ID: 1141355149

View in Genome Browser
Species Human (GRCh38)
Location 16:83338624-83338646
Sequence TAGCTGTTCTGGAGGAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 129}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141355142_1141355149 4 Left 1141355142 16:83338597-83338619 CCATGGGAATGTAAGCCAGGGAC 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG 0: 1
1: 0
2: 1
3: 8
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141355149 Original CRISPR TAGCTGTTCTGGAGGAGTAA GGG Intronic
900325021 1:2104481-2104503 TATGTGTTCTAGAGGAGTGAGGG + Intronic
903013420 1:20346208-20346230 GAGCTGTTTTTGAGGATTAAAGG - Intronic
904904071 1:33881349-33881371 AAACTGTTCTGTAGGAGAAAGGG + Intronic
906365226 1:45204943-45204965 TAGAAGCTCCGGAGGAGTAAAGG + Intronic
907054490 1:51352417-51352439 TCACTGTTCTTGAGGATTAATGG - Intergenic
907770921 1:57462424-57462446 TAGGTGTTCTTGTGGAGTGAGGG + Intronic
908530145 1:65026518-65026540 TTCCTGTTCTAGAGGAGGAAGGG - Intergenic
909918071 1:81345346-81345368 TAGCTGTTCTTGAGATGCAATGG - Intronic
910606239 1:89087808-89087830 TAGATGTTCTGCAGGGGTAATGG + Intergenic
911333725 1:96555970-96555992 AAGCTGTACTTTAGGAGTAAGGG - Intergenic
923011007 1:230087458-230087480 TGGCAGTTATGGGGGAGTAAAGG - Intronic
923830582 1:237550987-237551009 CAGCTGTTCTGGAGGAGGGCTGG - Intronic
1062834649 10:627642-627664 TAGATGTCCGGGAGGTGTAAGGG + Intronic
1065770689 10:29075235-29075257 TAGTTGTTCTATAGGAGTTACGG + Intergenic
1066057204 10:31693340-31693362 TTGCTCCTCTGGAGGAATAAAGG + Intergenic
1067374781 10:45717776-45717798 GAGATGTTCTGTAGCAGTAATGG - Intergenic
1067378947 10:45754774-45754796 GAGATGTTCTGTAGCAGTAATGG + Intronic
1067400904 10:45972543-45972565 CCGCTGTTATTGAGGAGTAACGG + Exonic
1067869258 10:49942113-49942135 CCGCTGTTATTGAGGAGTAACGG + Exonic
1067882594 10:50059414-50059436 GAGATGTTCTGTAGCAGTAATGG - Intergenic
1067886649 10:50095437-50095459 GAGATGTTCTGTAGCAGTAATGG + Intronic
1069223484 10:65911921-65911943 TAGGTGTTCTGAAGTAGTAAGGG + Intergenic
1070572996 10:77655634-77655656 TGGGTGTTGTGGAGGAGAAAGGG - Intergenic
1071807859 10:89143759-89143781 AAGCTGTTTTGGTGGAGTATTGG - Intergenic
1078182330 11:9022518-9022540 AAGCAGTTTTGGAGGAGTGATGG - Intronic
1079852178 11:25548668-25548690 TAGCTGTTCTACAGGGGAAAAGG + Intergenic
1081118736 11:39237196-39237218 TAGCTCTCCTGGAGGACTAAGGG + Intergenic
1084600757 11:70144083-70144105 TAGCTGCTCTGGAGCAGTGGAGG - Intronic
1084601259 11:70147270-70147292 TAGCTGCTCTGGAGCAGTGGAGG - Intronic
1090220739 11:125021570-125021592 TAGTTGTTTTGGTGGAGTGATGG + Intronic
1092078437 12:5692726-5692748 TAGGTGGTCTGGAGGTGTGATGG + Intronic
1100558696 12:95724577-95724599 TAGCTGTTATAAAGGAGAAAAGG - Intronic
1102792264 12:115657516-115657538 CAGTTGTTCAGGAGGGGTAAGGG + Intergenic
1102792567 12:115659584-115659606 TAGCTGTTCTCTGGGAGGAAAGG - Intergenic
1103007397 12:117432413-117432435 TCATTGTTCTGGAGGAGTCATGG + Intronic
1105853253 13:24354415-24354437 TTGCTGTTCTTGGGGAGCAATGG - Intergenic
1107140357 13:36991961-36991983 TACATGTCCTGGAGTAGTAAGGG - Intronic
1112522864 13:100113377-100113399 AAGCTGGTCTGGATGAGTCAGGG + Intronic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1114925392 14:27390865-27390887 TAGCTTTTCTGGTGGTGTATTGG + Intergenic
1123903278 15:24897470-24897492 TAGCTATTCTGGAGGTTGAATGG + Intronic
1126800586 15:52293909-52293931 TGTCTGTTCTGGAGGTGTGAAGG - Intronic
1129677251 15:77638343-77638365 TAGCTGTTCTTAAGAAGTCAAGG + Intronic
1133166968 16:3954676-3954698 TTGCTGCTTTGCAGGAGTAAGGG + Intronic
1139558026 16:67724961-67724983 TGGCTGCCCTGGAGGAGGAAAGG - Exonic
1141355149 16:83338624-83338646 TAGCTGTTCTGGAGGAGTAAGGG + Intronic
1143988208 17:10933739-10933761 TAGCTGTCCTGACAGAGTAATGG - Intergenic
1147009994 17:37437879-37437901 AAGCTGTTGTTGAAGAGTAAAGG + Intronic
1148537347 17:48451282-48451304 GAGCAGATCTGGAGGAGAAAGGG - Intergenic
1149062793 17:52443445-52443467 CAGTCGATCTGGAGGAGTAAGGG + Intergenic
1149881156 17:60292337-60292359 AATCTGTTGTTGAGGAGTAAAGG - Intronic
1150257983 17:63764165-63764187 CAGCTGTTCTGGAGGTGTGCAGG + Exonic
1150773172 17:68058980-68059002 TAACATTTCTGGAGGAGGAAGGG + Intergenic
1153115999 18:1657074-1657096 TAGATTTTCTGGACGTGTAATGG + Intergenic
1157536332 18:48460817-48460839 TAGCTTTTCTTGAGGAGGACGGG - Intergenic
1157736343 18:50053219-50053241 TAGCAGTTCTCGAGAAATAATGG - Intronic
1158110810 18:53939639-53939661 TAGTTGTTCTGGAACAGCAAAGG + Intergenic
1162126874 19:8504207-8504229 TTGCAGTTCTGGAGGAGTGAGGG + Intergenic
1165232269 19:34394558-34394580 TTGCTTTTCTGGAGGGATAAAGG - Intronic
926674150 2:15605497-15605519 GAGCTGTTTTGGTGGAGCAAAGG + Intronic
929942582 2:46346307-46346329 TAACTGTTCTGGGGCTGTAATGG + Intronic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932373372 2:71212006-71212028 GAGCTGATCTGGAGAAGTCAAGG - Intronic
932437376 2:71710577-71710599 CAGCTGTTCTGGATGTCTAAGGG + Intergenic
935483432 2:103621996-103622018 TAGCTGTCCTTTAGGAATAATGG + Intergenic
936855377 2:116951958-116951980 TAGCTGCTATAGAGGAGAAAGGG + Intergenic
938809301 2:134837541-134837563 AAGCTGTTCAGGAAGAGGAAAGG + Intergenic
939551845 2:143625579-143625601 TTGCTGTTCTGAAGAAGTAGAGG - Intronic
941571945 2:167181628-167181650 TATTTGTTCTGGAGGAAAAAAGG - Intronic
941680782 2:168396514-168396536 CACATGTTCTGGAGGAGGAAGGG - Intergenic
943826422 2:192399500-192399522 TCAATGTTCTGGAGGAATAATGG + Intergenic
944943499 2:204655711-204655733 AATCTGTTGTGGAGGATTAAAGG + Intronic
946143371 2:217710723-217710745 TAGGTGTTATGGAGGTCTAAGGG - Intronic
947017657 2:225639117-225639139 AACCTGTTCTGGGGGAGCAAAGG - Intronic
947618424 2:231573677-231573699 CAGTTGTTCTGCAGGAGTGAGGG - Intergenic
1175319064 20:58072756-58072778 TAGCTCTTCTGGAGGGGGCACGG + Intergenic
1176113138 20:63419531-63419553 TAGAGGTTCTGGAGGAGCCAGGG - Intronic
1176976663 21:15328287-15328309 TGGATGTTATGGAGGAGTTAAGG - Intergenic
1179315825 21:40243747-40243769 GAGCATTTCTGGAGGAGAAAAGG + Intronic
1182977279 22:34635273-34635295 CAGCTGTCCTGGAGGAATTAAGG + Intergenic
1183281805 22:36936260-36936282 TGGCTGGTGTGGAGGAGAAATGG + Intronic
1183550328 22:38479052-38479074 GAGCTTTTCTGAAGGAGCAATGG + Intronic
1183620158 22:38967417-38967439 TATCTCCTCTAGAGGAGTAATGG + Intronic
950444386 3:13027806-13027828 TGGCTGCTCTGTAGGAATAAGGG + Intronic
953563492 3:44012632-44012654 TATCTGTACTGGAGGGGGAAAGG + Intergenic
954320243 3:49827692-49827714 TAGCATATCTGGAGGAGTATGGG - Intergenic
955017003 3:55080304-55080326 TAGCTGCTTTGGAGCTGTAATGG - Intergenic
956646266 3:71460206-71460228 TAGCTGGTCTAGAGGAGTAAAGG + Intronic
960965710 3:123103347-123103369 TTGCAGTTCAGGAGGACTAAGGG - Intronic
961487084 3:127224179-127224201 TAGCTGTTCTTGTGGGCTAATGG - Intergenic
962679723 3:137785679-137785701 TGGCTGTTCTGGAAGATCAAAGG - Intergenic
964165459 3:153699527-153699549 TAGCTTTTCTGATGAAGTAAAGG + Intergenic
965601474 3:170458746-170458768 TAGCTATTCTGCAGGAGCTAAGG + Intronic
966868837 3:184277064-184277086 TAGGGGTTCTGGAGGCCTAAGGG + Intronic
969680331 4:8639783-8639805 TAGCTGTTCTCGGAGAGTGAGGG + Intergenic
973165282 4:47069899-47069921 GAGGTGTTCTGGTGGAGTACCGG - Intronic
988585208 5:32501937-32501959 TGGGTGTTCTGGTGGAGTAGCGG - Intergenic
988785661 5:34563811-34563833 AAGCTTTTCTGGAAAAGTAATGG + Intergenic
991138797 5:63214882-63214904 TAGGTGTTTTAGAGTAGTAAAGG - Intergenic
992358503 5:76010724-76010746 TAGGTGTTCTGAAGGAAAAAAGG + Intergenic
999218765 5:149958037-149958059 AAGCTGTTTGGGAAGAGTAATGG + Intergenic
999509715 5:152236652-152236674 TAGCCCTTCTGGAGTATTAATGG + Intergenic
999530800 5:152461505-152461527 TAGCTTTTTGGGGGGAGTAAGGG + Intergenic
1000294479 5:159901311-159901333 TGGCTGTGCTGGAAGAGCAAAGG - Intergenic
1002100634 5:176855875-176855897 GAGCTGTTCTGGATGTGAAATGG - Intronic
1007478902 6:42137247-42137269 TAGCTGGTCTGTAGGGGTCAAGG + Intronic
1007947757 6:45841208-45841230 TTGCTGTCCTGGGGCAGTAATGG + Intergenic
1009746892 6:67827360-67827382 GAGCTGTTTTTGAGGAGTACAGG - Intergenic
1012638022 6:101571563-101571585 TAGATATTTTGGAGAAGTAAAGG - Intronic
1012759907 6:103286313-103286335 TAGCTGTGTTGTAGAAGTAATGG - Intergenic
1013375259 6:109508670-109508692 TGGCTGTGCTGGAGGAGCAAAGG + Intronic
1015426716 6:133078781-133078803 TAGGTGTTTTGGAAGAGCAATGG - Intergenic
1015825552 6:137307216-137307238 CAGCTGTGCTGGATGAGGAAAGG + Intergenic
1028115171 7:86988645-86988667 AAACTGTTTTGTAGGAGTAATGG - Intronic
1028537241 7:91903383-91903405 TAGCTGTTATAAAGGAGAAAAGG - Intergenic
1034941147 7:155231250-155231272 TAGCTGTTCTAGAGCCGTGAAGG - Intergenic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1038250115 8:25895752-25895774 TAGCTGTTCAGGCAGATTAACGG - Intronic
1044599615 8:93990862-93990884 TAGCTGTTGTGGAGTAGCAGTGG + Intergenic
1044739775 8:95314395-95314417 TAGCTGTTATGGAAGTGAAAAGG + Intergenic
1044756125 8:95463056-95463078 TAGTTGTTCTGGTGGCTTAATGG + Intergenic
1044890672 8:96832287-96832309 CAGCTGTACTGTAGGTGTAAGGG + Intronic
1045499889 8:102737161-102737183 TTACTGTTCTGGAGGACAAAAGG + Intergenic
1047567527 8:126062172-126062194 TAGCTGTTATGAAGTAGTACAGG - Intergenic
1061296291 9:129678636-129678658 TGGCTGTTCTGGAGCAGAAAGGG + Intronic
1186015902 X:5193070-5193092 TAGCTGTTCATGAAAAGTAAAGG + Intergenic
1187734623 X:22291138-22291160 TAGGTTTTCTGGAGGAGAAATGG - Intergenic
1188400745 X:29740959-29740981 TTGTTATTCTGGATGAGTAATGG + Intronic
1189284627 X:39842599-39842621 CAGCTCTTCAGGAGGAGAAAGGG + Intergenic
1193186169 X:78515323-78515345 AAGCAGTTCTGGAAGAATAATGG + Intergenic
1193539705 X:82756459-82756481 TAGCTAATCTGGTTGAGTAAGGG - Intergenic
1196003874 X:110814751-110814773 GAGCAGTTCTGGAGGAGTGGTGG + Intergenic
1196624551 X:117863472-117863494 TAGCTTTACTGAAGCAGTAACGG - Intergenic
1197101281 X:122658525-122658547 TAGGTGTTGTGGAGGAGGTAGGG + Intergenic
1197456872 X:126687750-126687772 TAGCTGTTTTATAGGAGTTATGG - Intergenic
1198393686 X:136201937-136201959 TAGAAGTTCTGGAAGATTAAAGG + Intronic
1199923497 X:152436138-152436160 TAGCATTTTTGGAGGAGAAAGGG + Intronic
1200087827 X:153618396-153618418 GGGCTGTTCTCTAGGAGTAAAGG - Intergenic