ID: 1141352051

View in Genome Browser
Species Human (GRCh38)
Location 16:83307017-83307039
Sequence GAGCTTATTCATGCCGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141352051_1141352056 17 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352056 16:83307057-83307079 CATATAAGCTACAGTTGGGTGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1141352051_1141352052 12 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352052 16:83307052-83307074 CTCCACATATAAGCTACAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 83
1141352051_1141352055 16 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 105
1141352051_1141352057 18 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352057 16:83307058-83307080 ATATAAGCTACAGTTGGGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 152
1141352051_1141352053 13 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352053 16:83307053-83307075 TCCACATATAAGCTACAGTTGGG 0: 1
1: 0
2: 1
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141352051 Original CRISPR GAGCTTATTCATGCCGAAAG AGG (reversed) Intronic
No off target data available for this crispr