ID: 1141351777

View in Genome Browser
Species Human (GRCh38)
Location 16:83304796-83304818
Sequence GCTGCTAGTAAGAGTGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141351777 Original CRISPR GCTGCTAGTAAGAGTGAATT AGG Intronic
905084617 1:35361062-35361084 GATGCTCGTTAGAGTGAACTGGG - Intronic
908103997 1:60822293-60822315 GCAGCTACTAAGAGTGAAATTGG + Intergenic
908601387 1:65743963-65743985 GCTGCCAGTAAGTTTGAACTGGG - Intergenic
910688412 1:89941244-89941266 GCTGCTAGCAAGAGCAAATGGGG - Intergenic
911155334 1:94630587-94630609 ACTTCTAGAAAGAGTGTATTTGG - Intergenic
913365119 1:118029001-118029023 GCTACTTGAAAGAGTGAGTTGGG + Intronic
914295254 1:146315826-146315848 GCTGCTTTTAAGAGGTAATTAGG - Intergenic
914556295 1:148766609-148766631 GCTGCTTTTAAGAGGTAATTAGG - Intergenic
918603307 1:186390184-186390206 GCTGGTAGTAAAAGTGACTGAGG + Intronic
921782492 1:219182458-219182480 GCTGCTAATAAGAGAGATTCTGG + Intronic
923289201 1:232527841-232527863 GCTGCTTGGGAGAGTGAAGTGGG - Intronic
924716016 1:246574814-246574836 GCTGCTTATAAGAGAGATTTAGG - Intronic
1063927327 10:10993350-10993372 GCTACTAGAAAGAGTAAATTGGG + Intergenic
1064292087 10:14044491-14044513 CCTTCTACGAAGAGTGAATTTGG + Intronic
1065016603 10:21468196-21468218 ACTGCTAGAAACAGTGAATATGG - Intergenic
1066441211 10:35440683-35440705 GCTCCTAGAAAGAGTGATTCTGG + Intronic
1066631968 10:37466908-37466930 GCTGCTAGGGAGACTGAGTTGGG - Intergenic
1069140695 10:64820591-64820613 GTTGCTACTAGGAGTGAAATTGG + Intergenic
1071189466 10:83082664-83082686 GATGCTAATCAGAATGAATTGGG + Intergenic
1077767132 11:5171127-5171149 GGTGCAAGGAAGAGTCAATTCGG + Intronic
1080183316 11:29449420-29449442 TCTGCTAGCAAGAATGAACTCGG + Intergenic
1080794998 11:35554949-35554971 GCTGTTAGGAAGAGTGCATAGGG - Intergenic
1081120867 11:39263887-39263909 TCTGATATTAAGATTGAATTAGG + Intergenic
1081531421 11:43962327-43962349 GCTGTAAGTAAAAGAGAATTTGG + Intergenic
1082806851 11:57457291-57457313 GCTGTTAGTAAGTGAGAACTCGG + Intergenic
1085268347 11:75251469-75251491 GCTGCTATGAAGAGGGATTTTGG - Intergenic
1087355833 11:97093028-97093050 GCTGCTAGTAAGAAAGAATAGGG + Intergenic
1087646441 11:100813589-100813611 GCAGAGAGTGAGAGTGAATTAGG + Intronic
1092735778 12:11581025-11581047 GCTGCTAGGAAGACTGAGGTGGG + Intergenic
1094052218 12:26233069-26233091 AATGCTAGTAACCGTGAATTAGG + Intronic
1094080838 12:26533620-26533642 GCCACTAGTAATATTGAATTAGG - Intronic
1095128333 12:38508387-38508409 GCTGCTGGGAAGAACGAATTGGG + Intergenic
1095646878 12:44558250-44558272 GCAGCTAGAAATAGTGAAATTGG - Intronic
1097725938 12:63076124-63076146 TCTGCTAGTAAGGGAGATTTGGG - Intergenic
1106403179 13:29449052-29449074 TCTGCTAGAAAGAGTGCTTTAGG - Intronic
1109381463 13:61567045-61567067 ACTGCTAGTGAAAGTGTATTTGG + Intergenic
1109702096 13:66039408-66039430 GGTGCTAGCAAGAAAGAATTTGG - Intergenic
1111171112 13:84527953-84527975 GCTGCTAGCAAGTGAGAATGAGG - Intergenic
1111521693 13:89413175-89413197 CCTCCTAGAAGGAGTGAATTTGG + Intergenic
1112156395 13:96822166-96822188 GCTGCCAGTGAGACTGAATTGGG + Intronic
1112735393 13:102410370-102410392 GATGCTCTTAAGAGTTAATTGGG - Intergenic
1112829216 13:103428087-103428109 CCTGATAGGAAGAGGGAATTTGG + Intergenic
1115026472 14:28752812-28752834 GTTCCTAGTCAGATTGAATTTGG + Intergenic
1115137331 14:30126885-30126907 GCTGGAAGTAAGAATGGATTGGG - Intronic
1116606742 14:47008363-47008385 GCTGCTTGTATGAGCCAATTAGG - Intronic
1120068832 14:80079541-80079563 AATGCTAGTTAGGGTGAATTTGG - Intergenic
1127271983 15:57409710-57409732 GCTGTTAGGAAGAGTCAAGTCGG + Intronic
1128402090 15:67293860-67293882 GGTGCAAGGAAGAGTGAAGTGGG + Intronic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1131544045 15:93300892-93300914 GCAGCAAGGCAGAGTGAATTTGG + Intergenic
1134137497 16:11687796-11687818 GCTGCAAATAAGAGTGAAAATGG + Intronic
1139335499 16:66228180-66228202 GCTGCACGTAAGAGTCATTTGGG - Intergenic
1139626500 16:68193555-68193577 GCTACTAGGAAGACTGAAGTGGG + Intronic
1141351777 16:83304796-83304818 GCTGCTAGTAAGAGTGAATTAGG + Intronic
1142398171 16:89844899-89844921 GCTGGGAGTAAGAGTGAAGGAGG - Intronic
1146209074 17:30927914-30927936 GCTACTAGGAAGACTGAAGTGGG + Intronic
1150694434 17:67392313-67392335 ACTGCTAGTAAAAGTGAGCTGGG - Intronic
1151118855 17:71769780-71769802 GCTCCTAATAAGAGTGATATTGG - Intergenic
1151194394 17:72421319-72421341 GCTGCCAGTAAGAGTGTCATGGG - Intergenic
1156234562 18:35189407-35189429 GCTGCTATTAAGAGGCACTTGGG - Intergenic
1159401774 18:67946753-67946775 GGTGCCAGCAAGAGTTAATTTGG + Intergenic
1165472792 19:36013243-36013265 TCTGACAGTAAGAATGAATTTGG + Intronic
1167020467 19:46871252-46871274 ACTGCTAATGAGAGTGAAATGGG + Intergenic
926740286 2:16104906-16104928 GCTGCTGGAAAGGGTTAATTGGG + Intergenic
929044364 2:37775778-37775800 GCTGCCAACAAGACTGAATTAGG - Intergenic
929117201 2:38454399-38454421 GGTACTAGTAAGAGTGTACTTGG - Intergenic
931209200 2:60176619-60176641 GCTGGTAGCAAGAGTGCAATGGG + Intergenic
937186762 2:120051302-120051324 GCTGCTAGGAAGCTTGAACTGGG - Intronic
939247502 2:139644929-139644951 GCTGCTAATCTGTGTGAATTGGG + Intergenic
939830871 2:147069172-147069194 GCTGATAGCAAGAGTGACTTAGG - Intergenic
942540991 2:177015595-177015617 GCTGCTTGGAAGAGTGACTTTGG + Intergenic
944781919 2:203027821-203027843 GCTGCTTGGAAGGGTGAAATAGG - Intronic
945923076 2:215776234-215776256 GCTGGCAGTAAAAGTGAAATGGG + Intergenic
947708932 2:232299022-232299044 GCTGAGAGAAAGACTGAATTTGG - Intronic
948276573 2:236713646-236713668 TCTGCTTATAAGAGTGATTTTGG + Intergenic
948385291 2:237577061-237577083 GGTGCAAGTGAGAGTGAATGTGG + Intronic
1170454420 20:16519010-16519032 GCTACTATTAAAAGTCAATTAGG + Intronic
1175181934 20:57154621-57154643 GCTGCTAGTAAGGGTGTAAAAGG + Intergenic
1182070037 22:27457067-27457089 GATGCTTGTAAGAGTGACTCAGG - Intergenic
1182174863 22:28274678-28274700 GATGCTATTAAGAATGCATTAGG + Intronic
951097405 3:18648070-18648092 GCTGAGAGTAAGAGATAATTAGG - Intergenic
951641110 3:24836562-24836584 GCTTCTAGTAAGAGTGAGATGGG - Intergenic
955461816 3:59191445-59191467 GCTCCTAGTAAAAGTGATCTGGG - Intergenic
956514360 3:70030064-70030086 AGTGCTAGTAAGAGAGAAATTGG + Intergenic
958118751 3:89257170-89257192 GCTGCTAGAAGAAGGGAATTTGG - Intronic
963632971 3:147756708-147756730 GCTGCTATAAAGAGTGACTGAGG + Intergenic
964912306 3:161798161-161798183 TATGCTAGCAACAGTGAATTTGG - Intergenic
971303243 4:25458958-25458980 GCTACTTGTAAGACTGAAGTGGG - Intergenic
971405057 4:26314827-26314849 GCTGCTAGTGGGAGTGAAAATGG - Intronic
973564527 4:52170843-52170865 GCAGCCAGGAAGATTGAATTGGG - Intergenic
973880661 4:55268527-55268549 GCTGCCAGACAAAGTGAATTAGG + Intergenic
975478158 4:74846416-74846438 GCTTCTACTCAGAGTGAATTGGG - Intergenic
975484158 4:74915956-74915978 GCTGCTGGAAAGAGTGAACTTGG - Intergenic
976691290 4:87869958-87869980 CCTGCTGGGAAGAGTGAGTTAGG + Intergenic
979408962 4:120350857-120350879 GCTGTTAATGAGAGTGAGTTTGG + Intergenic
990688568 5:58336031-58336053 GCTGGGAGTATGAGGGAATTGGG + Intergenic
992853589 5:80837191-80837213 GCTGTTAGTAAAAGTGAAGGTGG + Intronic
993004885 5:82419253-82419275 GATGCCAGTAACACTGAATTAGG - Intergenic
993575679 5:89597307-89597329 ACTACTAGAAAGAATGAATTGGG - Intergenic
993997519 5:94740528-94740550 GCTGCTACTTGGAGTAAATTTGG + Intronic
994233519 5:97336153-97336175 GCTGCTAGGAAGTTTGAACTGGG - Intergenic
997701932 5:135908438-135908460 TCTGCTAGCAAGAGAGAAGTTGG + Intergenic
1000209682 5:159098000-159098022 GGTGGTAGTGAGAGTGAATTGGG - Intronic
1001221557 5:169904801-169904823 GTTGCTACTAGGAGTGACTTGGG - Intronic
1002547127 5:179956673-179956695 GCTGCATGGAAGAGTGACTTAGG - Intronic
1004306346 6:14505129-14505151 GGTGCTAATAATAGTGAATGAGG - Intergenic
1005864776 6:29929039-29929061 GCTGCAAGTAAGTATGAAGTGGG + Intergenic
1006016141 6:31082608-31082630 ACTTCTAGGAAGAGAGAATTAGG + Intergenic
1006423862 6:33951616-33951638 CCTGCTCCTAAGAGTGACTTGGG - Intergenic
1010190739 6:73193946-73193968 GCTGCTAGGAAGGCTGAGTTGGG - Intronic
1010330268 6:74615471-74615493 GCTTGTACTAAGAGGGAATTGGG + Intergenic
1010374168 6:75147182-75147204 GCCGTTAGTAAAAGTGAAATCGG + Intronic
1010435970 6:75831360-75831382 GCTACTAGGTAGAGTGAATATGG + Intronic
1010787187 6:80017577-80017599 GCAGCTACTAAGAGAGCATTAGG - Intronic
1013555873 6:111256878-111256900 GCTGCTTTCAAGAGTGAAGTGGG + Intergenic
1014138608 6:117916402-117916424 AGTGGAAGTAAGAGTGAATTTGG + Intronic
1015421111 6:133009536-133009558 TCTGTTAATAAGAGTGAAGTAGG - Intergenic
1020153692 7:5704002-5704024 GCTGCTTTTAGGAATGAATTGGG - Intronic
1020248166 7:6446896-6446918 GCTACTTGGAAGAGTGAAGTGGG + Intronic
1020787703 7:12591211-12591233 ACTTCTGGTAAGACTGAATTTGG + Intronic
1023890395 7:44387826-44387848 TCTGGTCATAAGAGTGAATTTGG - Intronic
1028151104 7:87373140-87373162 GATGCTAGTAAGGGTAAAGTGGG + Intronic
1028519503 7:91714595-91714617 GATGCTAGGAAGAGTGATTCGGG + Intronic
1031302866 7:120085564-120085586 ACTGCTAGTAACAGCCAATTTGG + Intergenic
1032265707 7:130368579-130368601 GCTGCTAGTAGGGGTGATTCAGG - Exonic
1032836702 7:135681723-135681745 GCTGCTGGTCAGAGTGACTAGGG - Intronic
1033020093 7:137715819-137715841 TCTGCTTGTAAGAGAGAAGTAGG + Intronic
1033569242 7:142611629-142611651 GCTCCTAGGAGGAGAGAATTTGG + Intergenic
1039083524 8:33757363-33757385 GATGCTAGAATGAGTTAATTGGG - Intergenic
1041323291 8:56637080-56637102 GCTGCTGGGAAGATTGAACTGGG - Intergenic
1044945908 8:97389224-97389246 GCTACTAATAACAGTGCATTTGG + Intergenic
1046945290 8:119968753-119968775 ACTGCTAGTAAGTGTGACCTTGG + Intronic
1047654611 8:126963505-126963527 GCTGCTAGTAAGTGTGGAGCGGG + Intergenic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049987464 9:965130-965152 GATGGTAGTAAAAGTGATTTTGG + Intronic
1053234282 9:36438569-36438591 TCTGCTTGTAAGTGTGTATTGGG - Intronic
1056452326 9:86728339-86728361 GTTGGTAGTAAGAGTGAGTATGG + Intergenic
1056519559 9:87387671-87387693 GCTGGTATTAAGAGTGAGATAGG - Intergenic
1057301020 9:93882281-93882303 GTTGCTAGTAAGAGTGTTCTAGG + Intergenic
1057752215 9:97802340-97802362 TCTGCCAGGAAGAGTTAATTAGG - Intergenic
1058499359 9:105594632-105594654 GCTGCTAGGAAGACTGAGGTAGG + Intronic
1189884551 X:45527585-45527607 ACTGTTAGTAAGAGAGACTTTGG + Intergenic
1190850640 X:54237660-54237682 CCTGATTGAAAGAGTGAATTTGG - Intronic
1193828903 X:86262975-86262997 GCTGCAACTAAGAGTGCTTTGGG - Intronic
1194139874 X:90196336-90196358 GCTGCCAGGAAGTTTGAATTGGG + Intergenic
1198860950 X:141069829-141069851 GCTGCCAGTAAGGCTGAATGAGG + Intergenic
1198901742 X:141517554-141517576 GCTGCCAGTAAGGCTGAATGAGG - Intergenic
1200485622 Y:3765305-3765327 GCTGCCAGGAAGTTTGAATTGGG + Intergenic