ID: 1141357183 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:83358224-83358246 |
| Sequence | GGGGTCTATGTTAGACTTCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 98 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 6, 4: 91} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1141357182_1141357183 | -6 | Left | 1141357182 | 16:83358207-83358229 | CCAACAAGCTAGAAGCAGGGGTC | 0: 1 1: 0 2: 0 3: 7 4: 89 |
||
| Right | 1141357183 | 16:83358224-83358246 | GGGGTCTATGTTAGACTTCTAGG | 0: 1 1: 0 2: 0 3: 6 4: 91 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1141357183 | Original CRISPR | GGGGTCTATGTTAGACTTCT AGG | Intronic | ||