ID: 1141352055

View in Genome Browser
Species Human (GRCh38)
Location 16:83307056-83307078
Sequence ACATATAAGCTACAGTTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141352051_1141352055 16 Left 1141352051 16:83307017-83307039 CCTCTTTCGGCATGAATAAGCTC No data
Right 1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141352055 Original CRISPR ACATATAAGCTACAGTTGGG TGG Intronic
907100374 1:51828101-51828123 ACATATAAACTACACCTGAGTGG + Intronic
909352090 1:74665835-74665857 ACATATAAATTACAGTGGGAGGG + Intronic
909728513 1:78865809-78865831 CCATATAACCTTCAGTTTGGTGG - Intergenic
910438471 1:87228965-87228987 ACCTCCATGCTACAGTTGGGGGG - Intergenic
911063183 1:93764925-93764947 ACATGTGTGCTACAGTGGGGCGG - Intronic
911612386 1:99970931-99970953 AGATAGAATCAACAGTTGGGAGG - Intronic
917378115 1:174373077-174373099 ACATATGAGGTACATTTAGGTGG - Intronic
918236140 1:182582471-182582493 ACATATAAGTCACAGTTGTTAGG + Intronic
921949909 1:220918725-220918747 TCATATAAGCTGCAGATAGGTGG - Intergenic
1066280389 10:33911677-33911699 ACAGATAACCTACAGAAGGGGGG - Intergenic
1069771138 10:70901300-70901322 ATATACAATCTACACTTGGGGGG + Intergenic
1073670343 10:105580243-105580265 TCATATCAGCTGCAGTAGGGAGG - Intergenic
1076056667 10:127380241-127380263 ACGTATAAGGTAGAGTTTGGTGG + Intronic
1081566406 11:44263780-44263802 ACACATAAGCTAGAGCTTGGGGG - Exonic
1082282889 11:50289346-50289368 ACATATATACTAAAATTGGGGGG + Intergenic
1083541941 11:63517624-63517646 ACATATAAATTTTAGTTGGGAGG - Intergenic
1085626373 11:78076844-78076866 ACAAAGGAGATACAGTTGGGAGG - Intronic
1086411350 11:86547772-86547794 ACATATAAGCAGGAGTTGAGTGG - Intronic
1087071174 11:94082372-94082394 ACATAAAAGGTACAGCTTGGAGG - Intronic
1092296247 12:7201345-7201367 ACATATCAGCTATATTTGGGAGG + Intronic
1093084256 12:14849099-14849121 ACAAAGAAGCTACAGCTGAGTGG - Intronic
1093132226 12:15405358-15405380 ACATAAAAGTTTCAGTTGGCTGG - Intronic
1093594227 12:20942270-20942292 ACATATTAGCTAAAGTTGAAGGG - Intergenic
1099925450 12:89011105-89011127 ACAAATTAGCAACAATTGGGTGG + Intergenic
1106633932 13:31507097-31507119 ACATATGACCTTCATTTGGGTGG + Intergenic
1107733392 13:43370872-43370894 ATATAGAAGCTACAGTTTGTGGG - Intronic
1120174531 14:81278757-81278779 ACATATGAGCTACTGTTCAGGGG + Intronic
1121637689 14:95464921-95464943 AAATATAAGCTATATCTGGGAGG + Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1129556433 15:76515083-76515105 AATTATAAGCTACAGTTTGAAGG + Intronic
1133919006 16:10135183-10135205 AATTATATGCTACAGTTGTGTGG - Intronic
1134868701 16:17632131-17632153 AGACAAAAGCTACAGGTGGGCGG + Intergenic
1135511195 16:23084981-23085003 ACAAATAAGCTGCAATTAGGGGG + Exonic
1136279480 16:29199553-29199575 ACTTTTAAGGTACAGTTTGGTGG + Intergenic
1139834195 16:69825060-69825082 ACATAAAAGCTACAGATGCAAGG - Intronic
1141241246 16:82266984-82267006 ACATTTAAGCAACTGCTGGGGGG - Intergenic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1143230576 17:5350766-5350788 ACATAACAGCTACATTTGAGGGG + Intronic
1147950820 17:44106858-44106880 ACATAAAAGCTACTTTTGGCCGG - Intronic
1150662128 17:67091918-67091940 GCAAATACGCTACAGTTTGGTGG + Intronic
1155905919 18:31451020-31451042 AAATAAAAGCTATATTTGGGAGG + Intronic
1156803791 18:41151476-41151498 ACATATAAGGTACAATTTGAGGG - Intergenic
1158519614 18:58160902-58160924 ACATGTAGGCAACAGCTGGGAGG - Intronic
1159756780 18:72375705-72375727 ACACATAAACTCCAGTTGTGTGG + Intergenic
925574333 2:5345195-5345217 ACATAAAGGCTACAGTTTGCTGG - Intergenic
932279940 2:70481814-70481836 ACTTACAAGCTATTGTTGGGAGG - Intronic
939168829 2:138670313-138670335 TCATCTGAGCTACAGTTGCGTGG - Intergenic
942605619 2:177687265-177687287 AGACAGAAGCAACAGTTGGGAGG - Intronic
943019061 2:182551157-182551179 AAATAATAGCTACAATTGGGGGG + Intergenic
944925506 2:204459954-204459976 AAATATATTCTACACTTGGGGGG - Intergenic
947674325 2:231963189-231963211 ACATTTAAACTACTGTTGGTGGG - Intronic
1169052867 20:2595410-2595432 ACACACAAGCTAGAGTTTGGAGG - Intronic
1173260462 20:41430454-41430476 TCATATGAGCTACTGCTGGGAGG + Intronic
1174713525 20:52732152-52732174 ACATAGAATTTAGAGTTGGGTGG + Intergenic
1175850713 20:62090756-62090778 ACAGAAAAGTTACAGTTGGCTGG - Intergenic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950650938 3:14406267-14406289 ACCTATAATCAACACTTGGGAGG - Intronic
951040394 3:17982892-17982914 ACACATAAGCAAAAGTTTGGTGG + Intronic
951123421 3:18956224-18956246 ACATATGAGATACAGTGGAGTGG - Intergenic
957805062 3:85136275-85136297 AAATAAAAGCTACATTTAGGAGG - Intronic
961761247 3:129169969-129169991 ACATAGAACATACAGTTGAGTGG - Intronic
965325548 3:167299439-167299461 AAATATAAGCTTCAGTAGAGTGG - Intronic
966645032 3:182236233-182236255 AAATAAAAGCCTCAGTTGGGTGG + Intergenic
967998865 3:195187385-195187407 ACACAGAAGAGACAGTTGGGAGG - Intronic
971819798 4:31537402-31537424 ACATAAAAGATACAATTTGGTGG - Intergenic
972431987 4:38991739-38991761 AAATATAAAATACAGTTAGGTGG + Intronic
974583405 4:63836829-63836851 ACATATAAGCTACAGTAGTATGG + Intergenic
977043668 4:92043502-92043524 ACATATTAGCTAAAGTTAGAGGG - Intergenic
983632057 4:169859624-169859646 ACATATAAACAACAGTGAGGTGG - Intergenic
988564194 5:32308025-32308047 AGAAATAAGCAACAGTTGGCTGG + Intronic
988807746 5:34756142-34756164 ACATATGGGCTAGGGTTGGGAGG + Intronic
988954789 5:36304471-36304493 ATATATCAGCTACAGTGGGATGG + Intergenic
992560465 5:77947480-77947502 AAATATAAGCAAAAATTGGGTGG + Intergenic
998885105 5:146685895-146685917 ACATACAAGCTAGATTTTGGTGG - Intronic
999296087 5:150460322-150460344 GAATATAATCTACAGTTGGCCGG - Intergenic
1002411615 5:179083212-179083234 ACCTATAAGAGACATTTGGGGGG + Exonic
1011613228 6:89173716-89173738 AGATATAAGGTATAGTTGTGTGG + Intergenic
1012522943 6:100142680-100142702 TCATATACACTACAGATGGGAGG + Intergenic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1022034106 7:26517724-26517746 ACAGATAAGCTCCAGTTGCAGGG - Intergenic
1022490100 7:30810525-30810547 ACATATTAGCTACAGTTAAAGGG + Intronic
1022736487 7:33081017-33081039 ACATATAAGGCACAGAGGGGTGG + Intergenic
1025483005 7:61009269-61009291 CCATATAAGCTACACGTGGTAGG + Intergenic
1027932657 7:84558262-84558284 ATATATATGCTACTGTTGGGTGG - Intergenic
1028325102 7:89513982-89514004 ACTTATAAGCTACAGTCAGGTGG - Intergenic
1030207573 7:106965852-106965874 AAATATAAGGAACAGTTGGCAGG - Intergenic
1030783647 7:113632994-113633016 ACATATTCTCCACAGTTGGGAGG - Intergenic
1031105688 7:117539557-117539579 ACATATAAGCTACAGAGAAGTGG - Intronic
1034842145 7:154408833-154408855 ACATATAAATTTGAGTTGGGGGG - Intronic
1037632275 8:20668994-20669016 ACATACAAGCAATAGTTTGGAGG - Intergenic
1040879834 8:52192677-52192699 ACAAAAAAGGTACAGTTAGGAGG + Intronic
1042172827 8:66008984-66009006 ACATATCAGCCACAGCTAGGAGG - Intergenic
1043501769 8:80865402-80865424 ACAGAGAAGTAACAGTTGGGTGG + Intronic
1044195299 8:89369291-89369313 ACTTATCAGGTACAGTTGTGTGG - Intergenic
1046252365 8:111649388-111649410 ACATATAATCTATAGTTGATGGG - Intergenic
1046717039 8:117579328-117579350 CCATATAAGTTACAGTGGGTTGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1051788518 9:20773202-20773224 AAATATATGCTAAAGGTGGGGGG - Intronic
1051926046 9:22327441-22327463 AAATATAAGCCACAGTTCTGAGG - Intergenic
1054851586 9:69852188-69852210 GCAGAAAAGCTACAGTTGGTAGG + Intronic
1058499450 9:105595825-105595847 ATCTATAAGCTATAGATGGGAGG - Intronic
1059633380 9:116149155-116149177 ACAACTAAACTACTGTTGGGGGG + Intergenic
1187424720 X:19166829-19166851 ACATGTCAGATACAGTTGGTAGG + Intergenic
1190275455 X:48896535-48896557 ACAGAGGAGCTCCAGTTGGGTGG + Intronic
1192432725 X:71123427-71123449 ACATCAAGGCTTCAGTTGGGAGG + Intronic
1193124555 X:77857409-77857431 ACATATGAGTTACAGGTGCGGGG - Exonic
1200425093 Y:3011663-3011685 ACATATAAACTCCAGCTAGGAGG - Intergenic
1201783880 Y:17752252-17752274 ACATATATGCAACAGAAGGGAGG - Intergenic
1201817673 Y:18153735-18153757 ACATATATGCAACAGAAGGGAGG + Intergenic