ID: 1141357183

View in Genome Browser
Species Human (GRCh38)
Location 16:83358224-83358246
Sequence GGGGTCTATGTTAGACTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141357182_1141357183 -6 Left 1141357182 16:83358207-83358229 CCAACAAGCTAGAAGCAGGGGTC 0: 1
1: 0
2: 0
3: 7
4: 89
Right 1141357183 16:83358224-83358246 GGGGTCTATGTTAGACTTCTAGG 0: 1
1: 0
2: 0
3: 6
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141357183 Original CRISPR GGGGTCTATGTTAGACTTCT AGG Intronic