ID: 1141349671

View in Genome Browser
Species Human (GRCh38)
Location 16:83282735-83282757
Sequence GGTGTCCAGGTTTGCTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141349671_1141349680 29 Left 1141349671 16:83282735-83282757 CCTTTCCAGCAAACCTGGACACC 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1141349680 16:83282787-83282809 TCCTCATTCAGGGCTGCTGATGG 0: 1
1: 0
2: 1
3: 14
4: 196
1141349671_1141349679 19 Left 1141349671 16:83282735-83282757 CCTTTCCAGCAAACCTGGACACC 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1141349679 16:83282777-83282799 TTGCATTGCTTCCTCATTCAGGG 0: 1
1: 0
2: 4
3: 13
4: 206
1141349671_1141349682 30 Left 1141349671 16:83282735-83282757 CCTTTCCAGCAAACCTGGACACC 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1141349682 16:83282788-83282810 CCTCATTCAGGGCTGCTGATGGG 0: 1
1: 0
2: 2
3: 16
4: 143
1141349671_1141349678 18 Left 1141349671 16:83282735-83282757 CCTTTCCAGCAAACCTGGACACC 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1141349678 16:83282776-83282798 ATTGCATTGCTTCCTCATTCAGG 0: 1
1: 1
2: 1
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141349671 Original CRISPR GGTGTCCAGGTTTGCTGGAA AGG (reversed) Intronic