ID: 1141346393

View in Genome Browser
Species Human (GRCh38)
Location 16:83250491-83250513
Sequence CTGCTGAAACAGAGCTGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141346390_1141346393 21 Left 1141346390 16:83250447-83250469 CCCTAGGGAAAGGAAGTGATAGC 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG 0: 1
1: 0
2: 1
3: 20
4: 224
1141346391_1141346393 20 Left 1141346391 16:83250448-83250470 CCTAGGGAAAGGAAGTGATAGCA 0: 1
1: 0
2: 1
3: 18
4: 273
Right 1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG 0: 1
1: 0
2: 1
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141346393 Original CRISPR CTGCTGAAACAGAGCTGACA AGG Intronic
900695946 1:4010530-4010552 CTGCTGAACCACAGCAGCCAGGG - Intergenic
902593354 1:17490838-17490860 CTGCAGTAAGAGAACTGACATGG + Intergenic
902618087 1:17634812-17634834 CTGTTGGAACAGAGAGGACAAGG - Intronic
907710665 1:56877473-56877495 CTGGAGAAGCAGAGATGACAAGG - Intronic
909273906 1:73660119-73660141 CTGCTGAAACAAATCAGAGATGG + Intergenic
911391219 1:97246383-97246405 CTGCTGAAACTTAGAAGACAAGG + Intronic
911972158 1:104452467-104452489 CTGCTGAAGCAGAGCTCTCAAGG + Intergenic
912559376 1:110539034-110539056 CTGCAGCGACAGAGCTGAGAAGG - Intergenic
915281059 1:154822361-154822383 CTGCTGAGACAGAGCCGGCCCGG - Intronic
915766134 1:158364579-158364601 CTGTGGATACATAGCTGACAAGG + Intergenic
918025644 1:180742284-180742306 CTGCTAAAACAGTGCTTACAGGG - Intronic
918073242 1:181149292-181149314 CTGCTGCAAGAGAGCAGACCAGG + Intergenic
919000550 1:191826462-191826484 ATGCTGATTCAGAGCTTACATGG + Intergenic
919799018 1:201339975-201339997 CTGCTGAAGCAGTGTTGAGAGGG - Intergenic
922917808 1:229272423-229272445 CTGCAGAAACACAGCAGACACGG + Intronic
923031789 1:230255072-230255094 CTGCTGAAGGAGATCTGATAAGG - Intronic
923435110 1:233960687-233960709 GTGATGAAACAGAGTTGACTAGG - Intronic
923598589 1:235381109-235381131 CTGCTGGAACCAAGCTGATATGG + Intronic
1062767742 10:78705-78727 CTGCTGAGACAGAGTAGAAATGG + Intergenic
1063291806 10:4757439-4757461 CTGCAGACACAGAGATGACGGGG - Intergenic
1064696145 10:17967317-17967339 CTTCTGAAAAAGAGATGACTAGG - Intronic
1064740507 10:18429264-18429286 CTGCATACAAAGAGCTGACATGG - Intronic
1065635419 10:27728403-27728425 CTGCTCAAAAAGATCTGCCAAGG + Intronic
1066180084 10:32953447-32953469 ATCCTGATGCAGAGCTGACAGGG + Intronic
1067135658 10:43605474-43605496 CTGCGCAAACAGTGCTGAGAGGG + Intergenic
1067905636 10:50287982-50288004 GTGATGACACAGAGCTGGCAAGG + Intergenic
1068853837 10:61776082-61776104 CTGCTGAAATATTGATGACATGG + Intergenic
1070988762 10:80712800-80712822 CTGCCTGAACAGAGCTGGCATGG - Intergenic
1071224388 10:83510933-83510955 CAGCTAAAACAGTGCTGAGAGGG + Intergenic
1074536509 10:114331985-114332007 CTGCTCAAAAAGAACTCACAGGG - Intronic
1075069706 10:119312871-119312893 CTGAGGACACAGAGCTGGCAAGG - Intronic
1075078143 10:119365090-119365112 AGGCTGAGACAGAGCTTACAAGG + Intronic
1075080025 10:119377204-119377226 CTGTTGAAACAGATCCGAAAGGG + Intronic
1075973584 10:126675260-126675282 CTGATGATACAGAGATGAAAGGG + Intergenic
1076217657 10:128709598-128709620 CAGCTGAAACAGAGTTGGCCTGG - Intergenic
1077196992 11:1286090-1286112 CAGCTGAAACACAGCGGAGATGG + Exonic
1077959338 11:7057300-7057322 CTTCTGAAACAGAACAGAAATGG - Intronic
1078893611 11:15579048-15579070 CTGATGAAACAAAGCTCACAAGG - Intergenic
1081386636 11:42480305-42480327 CTGCAGAAACAGAGCCCTCATGG + Intergenic
1083849549 11:65356862-65356884 CTGCTGAAAATGAGCTGAGGAGG - Exonic
1083857643 11:65401023-65401045 CTGCTGACCCAGAGCTGCCCTGG + Intronic
1084921219 11:72471562-72471584 CGGCTGAAACAGAGATGAGCTGG + Intergenic
1085716478 11:78878010-78878032 CTGCTGAAACATAGCCGGCACGG - Intronic
1085774539 11:79353305-79353327 CTGATAAAACAGATCTTACAGGG + Intronic
1086821577 11:91442443-91442465 CTGCAGGAACAGAGCTCTCATGG - Intergenic
1089798160 11:121000066-121000088 CAGCTGCAACAAAGCTGAAATGG + Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091606164 12:1953238-1953260 CTTCCCAAACAGAGCTGTCAAGG + Exonic
1092083178 12:5735039-5735061 CAGCTGAAGCAGGCCTGACAAGG + Intronic
1093099488 12:15010681-15010703 CTGCTGAATCACAGCTTACAGGG - Intergenic
1093543266 12:20313590-20313612 ATGCTAAATCAGAGCTGAAATGG - Intergenic
1093970584 12:25372137-25372159 CTATTTAAAAAGAGCTGACATGG + Intergenic
1094438375 12:30447197-30447219 CTGCTGAAACTGAGCAGATGTGG - Intergenic
1095693125 12:45113532-45113554 CTTCTGACACAGAGGCGACATGG + Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097437636 12:59570874-59570896 ATGCTGAATCAGAGCACACACGG + Intergenic
1097695802 12:62773833-62773855 CTGCTGAAGCACAGCTCTCAGGG + Intronic
1098684819 12:73405970-73405992 CAACAGAAACAGAGCTTACAGGG + Intergenic
1099918499 12:88926749-88926771 AGGCTGAAAAAGAGCAGACAAGG - Intergenic
1100516299 12:95331284-95331306 CTGCTGGAACCAAGCTGATATGG - Intergenic
1103421844 12:120791966-120791988 TTGTTGAATCACAGCTGACAGGG - Intronic
1104542186 12:129676098-129676120 CTGCTCACACAGAGCTCAGAAGG + Intronic
1109453545 13:62551383-62551405 ATGCTGAAGCAGAACTGTCATGG - Intergenic
1110522834 13:76501054-76501076 CTGCTGAAACAGTCCTGCCGTGG + Intergenic
1111478625 13:88789907-88789929 CTGGGGAAACAAAGCTTACATGG - Intergenic
1111532512 13:89557380-89557402 CAGCTGAAAAAAAGCAGACAGGG + Intergenic
1111739723 13:92188881-92188903 CTGCTCTAACAGAGCTAAGAAGG - Intronic
1111834918 13:93376082-93376104 TTCCTGAAACAGAGAGGACATGG + Intronic
1112471903 13:99696952-99696974 CTGTTGAAACAGAGAAGACAGGG - Intronic
1113524384 13:110963262-110963284 TTGTTGAAACTGAGCTGATATGG - Intergenic
1113683911 13:112265505-112265527 CAGCTAAAACAGAGCTTAGAAGG - Intergenic
1113865916 13:113523769-113523791 CGGCTAAAACAGTGCTGAGAGGG - Intronic
1115463416 14:33686837-33686859 CTACTCAAACAGAGCTGCCTGGG - Intronic
1116500932 14:45620369-45620391 CTGCTGAAAGAAAGCAGAGATGG - Intergenic
1118730460 14:68662456-68662478 CTGTTGAAACAGAACGGTCATGG + Intronic
1118751247 14:68809059-68809081 CTGTTTAAGCAGAGCTGGCAAGG - Intergenic
1118906075 14:70024215-70024237 CTGCTGTGACAGAGCTTACTAGG - Intronic
1120386641 14:83854640-83854662 CAGCTGAAGCAAAGCTGAGAGGG - Intergenic
1121743178 14:96268138-96268160 ATCCTGAAACAGACCTCACAAGG - Intronic
1121830859 14:97050905-97050927 CTGAGGGAACAGAGCTGACTTGG + Intergenic
1121838311 14:97111930-97111952 CTACTGAATCAGAGATTACAGGG + Intergenic
1124077684 15:26461616-26461638 CTGTTGAAACAGAGCTCAGAGGG + Intergenic
1125292458 15:38165041-38165063 CTGCTTAATCTGAGCTGATAAGG - Intergenic
1125485214 15:40106797-40106819 CTGCTCAAAGAGAGCCGAGACGG - Intronic
1131547286 15:93326441-93326463 CTGCTGTAACAGAGCTAACCTGG - Intergenic
1131843266 15:96461203-96461225 CTGCTGAGACAAAGCTAAAATGG - Intergenic
1132485374 16:187571-187593 CTGCAGAAACAGAGCGGATGAGG + Intergenic
1132935460 16:2478288-2478310 CTTCTGAAACAGAGTTGACCAGG - Intronic
1137842968 16:51657023-51657045 CTGATGAAGCAGAGCTCAGAAGG + Intergenic
1138240830 16:55425885-55425907 TTGCTAAAATAGAGCAGACAGGG - Intronic
1139017654 16:62709654-62709676 CTGCTGAAAGAGACCAGACCAGG + Intergenic
1140233779 16:73140441-73140463 CTGCTGAGACAGTGCTCTCAGGG + Intronic
1141346393 16:83250491-83250513 CTGCTGAAACAGAGCTGACAAGG + Intronic
1147447000 17:40480564-40480586 ATGCAGAAACAAAGCTGAGATGG + Intronic
1149453643 17:56769916-56769938 CTGCTGAAACAGGACTGCCCTGG + Intergenic
1149483758 17:57024838-57024860 CTGTTGAAACCAAGCTGATATGG + Intergenic
1153568358 18:6443476-6443498 ATGCTGTAACAGAGTTGAAATGG + Intergenic
1153754393 18:8265166-8265188 CTGCTGAAACACAGCAGAATTGG - Intronic
1155850923 18:30773231-30773253 CTGCTGGAACCAAGCTGATACGG - Intergenic
1156042911 18:32843525-32843547 CTTCTGGAACAGAAGTGACAAGG + Intergenic
1156459846 18:37315567-37315589 CTCCAGACACAGAGCAGACAAGG - Intronic
1156807538 18:41203666-41203688 CTGCTGAAATGGATCAGACATGG + Intergenic
1157479298 18:48042877-48042899 CTGCTCTAACAGAGCTTAGAGGG + Intronic
1160348977 18:78158593-78158615 CTGCTGAAAGAGAGAAGCCAGGG - Intergenic
1160620363 18:80166568-80166590 CTGCTGTAAAAAAGCTGCCACGG - Intronic
1160824476 19:1073299-1073321 CTGCTGGAACAGGGCTGCGAGGG + Intronic
1161516255 19:4698212-4698234 ATGCTTAAACAGGGCTGGCACGG + Intronic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1162939161 19:13997697-13997719 TGGCAGGAACAGAGCTGACAGGG + Intronic
1163561931 19:18024366-18024388 CAGCTGAATCAGGGCTGACCTGG - Intergenic
1164790703 19:30977157-30977179 CAGCAGAAACAGTGCTTACAGGG - Intergenic
1165211759 19:34241520-34241542 CTGCTGAAAAATACCTCACAGGG - Intergenic
924989072 2:295700-295722 ATGCTGAGACAGAGATGAGATGG + Intergenic
925043026 2:748300-748322 CTGCTGAACCAGAATTGCCACGG - Intergenic
927512681 2:23654226-23654248 CTGGAGAAACATAGCTGACTAGG - Intronic
928389905 2:30901206-30901228 CTGCTGAAAATGAGCTCACAGGG + Intergenic
929435712 2:41927019-41927041 CTGGTGAAAAAGAGCTGACTTGG - Intergenic
930010584 2:46935184-46935206 CTGCTGGAAAAGAGCTGTGAAGG + Intronic
934914377 2:98288339-98288361 CTTCTAAAACTGAACTGACATGG - Intronic
935097154 2:99956365-99956387 TTCCTGAAGCAGAGCTGAAATGG + Intronic
936811454 2:116407767-116407789 CTGCAGAAACAGGGCTCTCATGG + Intergenic
937870735 2:126784284-126784306 TTGCTGAAGCCCAGCTGACATGG - Intergenic
940881387 2:158950353-158950375 CTGCTAAAACAGACCTAATAGGG + Intergenic
942838798 2:180335036-180335058 ATTCAGAAACTGAGCTGACATGG - Intergenic
944889007 2:204097982-204098004 CTGCTGAAGCAAACCTGTCAAGG - Intergenic
946260056 2:218481392-218481414 CTACTGAAACAGAACTTCCAGGG + Intronic
948356116 2:237378700-237378722 CTGCTGAGGCAAAGCTGGCAGGG + Exonic
948489566 2:238303779-238303801 CTGTTGGTACAGAGCTGCCAGGG - Intergenic
1170902211 20:20475241-20475263 CTGCCCATAAAGAGCTGACATGG + Intronic
1171008520 20:21492057-21492079 CAGCTGCAACAGCGCTGTCAGGG - Intergenic
1173397132 20:42690144-42690166 CTGCTGAAACACAGGTGATGGGG + Intronic
1175548562 20:59799591-59799613 CTAATCAAACAGAGCTGAAATGG - Intronic
1177051794 21:16244960-16244982 CTTCTGAAACAATGCTGATATGG - Intergenic
1177059585 21:16354024-16354046 CTGCTGATAAAGACCTGAGATGG - Intergenic
1177338850 21:19771343-19771365 TTGCTGAAACAGAGCTATCTTGG - Intergenic
1179611451 21:42554524-42554546 GTGTTGAAACAGAGCTGTGAGGG + Intronic
1179812264 21:43879612-43879634 CTGCTGAAGGAGAACAGACAAGG - Intronic
1181829047 22:25544616-25544638 ATGTTGAAACGGAGCTGAAAAGG + Intergenic
1182265705 22:29113622-29113644 TTGATGAAACTGAGCTGAGAAGG + Intronic
1183837757 22:40470434-40470456 CAGCTGAAACAGTGCTTAGAGGG + Intronic
950071602 3:10157128-10157150 CTGCTGGAACAGCCCTGATACGG - Intergenic
952834882 3:37594132-37594154 CTGCTGACCCAGAGCTCAGATGG - Intronic
953039651 3:39244194-39244216 CTGTCATAACAGAGCTGACAAGG - Intergenic
953235950 3:41107277-41107299 TAGCTGAAACAGTGCTGAAAAGG - Intergenic
954527361 3:51283880-51283902 CTCCTGAAACAGTGCAGAGAAGG + Intronic
955224368 3:57049026-57049048 CTTCTGAAACAGACTTGCCAAGG + Intronic
957538933 3:81543348-81543370 CTGTTGTAAACGAGCTGACAAGG + Intronic
958577728 3:95974107-95974129 CTGCTGGAGCAGGGCTCACATGG + Intergenic
961115551 3:124326137-124326159 CTGGTGGAACACAGCAGACATGG - Exonic
962715898 3:138125878-138125900 GAGCTGAAGCAGAGCTGAGAAGG + Intronic
964655229 3:159059354-159059376 CTGCTGTAACAGAATTAACAAGG - Intronic
964708524 3:159646825-159646847 CTTCTGAAAAAGAGCTGAAAAGG + Intronic
964723019 3:159786573-159786595 CTGCTGAAACTGAAATGAGAAGG + Intronic
966834529 3:184038788-184038810 CTGGGGAGGCAGAGCTGACAGGG + Exonic
966843322 3:184106506-184106528 CTGCGGAGGCAGAGCTGACAGGG + Exonic
970806120 4:20035358-20035380 CAGCTAAAACAGTGCTGAGAGGG + Intergenic
973855208 4:55004431-55004453 CTGCTGCTACAGAGCTGAAACGG + Intergenic
974318832 4:60317300-60317322 CTGCTGTAATAGAGTAGACAAGG - Intergenic
974405487 4:61462907-61462929 CTGTTGAAACAGTTCTGACTAGG - Intronic
977623735 4:99166661-99166683 CTGTTGAAACCAAGCTGATATGG + Intergenic
978322314 4:107511228-107511250 CTGCCTGAATAGAGCTGACATGG + Intergenic
980987755 4:139712172-139712194 CTGTTGAAACCAAGCTGATATGG + Intronic
982137816 4:152288780-152288802 CTGTTGAAACAGGGCTCAGAAGG - Intergenic
982350483 4:154409519-154409541 CTCCTGAGCCTGAGCTGACAGGG + Intronic
985991966 5:3569728-3569750 CTGATGGAACAGAGATGAGACGG - Intergenic
989644075 5:43610303-43610325 CTGATGAAAGAGAGTTGACTTGG - Intronic
996706861 5:126506699-126506721 CTGCTGCAACAGATCTGCCCCGG + Intergenic
996850163 5:127942669-127942691 CTGCTGAAACAATGCTGATCAGG - Intergenic
997385452 5:133468594-133468616 CTGCTGATACAATGCTGACATGG - Intronic
997692705 5:135837492-135837514 CTGCTGCAACAAGGCTGATACGG + Intronic
998104085 5:139457282-139457304 CTTCTGAAGCCGAGCTGAGAAGG - Intronic
1000415873 5:160983287-160983309 CTGCTGGAACCAAGCTGATATGG - Intergenic
1000859737 5:166442331-166442353 CTACTGAAACTGAACTGAAACGG - Intergenic
1001040604 5:168332230-168332252 CTGATGACTCAGAGCTGAGAAGG + Intronic
1001052738 5:168426009-168426031 CTGGAGCCACAGAGCTGACATGG - Intronic
1001683546 5:173576139-173576161 CTGGTGAAACAGACATGAAAAGG + Intergenic
1003124636 6:3346535-3346557 CTGCTGCCACACAGCTTACAAGG + Intronic
1003134620 6:3424810-3424832 CAACTGAAACAGAGCCCACATGG + Intronic
1003148716 6:3530758-3530780 CTGCAGAGACAGGACTGACAGGG + Intergenic
1003802674 6:9687916-9687938 CTGCTGAAACAAAGATGGAAGGG + Intronic
1006942470 6:37762170-37762192 CTGCTAAAGCAGAGCTTGCAGGG + Intergenic
1007336077 6:41156126-41156148 GTGCTGAGACAGAGGTGACCAGG + Intergenic
1008501232 6:52185218-52185240 TAGCTGAAACCCAGCTGACAGGG + Intergenic
1008820580 6:55626521-55626543 ATGCTGAATCAGAGCATACATGG - Intergenic
1010810187 6:80291562-80291584 CTGCTGGAACCAAGCTGATATGG + Intronic
1011101196 6:83724440-83724462 CTGCTGCCAGAGAGCTGACAGGG - Intergenic
1011520091 6:88195388-88195410 CTACTGAAATAGAACTTACAAGG - Intergenic
1011841160 6:91500858-91500880 CTGATGAAGAATAGCTGACATGG + Intergenic
1013325501 6:109042196-109042218 CAGCTGAAGCAGTGCTGAGAGGG + Intronic
1013456082 6:110330706-110330728 CTTTGAAAACAGAGCTGACATGG + Intronic
1015159497 6:130136590-130136612 ATGATTAAACAGAGCTGACTAGG - Intronic
1018585860 6:165357963-165357985 CAGCTAAAACAGTGCTGAGAGGG - Intronic
1018912035 6:168106965-168106987 CTGCTTAAACACAGCTCATAGGG - Intergenic
1022186729 7:27976446-27976468 CAGTTGAAACAAAGCTGAGATGG - Intronic
1024234185 7:47385447-47385469 CTGCAGATACAGAGCTGAATTGG - Intronic
1024852834 7:53741299-53741321 CTGCTGAATTGGAGCTGCCAAGG - Intergenic
1026046296 7:66907735-66907757 ATGCTGATTCAGAGCAGACATGG + Intergenic
1026667230 7:72352633-72352655 CAGCTAAAACAGTGCTTACAAGG + Intronic
1026966948 7:74446159-74446181 CTGCTGATCCAGAGCTCCCAGGG + Intergenic
1028750057 7:94372910-94372932 CTGCTGAAACAGAATTTTCAAGG - Intergenic
1029946583 7:104539599-104539621 CTGCCCAACCAGAGTTGACAAGG - Intronic
1030710983 7:112748710-112748732 CTGCTAAACCAGAGCTGACAGGG + Intergenic
1032128874 7:129213078-129213100 CCGCTGAAACTGAACTGAAATGG - Exonic
1033845566 7:145427836-145427858 CTACTGACACAAAGCGGACAGGG - Intergenic
1034117200 7:148593803-148593825 CTGCTGGAAAAGAAGTGACATGG + Intronic
1034458194 7:151183154-151183176 CTTCAGAAACAGAGCTGGCTAGG + Intronic
1035793397 8:2329285-2329307 GAGCTAAAGCAGAGCTGACAGGG - Intergenic
1035799407 8:2392420-2392442 GAGCTAAAGCAGAGCTGACAGGG + Intergenic
1037617599 8:20533670-20533692 GTGATGAAACAGAGGTGACAGGG + Intergenic
1039879944 8:41618995-41619017 CTGCAGAAACTCAGCTGAAAAGG - Intronic
1042656226 8:71100273-71100295 AAGATGAAACAGAGCTGAAAAGG - Intergenic
1043274549 8:78376958-78376980 CAGCTGAGACAGAGCAGACAGGG - Intergenic
1043395882 8:79835697-79835719 CAGCTGAAACAGTGCTGTGAGGG + Intergenic
1044922694 8:97182522-97182544 CTGCTGAAGCTGTGCTGACTGGG + Intergenic
1045332723 8:101169684-101169706 CTAAAGACACAGAGCTGACAGGG + Intergenic
1045425257 8:102059881-102059903 CTGGTAAAACACAGCTGCCAGGG + Intronic
1045690417 8:104754339-104754361 CTGCTGAAATGAAGCTGGCAGGG + Intronic
1045953623 8:107881233-107881255 CAACTGAAACAGAGCTGCAAAGG - Intergenic
1046965113 8:120155637-120155659 CTGCTGAAAGAAAGCTGTCTGGG - Intronic
1048468964 8:134690312-134690334 CTCCTGTAACAGTGCGGACAGGG - Intronic
1049436341 8:142587801-142587823 CCGCTGCAGCAGAGCTGACTGGG + Intergenic
1051940561 9:22500948-22500970 CAGCTTAAACAGAGCTGCTATGG - Intergenic
1052894200 9:33731958-33731980 CTGCACAAACAGAGCTGGCCAGG - Intergenic
1054782751 9:69180762-69180784 CTGCTAAAACTGAGCTCACCAGG - Intronic
1055106917 9:72522790-72522812 CTGCTGGAACAGCGCTGAATAGG + Intronic
1056477751 9:86969261-86969283 CTGCTGAAAAACAGCTTACAAGG - Intergenic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1059167947 9:112096979-112097001 CTGCTGATACAGACAGGACAAGG + Intronic
1059786750 9:117594428-117594450 CTGCTGATACAGAATCGACAAGG - Intergenic
1060054614 9:120402882-120402904 CTGCTCAAACAGATCAGCCAGGG - Exonic
1060484232 9:124037074-124037096 CTGGTGAAACTCAGCTCACAGGG + Intergenic
1062570778 9:137184205-137184227 ATGCAGACACAGAGCCGACATGG + Intronic
1062570788 9:137184249-137184271 ATGCAGACACAGAGCAGACACGG + Intronic
1188115591 X:26238800-26238822 CTGCAGAAGCAGAGCTCTCATGG - Intergenic
1188133783 X:26469609-26469631 CTGTTGGAACCAAGCTGACATGG + Intergenic
1188156698 X:26749529-26749551 ATGCTGCAGCAGAGCTGGCAAGG + Intergenic
1189738321 X:44093645-44093667 CTGCTGAAGCAAAGCTTCCAAGG - Intergenic
1190915311 X:54807903-54807925 CAGCTGAAGCAGAGGTGACCTGG + Intronic
1190981880 X:55463618-55463640 CTGCTGAAGCAGAGGAGAAATGG + Intergenic
1190986818 X:55509562-55509584 CTGCTGAAGCAGAGGAGAAATGG - Intergenic
1192058051 X:67793243-67793265 TTGCTGAAAAAGAACTGGCAAGG - Intergenic
1196019829 X:110979767-110979789 CTGCTAAAGCAGTGCTGAGAGGG - Intronic
1197778221 X:130134522-130134544 TTGCTGAGACAAAACTGACATGG + Intronic
1198819444 X:140631806-140631828 CAGCTGAAGCAGTACTGACAGGG - Intergenic
1201050975 Y:9934928-9934950 CTGAAGAAACAGAGATGAGAAGG + Intergenic
1201978646 Y:19882144-19882166 CTGCAAAAACAGAGCTCACTTGG - Intergenic