
937919221 2:127118529-127118551 TGGGCACGGGAGGAAGTGCAGGG + Intergenic
939696482 2:145331490-145331512 TGCCCTCTGAAGGAGGTGCTGGG - Intergenic
940374880 2:152946446-152946468 TGGGCTCTGCAGGCTGTACAAGG - Intergenic
942119672 2:172764514-172764536 TGGGCTCGGCAGGATGTGGGTGG + Intronic
942265777 2:174224319-174224341 TGGGCTCTGCTGGAGAGGAATGG - Intronic
942777123 2:179595477-179595499 TGGGCTGTGGCAGAGGTGCAGGG + Intronic
946188067 2:217992386-217992408 GGGGCTCTGGAGCAGGTGCAAGG - Intronic
946277506 2:218642546-218642568 TGGTCTCTGCAGGAGAGCCAGGG + Exonic
946345219 2:219104200-219104222 TTGGCCCTGCAGGTTGTGCATGG - Intronic
946956901 2:224940776-224940798 TGCTCTCTGTAGGAGGTGCCTGG + Intronic
948166364 2:235865653-235865675 GGTGCTCTGGAGGAGGGGCAGGG + Intronic
948541286 2:238692963-238692985 TGCTGTCTGCAGCAGGTGCATGG + Intergenic
948893238 2:240916977-240916999 TGGGCCCAGGAGGAGGAGCAGGG + Intergenic
948942458 2:241203262-241203284 TGGGCACTGTTGTAGGTGCAGGG - Intronic
1169195125 20:3678664-3678686 AGGGCTCTCTAGGAGGGGCAGGG + Intronic
1169258541 20:4118343-4118365 TGAGCGCTGCAGGAGGCACAAGG + Intergenic
1169871569 20:10253952-10253974 TGGGCTCTGTGGGAGGAGGAGGG - Intronic
1170728028 20:18947290-18947312 TGTGCTTTGCAGGAGGTGGTGGG - Intergenic
1170897359 20:20427634-20427656 GGGCCACTGCAGCAGGTGCATGG - Intronic
1172391969 20:34571664-34571686 TGGGCTGCGCAGGACATGCAAGG + Intronic
1173249033 20:41354883-41354905 GGGGCTCTGCAGGGGGAGCCTGG + Intronic
1174238521 20:49114339-49114361 TGGGTACTGCAGGAGGTGGTGGG + Exonic
1174404540 20:50294849-50294871 TGGGGTCTGCACGCGGTGGAAGG - Intergenic
1175785246 20:61708076-61708098 TGGGCTCTGCTGGGGGTCCCGGG + Intronic
1175787828 20:61723292-61723314 GGGGGTCCGGAGGAGGTGCAGGG - Intronic
1175968010 20:62669296-62669318 TGGGCTTTGCTGGAGCTGCTGGG - Intronic
1176057569 20:63156655-63156677 TGGGCTCTGCAGGAAGCGCTGGG - Intergenic
1178407811 21:32338834-32338856 TGGGCTGTACAGGAGCTGTACGG + Exonic
1178884096 21:36471632-36471654 TGGGCTCTGCTGGATTTCCAAGG - Intronic
1179177647 21:39020869-39020891 TGGGCTGAGAAGGAGGTGCCCGG - Intergenic
1179722975 21:43325794-43325816 TGGGCTCTGCTGGACTTGCTGGG + Intergenic
1179954789 21:44732541-44732563 TGAGCCCTGCAGGACGTGCCCGG - Intergenic
1180126464 21:45793665-45793687 GGGGCTCTGCAGGAGGAGACGGG + Intronic
1180605632 22:17057034-17057056 TGGGCTCAACTGGATGTGCAGGG - Intergenic
1180724839 22:17939169-17939191 GGGACTCTGCAGGCCGTGCAGGG - Intronic
1180728034 22:17960889-17960911 CGAGCTCAGCAGGAGGTGCTGGG + Intronic
1180982228 22:19884216-19884238 TGGCCTCTGCAGGAGGTGGCAGG + Intronic
1181061423 22:20283828-20283850 GGGGCTTGGCAGGAGCTGCAGGG + Intergenic
1181116526 22:20635399-20635421 TGGGCAGGGCAGCAGGTGCAGGG - Intergenic
1181141024 22:20804973-20804995 TGGGCTGTGAAGGACGAGCAGGG - Exonic
1181184540 22:21093527-21093549 AGGGCTGTGCAGGATGTGCCTGG + Intergenic
1181514079 22:23401683-23401705 TGGCCTCTGCTGGAGAGGCAGGG + Intergenic
1181975467 22:26726199-26726221 TGGGCTCTGCATGGGGAGCTCGG + Intergenic
1182441271 22:30365763-30365785 TGGACTCTGCAGTATGTGCTTGG + Intronic
1182454305 22:30440024-30440046 GTGGCTCTGCAGCAGTTGCAGGG - Intergenic
1182615387 22:31585440-31585462 TGGGACCTGCAAGAGGTACAGGG + Intronic
1183015416 22:34982491-34982513 TGGGCTCTGCAAGATATGTAAGG + Intergenic
1183509307 22:38225687-38225709 TGAGCTCTGCTGGAGGTGTGGGG - Intronic
1183741461 22:39670786-39670808 GGGCCTCTGCAGGTGGTGCAGGG - Exonic
1183966847 22:41447257-41447279 TGGGCTCCGAGGCAGGTGCAGGG - Intergenic
1184098620 22:42329880-42329902 TGGGCTCAGTGGGAGGTGGAGGG + Intronic
1184553469 22:45218649-45218671 TGGGCTCTGTTGGAGGGGCTGGG - Intronic
1184643664 22:45885021-45885043 GGGGCTGGGCAGGAGGTGCTGGG + Intergenic
1184668015 22:45998637-45998659 TGGGCTCTGCGGGCCGGGCAGGG - Intergenic
1184894906 22:47401213-47401235 AGGGCTCTGCTGTAGGTGCTGGG - Intergenic
1185089036 22:48755683-48755705 CAGGCTGTGCAGGAGGTGCCAGG - Intronic
1185221392 22:49630731-49630753 AGGCCTCTGCAGCAGCTGCACGG + Intronic
952385806 3:32840819-32840841 AGGGCTCAGCTGGGGGTGCAAGG + Intronic
952840728 3:37643148-37643170 TTGGCTCAGCAGGAGGGGAAAGG + Intronic
954125468 3:48525468-48525490 GGGGCTCTGCAGGGGCTGCGTGG - Intronic
955337123 3:58096050-58096072 GGGGTTCTGCAGGAGCTGCCAGG - Intronic
955408791 3:58642674-58642696 TGTGTCCTGCAGGAGATGCAGGG + Intronic
959311230 3:104740278-104740300 TGGCCTCTGGAGGAGATGAATGG + Intergenic
961077095 3:123992275-123992297 TGGGCTTTGCTGGTGGTGGAAGG + Intergenic
961307481 3:125969025-125969047 TGGGCTTTGCTGGTGGTGGAAGG - Intergenic
961314049 3:126022457-126022479 TGTGGTCTGGAGGTGGTGCAGGG + Intronic
961643803 3:128381749-128381771 TGGGGCCTGCAGGAAATGCAGGG + Intronic
962927682 3:140010601-140010623 TGGACACAGCAGGAGGTTCATGG - Intronic
963056250 3:141188528-141188550 AGGGGTATGCAGGAGGTGTAGGG + Intergenic
964323188 3:155519205-155519227 TGGTCCCTGCTGCAGGTGCATGG - Intronic
965737709 3:171839205-171839227 TGGGATGTGCAGGAAATGCAAGG - Intergenic
966900591 3:184481185-184481207 TGGGCTCAGCAGGGGATGCAGGG + Intronic
967878411 3:194282037-194282059 TGGGCTTTGGAGGAGGCGCCTGG - Intergenic
968452345 4:681505-681527 TGGGGTCTGGGGGAGGTGCGGGG - Intronic
968605230 4:1532249-1532271 TGGGCTATGAGGGAGGAGCAGGG + Intergenic
968713382 4:2137080-2137102 TGGGCTGTGTAGTAGGTGCTGGG - Intronic
968907439 4:3461216-3461238 TGGGCTCCACACGAGGGGCAGGG - Intergenic
968945667 4:3662262-3662284 AGGGCTCTGCCGGAGGCTCAAGG - Intergenic
969053719 4:4388945-4388967 TAGGCTTTGCAGGAGGGGCAGGG + Intronic
969112155 4:4850993-4851015 TGGGCTCTGCGGGAGGGGGTGGG - Intergenic
969576297 4:8038001-8038023 TGGGCTCCCCAGGAGCTGCCGGG + Intronic
979179419 4:117707190-117707212 TGGCCTATGCAGGAGTGGCAGGG + Intergenic
985103003 4:186476487-186476509 TGGGGTCTGCGGGGGCTGCAGGG - Intronic
985621993 5:960676-960698 AGGCCTCTGCAGGAGTGGCAGGG - Intergenic
985998644 5:3612828-3612850 TGAGCCCTTCAGGAGGTGGAAGG - Intergenic
987296727 5:16559441-16559463 TGCTCTCTGCAGGAAGTGGATGG - Intronic
992500795 5:77340900-77340922 AGGGCTCTTAAGAAGGTGCAGGG + Intronic
993995673 5:94719652-94719674 TGGGATCTGCAGGTGGTGTGCGG + Intronic
994699179 5:103111823-103111845 TGGTCTCTCCAGGAGGTAAATGG - Intronic
995145359 5:108782367-108782389 TGGTCTATGCAGGAGGTTGAAGG - Intronic
996815202 5:127566609-127566631 TGGGCTCTGGGGGAGGTGGCAGG - Intergenic
997511215 5:134455892-134455914 TGGGCTTTGAAGGATGAGCAGGG - Intergenic
998224770 5:140318434-140318456 AGGTCTCTGCATGGGGTGCAGGG + Intergenic
998307907 5:141096929-141096951 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998308543 5:141102782-141102804 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998310450 5:141124128-141124150 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998311606 5:141137564-141137586 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998312889 5:141152384-141152406 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998315076 5:141174962-141174984 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998316193 5:141184692-141184714 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998316755 5:141189451-141189473 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998317389 5:141194691-141194713 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998318055 5:141201907-141201929 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998319016 5:141211040-141211062 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998320561 5:141225638-141225660 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998321571 5:141236687-141236709 GCGGCTGTGCAGGAGGAGCAGGG + Intergenic
998322130 5:141242043-141242065 GCGGCTGTGCAGGAGGAGCAGGG + Intergenic
998322794 5:141247711-141247733 GCGGCTGTGCAGGAGGAGCAGGG + Exonic
998473903 5:142404905-142404927 TGGGCTCTGCAGGCCTGGCAAGG + Intergenic
999046790 5:148478349-148478371 TGGATTCTGCAGGAGGTTCTGGG + Intronic
999103063 5:149043321-149043343 TGGGCATTGGAGGAGGGGCAGGG - Intronic
999721196 5:154400463-154400485 TGGGCTCTGGAGCTGGTGTAGGG - Intronic
1001628721 5:173158618-173158640 TGGGCTCTGAAGGCCGTGCCTGG + Intronic
1001717628 5:173829618-173829640 TGGGCTCGGCATGAGGGGCAAGG - Intergenic
1002069790 5:176672338-176672360 TGTCCTCTGCAGGACCTGCAGGG - Intergenic
1002675701 5:180910788-180910810 TGAGCTCAGGAGGAGGTGTAGGG - Intronic
1004280378 6:14275291-14275313 TGGCCTCTTCATGAGGGGCATGG - Intergenic
1004449170 6:15728853-15728875 TGAGCTCTGCAGGAGAGGGAAGG - Intergenic
1004719547 6:18255399-18255421 TGGGCTGAGGATGAGGTGCAAGG - Intronic
1005039998 6:21592940-21592962 TGGGCTATGCAGGATTTACAGGG + Exonic
1005107891 6:22245423-22245445 GGGGCTGTGGAGGAGGGGCATGG - Intergenic
1006155857 6:32012407-32012429 GGGGCTCTTCAGGAGGCTCAGGG + Intergenic
1006162190 6:32045261-32045283 GGGGCTCTTCAGGAGGCTCAGGG + Exonic
1006412335 6:33881575-33881597 CAGGCTCTGCAGGGGGTGCCAGG - Intergenic
1007337369 6:41163227-41163249 TGGGGTCTGGAGGCGGTGCAGGG + Intergenic
1007722616 6:43894197-43894219 TATGCTCTGCAGGAGTGGCAGGG + Intergenic
1010296185 6:74199449-74199471 GGGGCTCTGCAGCTGCTGCAGGG - Intergenic
1011095765 6:83660178-83660200 TGACCTCTGCAGTAGGTCCATGG - Intronic
1012533912 6:100272491-100272513 TGGGCTCTTGAGGACTTGCAGGG + Intergenic
1013292586 6:108732165-108732187 TGTGCACTGCAGGAGGTGCCCGG + Intergenic
1013385469 6:109625473-109625495 GGGGCACTGCAGGAGGTGAGCGG + Intronic
1013896723 6:115097553-115097575 TGTCCTCTGCAGGACGTGAACGG - Intergenic
1019328347 7:450726-450748 TGGGCTCTGCGGGAGGGGCTGGG - Intergenic
1019608227 7:1920945-1920967 CGAGCTTTGCAGGAGGAGCAGGG - Intronic
1026528199 7:71174173-71174195 TGGGCTCTGCTCCAGGTGCCCGG + Intronic
1027056461 7:75053094-75053116 TGGGGTCTGGGGGTGGTGCACGG + Intronic
1027056527 7:75053274-75053296 TGGGGTCTGGGGGTGGTGCACGG + Intronic
1027125784 7:75555848-75555870 TGGACTCTGCAGGCAATGCAGGG + Intronic
1027255854 7:76430381-76430403 TGGCCTCAGCATGGGGTGCAGGG + Intronic
1027998962 7:85466774-85466796 CCAGCTGTGCAGGAGGTGCAAGG + Intergenic
1028088064 7:86661408-86661430 TGGGCCCTGCGGTAGGTGCTGGG + Intronic
1028453882 7:91017551-91017573 TAGGCTCAGCAGTAGGTGCTTGG + Intronic
1029259551 7:99292541-99292563 TGGGCTGGGCAGGTGGTGCTGGG + Intergenic
1029553656 7:101252495-101252517 TCAGCTCTGCAGGAGGGGCGCGG + Intergenic
1029736448 7:102468282-102468304 GTGGCACTGCAGGAAGTGCAGGG - Exonic
1032083632 7:128872582-128872604 TGGGCTCTGCAGGTCCTCCAGGG + Intronic
1032405110 7:131650142-131650164 GGGGCTGTGCTGGAGGTGCCTGG + Intergenic
1032521102 7:132545859-132545881 TGGACCCTGCAGGAGGTGGCTGG + Intronic
1033411966 7:141126300-141126322 TGGGGCCTGGAGGAGGTGAATGG + Intronic
1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG + Intergenic
1035242732 7:157542795-157542817 TGGGCTCTGAGTAAGGTGCACGG - Intronic
1035415989 7:158686973-158686995 TGGAATCTGCAGGAGCAGCAGGG - Intronic
1036029812 8:4956827-4956849 TGACTTCTGCAGGAGGTGCGTGG - Intronic
1036176572 8:6543869-6543891 TGGGCTTTGCAGAAGCTGAAAGG + Intronic
1036359116 8:8065291-8065313 TGGGGTGGGGAGGAGGTGCAGGG + Intergenic
1036832063 8:12028403-12028425 AGGGCTATGCAGGACGTGCCTGG - Intergenic
1036891842 8:12601661-12601683 TGGGGTGGGGAGGAGGTGCAGGG - Intergenic
1037969829 8:23164131-23164153 TGGGCCCTCCTGGAGGTGCTGGG - Intergenic
1038056999 8:23869009-23869031 TGGGCTTTTCAGAAGGTGGAGGG + Intergenic
1038257419 8:25962979-25963001 TGTGCTCTTCTGGAGGGGCAGGG + Intronic
1039745881 8:40426233-40426255 TGGGGTCTTCAGGAGGTGATGGG + Intergenic
1040933921 8:52764038-52764060 CAGGCACTGCAGGAGGTGCTTGG + Intergenic
1041452885 8:58025937-58025959 TGGATTGTGCAGGAGGTCCATGG + Intronic
1045475634 8:102550086-102550108 TGAGCTCTGAATGAGGTGGAAGG + Intergenic
1047770101 8:128024107-128024129 TGGGCTCTGCAGACGGTGGTGGG - Intergenic
1049254947 8:141608785-141608807 TGGGAGCTGCATGAGGAGCAGGG + Intergenic
1049707395 8:144049239-144049261 TGGGCCCTGCACCAGCTGCAGGG + Intergenic
1049732674 8:144186500-144186522 TGGGTTCAGCAGCAGGGGCATGG - Intronic
1050301350 9:4261933-4261955 AGGGCTCTCCAGCAGATGCAGGG + Intronic
1051145901 9:14027154-14027176 TGGGCTGGGCAGGAGGTGAGAGG - Intergenic
1052956474 9:34256427-34256449 TGGGTTCTCCAGGAGGGACATGG + Exonic
1057866644 9:98686909-98686931 TGGGCTCTGCTGGAAGTACAGGG - Intronic
1057906302 9:98986075-98986097 TGGGCAATGCAGGAGCTACAGGG + Exonic
1057913714 9:99039885-99039907 GGGGATCTGCAGGAGAGGCAGGG - Intronic
1058289154 9:103215464-103215486 TGGGCTCTGCTAGATGAGCAGGG + Intergenic
1059325464 9:113501591-113501613 TGGGCTCTGCAAGGTGTGCTCGG + Intronic
1059537065 9:115090769-115090791 TGGGCTCTGAAGGCGGTGCCAGG + Exonic
1060470328 9:123943078-123943100 TGGGGTCTGGGGGAGGAGCATGG + Intergenic
1060665947 9:125432223-125432245 TGGGCTCTGCAGCAGATCCTCGG + Intergenic
1060978422 9:127778853-127778875 TGGCCTCAGCAGCAGGGGCAGGG + Intergenic
1061074619 9:128333583-128333605 AGGGCTCTGCGGGAGGAGCTGGG + Exonic
1061620112 9:131806485-131806507 TGGGCTCAGCAGGAGATGTGTGG - Intergenic
1061903073 9:133683017-133683039 TGGGGGGTGCAGGGGGTGCAGGG - Intronic
1062533128 9:137010444-137010466 TGGGCTCTGGAGGTGGGGCAGGG - Intronic
1188984106 X:36754128-36754150 TGGACTCTGCAGGTGATGCATGG - Intergenic
1188984203 X:36754931-36754953 AGGACTCTGCAAGAGGTGCATGG - Intergenic
1188985036 X:36761529-36761551 AGGGCTCAGCAAGAGGTGCATGG - Intergenic
1188986610 X:36773873-36773895 AAGGCTCAGCAGGAGGTTCATGG - Intergenic
1188987674 X:36781912-36781934 TGGACCCTGCAGAAGGTGCATGG - Intergenic
1189634004 X:42985663-42985685 TGAGCTCTGCAGGAGGTAATGGG + Intergenic
1190395143 X:49974806-49974828 TGGGTTGTGCAAGAGGTGGAAGG + Intronic
1193159718 X:78214858-78214880 TGGACTCTCCAGGAAGAGCATGG + Intergenic
1193932564 X:87573266-87573288 TGGGCTATGCACTAGGTACAGGG - Intronic
1196867515 X:120083456-120083478 GTGGCAATGCAGGAGGTGCAAGG - Intergenic
1196875586 X:120152825-120152847 GTGGCAATGCAGGAGGTGCAAGG + Intergenic
1199201275 X:145092460-145092482 TGGGCTCTGGTGGAGTTGGATGG - Intergenic
1199541392 X:148961222-148961244 TGGCATCTACAGGAGGTGAATGG - Intronic
1200059841 X:153479348-153479370 TGGGCTGGGCAGCAGCTGCAGGG - Intronic
1200078764 X:153565314-153565336 TGGGCTCTGAAGGAGCTGTCAGG - Intronic
1200440525 Y:3207199-3207221 AAGACTCTGCAGCAGGTGCAGGG - Intergenic
1200703091 Y:6418812-6418834 GTGGCTCTGCTGGAGCTGCAGGG - Intergenic
1201031019 Y:9745885-9745907 GTGGCTCTGCTGGAGCTGCAGGG + Intergenic
1202177792 Y:22113625-22113647 GTGGCTCTGCTGGAGCTGCAGGG - Intergenic
1202213569 Y:22472770-22472792 GTGGCTCTGCTGGAGCTGCAGGG + Intergenic