ID: 1141355650

View in Genome Browser
Species Human (GRCh38)
Location 16:83344173-83344195
Sequence TGGCATTTCCAGTGAATCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141355650 Original CRISPR TGGCATTTCCAGTGAATCAC GGG (reversed) Intronic
900725417 1:4213402-4213424 TGGCATTTCCGAACAATCACTGG - Intergenic
902826153 1:18975834-18975856 AGGCACTTCCAGTGACTCACGGG + Intergenic
903453020 1:23467622-23467644 TTGCATTTCCAGTGAAACCTGGG - Intronic
903725682 1:25441966-25441988 TGGAATTTCCACTCAATTACAGG - Intronic
906124127 1:43416175-43416197 TAGCAGTTCCAGGGAATCAGTGG + Intronic
911355105 1:96807551-96807573 TGGCATTTACAGTCAATCACTGG - Intronic
914246039 1:145886254-145886276 TCGCATTTGCATTTAATCACTGG + Intergenic
915849532 1:159306339-159306361 TAGGCTTTCCAGTGTATCACAGG - Intronic
917211766 1:172638995-172639017 TTACATTTTCAGTGAGTCACAGG + Intergenic
917968157 1:180191463-180191485 TGGCAGTTCCTCTGATTCACGGG - Intronic
918149884 1:181789204-181789226 TGGCATCTCCTGAGAACCACTGG - Intronic
923298199 1:232615476-232615498 TGGAACTTCCTCTGAATCACAGG + Intergenic
924322568 1:242864609-242864631 TGCCATTTCCAGTGCTCCACTGG + Intergenic
1062914219 10:1235113-1235135 TGGCAAATCCACAGAATCACAGG - Intronic
1062914388 10:1235872-1235894 TGGCAAATCCACAGAATCACAGG - Intronic
1068799430 10:61122842-61122864 TGGCATTACCAAAGACTCACAGG + Intergenic
1068828934 10:61470734-61470756 TGCTTTTTCCAGTGAATCATTGG + Intergenic
1070920023 10:80178715-80178737 TTGCATTTCCAGTGGCTCCCAGG + Intronic
1073548821 10:104378209-104378231 TGGCATTTCAACTGAGTCAATGG - Intronic
1074796570 10:116951543-116951565 TTGCTTTTCCGGTGAATGACTGG - Intronic
1076207484 10:128614754-128614776 AGGCATTTCCATGGAATAACAGG - Intergenic
1077998862 11:7476721-7476743 GGGCATTTCCAGTAAAGCATAGG + Intergenic
1078069003 11:8096144-8096166 TGGCATTCCCAGGGAATGGCAGG + Intronic
1078469543 11:11576063-11576085 AGGCACTTCCACTGAACCACTGG + Intronic
1083088861 11:60179305-60179327 AGGAATTTCCTGTCAATCACTGG + Intronic
1086957024 11:92943714-92943736 TGGCATATCCAGTGCATCGTTGG - Intergenic
1087192710 11:95272579-95272601 TGGCATTTTCAATATATCACTGG - Intergenic
1089611523 11:119672133-119672155 TCACATTTCCAGTGAAGCCCGGG - Intronic
1089713982 11:120337807-120337829 TGACATTACCAGTAAATCACAGG + Intronic
1090458560 11:126870082-126870104 TGGCACTTCCTTTGAATCAGGGG + Intronic
1093278374 12:17157836-17157858 TGGCATACTCAGTGAACCACAGG + Intergenic
1095561751 12:43574184-43574206 TTGCATTTCCAGAGTTTCACAGG + Intergenic
1097790554 12:63811144-63811166 TGGCATCTTCAGTGTGTCACAGG + Intergenic
1099221300 12:79918236-79918258 TCACATTTCCAGGGAATCAGAGG + Intronic
1101119410 12:101563771-101563793 TGGCATATCAATTGAACCACAGG - Intergenic
1101597694 12:106181546-106181568 TGGCATTTGGGGTGATTCACGGG + Intergenic
1103821131 12:123699629-123699651 AGTCATTTCCAGTGAATGTCCGG - Intronic
1105464188 13:20621953-20621975 TGGCTTTTCCAGAATATCACAGG + Intronic
1105863356 13:24437124-24437146 TGGCATTTCAAGTCAATAAGAGG + Intronic
1110139084 13:72105313-72105335 TGACATTTCCATTGAGTCAGTGG + Intergenic
1112155245 13:96809928-96809950 TGGGATTTGGAGTGAATTACTGG + Intronic
1113177844 13:107586409-107586431 TTGGAGTCCCAGTGAATCACAGG - Intronic
1114295334 14:21324282-21324304 TGGAATTACCAGTTAATCATAGG + Intronic
1115860542 14:37681509-37681531 TGACATTTACAGGCAATCACTGG + Intronic
1116089215 14:40283417-40283439 AGGAATTTCCAGTGAAGCTCGGG - Intergenic
1116402991 14:44531939-44531961 TCCCATTTCCAGTGACTCATTGG + Intergenic
1118887301 14:69878279-69878301 TGACATCTCCAGGAAATCACAGG - Intronic
1120023070 14:79552029-79552051 TGCCATTTCTAATGAACCACGGG - Intronic
1122424065 14:101595515-101595537 TGGCATTGCCAGTCAACCTCTGG - Intergenic
1123736283 15:23187399-23187421 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124192421 15:27591819-27591841 TGACATTTCGACTGCATCACTGG - Intergenic
1124286990 15:28410372-28410394 GGGCATTTCCTGTGAATTGCAGG - Intergenic
1124295711 15:28501255-28501277 GGGCATTTCCTGTGAATTGCAGG + Intergenic
1124718493 15:32090470-32090492 TGGTAATTTCAGTGAATCTCTGG - Intronic
1128157335 15:65400183-65400205 TGGCATCTCCAGTCACTCAGTGG + Intronic
1130671591 15:85917711-85917733 TTGCATTTCCAGCAAATCATTGG + Intergenic
1135055522 16:19228893-19228915 TAGCATTTGCCGTGAATCCCTGG + Intronic
1137878820 16:52024757-52024779 TGGCATCCCCAGTGCCTCACAGG - Intronic
1138061315 16:53893485-53893507 TGGCCTATCCATTGAATCTCTGG - Intronic
1139188708 16:64836952-64836974 TATCATTTGCAGTGACTCACTGG - Intergenic
1140154998 16:72415081-72415103 TGCCATTTCCACTTAATCAAAGG - Intergenic
1140703616 16:77605635-77605657 TGGGATTACCAGAGAAACACTGG + Intergenic
1141355650 16:83344173-83344195 TGGCATTTCCAGTGAATCACGGG - Intronic
1143441401 17:6977164-6977186 TGATATTTCCGGTGAATCTCAGG - Intronic
1144514832 17:15910129-15910151 TGTCATTCTCAGTGACTCACTGG - Intergenic
1144789059 17:17847509-17847531 TGGCATTTCCATGGAAACACAGG + Exonic
1147762613 17:42809371-42809393 GGGCATTTGCAGAGCATCACTGG + Exonic
1149898161 17:60447473-60447495 TGGAATTTGCATTGAAACACTGG - Exonic
1151044645 17:70904905-70904927 GGCCATTTCCAATGAATAACAGG + Intergenic
1155928187 18:31680020-31680042 TGACATTTCCTGTTACTCACAGG + Intronic
1159920939 18:74226880-74226902 TGGCATTTGCAGTCAATCCTTGG + Intergenic
1160848507 19:1177931-1177953 GGGGATTTCCAGGGAATCACAGG + Intronic
1161544646 19:4872908-4872930 CTGCATATCCAGTGAATCGCTGG - Intergenic
1166820855 19:45578924-45578946 AGGCATTTGCAGTGACCCACAGG + Intronic
1167618177 19:50547591-50547613 AGGCATTGCCAGTGATTCCCAGG - Intronic
925027936 2:624291-624313 TGGCTTTTCCATTCAGTCACAGG - Intergenic
927037024 2:19188650-19188672 TGGCTTTTCCAGTAAATTAATGG + Intergenic
928868306 2:35945208-35945230 GGGCATTTCTAGTCAATAACAGG - Intergenic
930369752 2:50487892-50487914 TGGCATTTCCTGTGAATTCCTGG + Intronic
933560944 2:83885370-83885392 TGGTATTTACAGTGAAACACAGG + Intergenic
935419483 2:102852730-102852752 TGGCTTCTCCAGTGACTAACTGG - Intergenic
937131586 2:119518035-119518057 TGGCATTTCCAGTGAGTGTGTGG - Intronic
937481295 2:122262481-122262503 TAGAATTTTCAGTGAATCCCTGG + Intergenic
939194295 2:138953657-138953679 AGGCTGTTCCTGTGAATCACTGG + Intergenic
942381573 2:175396939-175396961 TGGCATTTACAGAATATCACTGG + Intergenic
946789159 2:223283104-223283126 TGGCAGCTCCAGAGAATCTCTGG - Intergenic
948661810 2:239511861-239511883 TGGAATGTCCAGTAAACCACAGG - Intergenic
948851240 2:240707563-240707585 TGGCAGTTCTAGTGAATTGCTGG - Intergenic
1169192835 20:3668867-3668889 GGGCAGAGCCAGTGAATCACCGG - Exonic
1169837661 20:9898543-9898565 TGGCAGTTACAGTGAAACAATGG + Intergenic
1173406472 20:42770680-42770702 TTGGATATCCAGTGATTCACTGG - Intronic
1178155719 21:29851539-29851561 TGGCATTTCCACTGCATTATAGG - Intronic
1179413037 21:41176774-41176796 TGAGATTTCCAGTCTATCACAGG + Intronic
1179427173 21:41290671-41290693 CTGCATTTCCAGTGAAACTCGGG - Intergenic
1182064141 22:27418389-27418411 TGGCATTCCCACTGAATTCCAGG - Intergenic
1182243043 22:28932473-28932495 TGGCATGTACAGAGAATCTCAGG + Intronic
953571341 3:44074197-44074219 TGGCCTCTCCAGGGAACCACTGG - Intergenic
957415396 3:79895611-79895633 TAACATTTCCACTGCATCACGGG + Intergenic
959669836 3:108963986-108964008 TGTCATTGCCTGTGAATTACTGG - Intronic
961374234 3:126452063-126452085 TGGCATTTCCAGTTATTGACAGG - Intronic
961628925 3:128282199-128282221 TGGCATTTCATGTGGGTCACAGG - Intronic
963357652 3:144230204-144230226 CAGCAATTCCAGTGATTCACAGG + Intergenic
966910384 3:184556281-184556303 AGGCATTTCCGGACAATCACAGG - Intronic
967084628 3:186082889-186082911 TGTCCTTTCCAGTCAGTCACTGG - Intronic
968013300 3:195302054-195302076 TGGCATTGCCAGGGATACACTGG + Exonic
969208378 4:5665991-5666013 TGACATTTTCTGAGAATCACAGG + Intronic
969261967 4:6039304-6039326 TGCCAAGTTCAGTGAATCACTGG - Intronic
970377078 4:15469652-15469674 TTGCATTTCCAATGAAGAACAGG - Intergenic
970610648 4:17722070-17722092 TGGCAGGGCCAGTGACTCACTGG + Intronic
971664552 4:29465229-29465251 AGGGATTTCCAGTAAATCATAGG - Intergenic
973126565 4:46593091-46593113 TGGACTTTCCTGTGCATCACAGG + Intergenic
973876311 4:55223271-55223293 TGGGATTTACAGTGGATCTCTGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
975041223 4:69746332-69746354 TAGAAATTCCAGTGAGTCACAGG + Intronic
975604560 4:76141080-76141102 TGGCAATACCTGTGAATCAAGGG - Intronic
976494055 4:85706255-85706277 TGGTATATCCAGTGATTCAATGG - Intronic
977261836 4:94806342-94806364 AGGCAGTTAAAGTGAATCACTGG - Intronic
977277481 4:94995742-94995764 TGGTATTTCCAGGCAAGCACAGG + Intronic
978440745 4:108730798-108730820 AGGCAAGTCCAGAGAATCACAGG - Intergenic
979128791 4:117012511-117012533 TCCTATTTCCAGTGATTCACAGG + Intergenic
979128793 4:117012519-117012541 ATTCATTTCCTGTGAATCACTGG - Intergenic
980069209 4:128225234-128225256 AGGCATTTCCAGTAAATCTGTGG + Intergenic
981138395 4:141238711-141238733 CGTCACTTCCAGTGATTCACTGG + Intergenic
984132457 4:175895171-175895193 TGGCATCTCAAGTCATTCACTGG - Intronic
984178682 4:176453284-176453306 TGGCATTTCTAATGAATTGCTGG + Intergenic
986078527 5:4364054-4364076 TGACAGCTACAGTGAATCACGGG - Intergenic
986153847 5:5154001-5154023 TAGAATTTCCAGGGAATCCCTGG - Intronic
986176797 5:5359468-5359490 TGGCATTTCCAGTCCACCAGTGG - Intergenic
986854706 5:11855142-11855164 TGGCATCTCCAGCTAATCCCTGG - Intronic
990758298 5:59100794-59100816 TTGTTTTTCCAGTTAATCACTGG + Intronic
993058277 5:83008079-83008101 TTGCATTTCCAGTTATTCACTGG - Intergenic
993184371 5:84598079-84598101 TTGCATTTCCTGTGAATTGCTGG - Intergenic
993760967 5:91796714-91796736 TGGCATCTCCCGTGATTCTCAGG - Intergenic
996008740 5:118456497-118456519 TGTCATTTCCAGGAAATCCCTGG + Intergenic
996175185 5:120347698-120347720 TGGCTTTTCCAGTGATTGCCTGG - Intergenic
998871788 5:146559902-146559924 TGGTATTTTCAGTGAATCTTGGG - Intergenic
999196110 5:149782759-149782781 TGGCCTTGCCAGCCAATCACAGG + Intronic
1007609787 6:43142023-43142045 TTGCCTTTCCACTGAATCAGCGG - Exonic
1009341981 6:62567120-62567142 TGGCATTTACAGTGAAATCCTGG - Intergenic
1010279133 6:74003567-74003589 CGGCAGTTCCAGTGAATGAAAGG - Intergenic
1012036098 6:94141359-94141381 TGGCATTTCAAGTGAGTCCAAGG - Intergenic
1013482816 6:110566739-110566761 TGGCATTTTGAGATAATCACTGG - Intergenic
1014045755 6:116884067-116884089 TGGCAGTTGGAGTGAATCAAAGG - Intronic
1015732469 6:136362586-136362608 TGGCATTCACAGTGGATGACGGG + Exonic
1019367985 7:645030-645052 AGGGATCTGCAGTGAATCACGGG - Intronic
1020538712 7:9433895-9433917 TGGCAAATCCAGTGAATTAAGGG - Intergenic
1021996338 7:26181381-26181403 TGGAAATGCCAGTGATTCACTGG - Intronic
1024158581 7:46651325-46651347 TGGCATGTCCTGTGGAACACGGG + Intergenic
1024449078 7:49517857-49517879 TGGCATAACCACTGAATCTCAGG + Intergenic
1028903111 7:96123189-96123211 TGACTTATCCAGTGAAGCACTGG - Intronic
1030205981 7:106953144-106953166 TGGCATTTCTCGTGAAAAACGGG + Intergenic
1030715133 7:112800645-112800667 TGGCCTGTCTAGTGAAACACAGG - Intergenic
1031764989 7:125766727-125766749 TTGCATTACCAGTGTATTACTGG - Intergenic
1032384362 7:131511263-131511285 TGGTGTATCCAGTGACTCACCGG - Exonic
1041628960 8:60063205-60063227 TGTAATTGCCAGGGAATCACAGG - Intergenic
1043004054 8:74796320-74796342 TTTCTTTTCCTGTGAATCACAGG - Intronic
1050388923 9:5116216-5116238 TGGCATGACTAGTAAATCACTGG + Intronic
1051963443 9:22796793-22796815 TGTCATTTCCAGTGAGACAATGG - Intergenic
1055604664 9:77956378-77956400 GGGCATTTGTAGTGAATAACAGG - Intronic
1055658054 9:78472051-78472073 ACACATTTCCAGTGAATCAAAGG - Intergenic
1055931369 9:81562920-81562942 TGTCATATCCAGTCACTCACGGG + Intergenic
1056004076 9:82248438-82248460 TGGCATTTCGATTGAATTTCTGG - Intergenic
1056034486 9:82589070-82589092 TGGCATTTCCAATGCATTAATGG + Intergenic
1057041256 9:91849174-91849196 TGTAATTTCAAGAGAATCACAGG + Intronic
1059169634 9:112113123-112113145 TGGCCTGTCAGGTGAATCACAGG - Intronic
1060386142 9:123230739-123230761 TGGCCATTTCAGTTAATCACAGG + Intronic
1060952065 9:127610391-127610413 TGGCATTACCAGTGCATCCTAGG + Intergenic
1061639360 9:131939847-131939869 TGGCTTCTCCTTTGAATCACTGG + Intronic
1061658289 9:132109827-132109849 TGGCCTGTCCAGTGCATCCCAGG + Intergenic
1187836031 X:23433563-23433585 AGGCATTTCCAGTGGTTCACTGG - Intergenic
1192022817 X:67412290-67412312 TGGAAATTCTAGTGAATTACTGG - Intergenic
1201404012 Y:13632243-13632265 TGGCAGTTCCTTGGAATCACTGG + Intergenic