ID: 1141359692

View in Genome Browser
Species Human (GRCh38)
Location 16:83384129-83384151
Sequence CAATTCCAATCTAATATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141359692 Original CRISPR CAATTCCAATCTAATATCTA AGG Intronic
903939295 1:26918065-26918087 CAATTCCAAGCTCATATCATGGG + Intronic
904632223 1:31850960-31850982 CAATTCCAATCTAATATTTCGGG + Intergenic
906751065 1:48260775-48260797 CAAATCCAATTTAATATGTAAGG - Intergenic
909015485 1:70375505-70375527 AAATTCCAATCTAAAATTAATGG + Intronic
909973388 1:82017820-82017842 CAATTCGTATCTGATATATAAGG + Intergenic
910441036 1:87252292-87252314 CAATTCCAATATAAGATGTAAGG - Intergenic
919034272 1:192285571-192285593 CAATCCCTATCAAATATCAATGG + Intergenic
921124570 1:212166057-212166079 CAATTCCAATCCAACATCACAGG + Intergenic
1063816519 10:9780720-9780742 CAATTCAAATCAAACATCAAGGG + Intergenic
1065118096 10:22501671-22501693 CTATTCCAATCTAATAATAAAGG - Intergenic
1065974617 10:30831237-30831259 AAATTCCATTATAATACCTAAGG + Intronic
1065974979 10:30834032-30834054 CAATTTTAAACTAATATTTATGG - Intronic
1066226510 10:33388720-33388742 AAATTCCAAACTAATTTCTTTGG + Intergenic
1066383912 10:34925730-34925752 CAATTCCTATCAAATCTCAAGGG + Intergenic
1067686210 10:48467122-48467144 CAAGTCCAAACCAATATCTCTGG - Intronic
1072557685 10:96535436-96535458 GAATACAAATCTAATATCAAGGG - Intronic
1073158575 10:101369764-101369786 CAATTCCAGTCTAATACCACAGG + Intronic
1074230441 10:111528873-111528895 CAATCCTAATCAAATTTCTATGG + Intergenic
1077079053 11:715284-715306 CAAATCCTAACAAATATCTAAGG - Intronic
1080913887 11:36635096-36635118 AAATTCCTATGTAATAGCTATGG + Intronic
1082010300 11:47445808-47445830 CAATTCAAATCTAATGTTTCAGG - Intronic
1082696400 11:56370457-56370479 CTGTTCCAATATAATATTTATGG + Intergenic
1088152564 11:106763073-106763095 CAACTCCCATATAATTTCTATGG + Intronic
1089044957 11:115492767-115492789 CAATTCCAGTCTAACATCTGAGG - Intronic
1091105385 11:132914404-132914426 CTGTTCCAATATAATATTTATGG + Intronic
1092708995 12:11314652-11314674 CAATTCCAAATTATTATTTATGG + Intergenic
1093792991 12:23276895-23276917 CAATTCCACTGTAATCTCAAGGG - Intergenic
1094228798 12:28079199-28079221 CACTTCCTTTCTAATATTTAAGG + Intergenic
1095773293 12:45986359-45986381 CACTTTCAATCTATTAACTAAGG + Intronic
1100574527 12:95877498-95877520 AAATTCAAAGCTAATATATAAGG - Intronic
1101235023 12:102780063-102780085 TAATTACAACCTAATAACTATGG + Intergenic
1102378757 12:112445514-112445536 CAATTACAATCTAACATCATGGG + Intronic
1107077989 13:36344524-36344546 CAATTTCAGTCTAATCTCTGGGG + Intronic
1110929501 13:81196959-81196981 CAACTCCTATCTTATATCAAAGG - Intergenic
1113259334 13:108544304-108544326 CACTTCTCATCTCATATCTAAGG - Intergenic
1114327170 14:21601128-21601150 GAATTCCAAGCTAATAGGTATGG + Intergenic
1115420234 14:33185541-33185563 CCATTCCTATATAATACCTAGGG - Intronic
1115689141 14:35825758-35825780 CATTTTCAATCTAATATTTTTGG - Intergenic
1115914504 14:38296458-38296480 CCTTTCCAATCCAATCTCTATGG - Intergenic
1117605876 14:57428726-57428748 CAATTCCAATCCAATATCACAGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118059899 14:62124534-62124556 TAATTACAATCTAGTATCTTTGG + Intergenic
1118959918 14:70519667-70519689 CAATTTCCATCTTATATCTTAGG - Intergenic
1119222612 14:72921224-72921246 CAATTCCAATCCATCATATAGGG - Intergenic
1119457405 14:74768131-74768153 TATTTCCAATCAAATATCTGTGG - Intronic
1124040802 15:26101394-26101416 CAACTCTAATCTATTACCTATGG + Intergenic
1126359415 15:47830781-47830803 CAATTCCAATCCAATACCACAGG - Intergenic
1127590330 15:60416054-60416076 CAATTCCAATAGAATATCACAGG + Intergenic
1129143770 15:73628963-73628985 GAATTCCAACCTCACATCTAAGG + Intronic
1129655522 15:77522334-77522356 CAATTTCAATTTAATACCTAAGG - Intergenic
1130972556 15:88744840-88744862 CAATTCCAATCTTACACCCAGGG + Intergenic
1131709762 15:95040285-95040307 CAAATCCAAACTAATATTCATGG - Intergenic
1135167968 16:20157181-20157203 CCATTCCAATGTAAGATCTGTGG + Intergenic
1137280105 16:46969427-46969449 CAATTGTAATTTAATATGTAGGG - Intronic
1138901975 16:61283247-61283269 TATATCCACTCTAATATCTATGG + Intergenic
1139755198 16:69136995-69137017 CAATTCCAATCTTATAGTTGGGG - Intronic
1140160886 16:72492514-72492536 CAATTCCATTCTGAAAACTAAGG + Intergenic
1141359692 16:83384129-83384151 CAATTCCAATCTAATATCTAAGG + Intronic
1145770958 17:27492751-27492773 CTATTCCAAGCCAACATCTATGG - Intronic
1154932186 18:21011345-21011367 CATATACAATGTAATATCTAGGG - Intronic
1157319974 18:46626635-46626657 CAATACCATTTTAATATGTAGGG + Intronic
1157715521 18:49883633-49883655 AAATTCATATATAATATCTAGGG + Intronic
1159094634 18:63888586-63888608 AAACTCCAATCTAACATCCAGGG + Intronic
1159097864 18:63925158-63925180 CACTTCCAATCTAATAACACAGG - Intronic
926770146 2:16364287-16364309 CAATTACATTCTTATACCTAAGG - Intergenic
928497937 2:31853694-31853716 CAATTCCAAACTAAAACCTGAGG + Intergenic
930890810 2:56384664-56384686 CAATTACAATATTATATCTGGGG - Exonic
934706216 2:96483368-96483390 CAATAGCAATTAAATATCTAAGG + Intergenic
935016199 2:99184454-99184476 CATTTCCAATCTAGTATATAAGG + Intronic
935700924 2:105811271-105811293 CAACTCCAATCCTATATCTTTGG - Intronic
936020724 2:108993079-108993101 CAATTCCATTCTCATATTTTAGG - Intergenic
937161656 2:119768537-119768559 CAATTCCAATCTAACATCTCAGG + Intronic
938898045 2:135772342-135772364 CAATTCCAAACAAATATGCATGG - Intronic
939551091 2:143616872-143616894 CAAGTCCAATCAACTGTCTATGG - Intronic
939812172 2:146847527-146847549 TAATTGCCATCAAATATCTAGGG - Intergenic
941002686 2:160218435-160218457 CAGTTCAAATCTAAATTCTAAGG - Intronic
941182738 2:162280609-162280631 TAATTCCAATCTAATAATCAAGG - Intronic
941183816 2:162295490-162295512 CAATGCCAATCAAATATGTAAGG + Intronic
942195364 2:173512963-173512985 GAATTCCAAACTAATATATAAGG - Intergenic
942982867 2:182103234-182103256 CTATTCAAATTTAATAACTAGGG - Intronic
943033299 2:182711393-182711415 CAATTGCAATGTAATATCACAGG - Intergenic
943554819 2:189389577-189389599 TTATTCCAATCTAAAATTTATGG - Intergenic
944041512 2:195360778-195360800 CATTTCCATTATAATATCTTGGG - Intergenic
944948729 2:204721763-204721785 CAATTCAAATATAATAACTTAGG - Intronic
946557490 2:220874481-220874503 CCATTCCATTCTACTAGCTATGG - Intergenic
948788194 2:240363976-240363998 AAATTCCCAGCTAATATTTATGG - Intergenic
1169942558 20:10952860-10952882 CAATTCCACTCTAAGATGCAAGG - Intergenic
1170097162 20:12658656-12658678 CAATTACAATCCAATGTTTATGG + Intergenic
1177312467 21:19414678-19414700 CAATTCCAATCAAGCCTCTATGG - Intergenic
1178558908 21:33619406-33619428 AAAATACAATCTGATATCTAAGG + Intronic
1180288929 22:10779030-10779052 CCTTTCCAATCTACTATCTCTGG + Intergenic
950512316 3:13438357-13438379 AAATTCCAATCTGATCTCTGGGG + Intergenic
951356693 3:21675806-21675828 GAATACAAATCTAATACCTATGG - Intronic
956455635 3:69418118-69418140 GGATTACAATCTAATATCTTTGG + Intronic
959790638 3:110357116-110357138 CAATACAAATCTAATATCATTGG - Intergenic
960031917 3:113062692-113062714 CAATTTCAATCCAACATCTGAGG + Intergenic
966125360 3:176570104-176570126 CAATTCAATTATAATCTCTAGGG - Intergenic
966377424 3:179310825-179310847 CAGTTCTTATCAAATATCTATGG - Intergenic
966649478 3:182283291-182283313 AAATTCCAAGCTATTCTCTATGG + Intergenic
970619857 4:17806647-17806669 CAATTCCAATCAAATTTTTAAGG + Intronic
972934385 4:44114472-44114494 CAATGGCCATCTAAAATCTAAGG - Intergenic
974084150 4:57241633-57241655 CTAGTCCAATCAAATACCTAGGG + Intergenic
976689449 4:87853516-87853538 AAATTCCACTTTATTATCTAAGG - Intergenic
977155847 4:93572624-93572646 CAATTCTAATAAAATATGTATGG + Intronic
981896762 4:149810837-149810859 AAATTCAAATATAATAGCTAGGG - Intergenic
982106034 4:152012839-152012861 CAATTCCTGCCTACTATCTATGG + Intergenic
982843978 4:160226197-160226219 CAATTCCAGTCAGATATCTGGGG - Intergenic
983734149 4:171036578-171036600 GAATTCCAATGTAATATATAAGG + Intergenic
983761560 4:171413859-171413881 CAATTCCAATGAAATATTTTAGG - Intergenic
983793973 4:171836901-171836923 CAATTCCATTCTAATACCTTAGG - Intronic
983987857 4:174081998-174082020 CAATTGCAATATAATCTATAAGG - Intergenic
984251044 4:177335181-177335203 CTATTGCAAAATAATATCTATGG - Intronic
985164151 4:187074533-187074555 CAATTCCCATCTAATACCACAGG - Intergenic
985177900 4:187222008-187222030 AGATCCCAATCTAAAATCTAGGG - Intergenic
987049630 5:14138637-14138659 CAATTCCAACCCAACATCTTCGG + Intergenic
988885150 5:35548498-35548520 CAATTCTAATCTAAGATAAATGG + Intergenic
989748492 5:44861164-44861186 CTATTCCATTCAAATAACTATGG + Intergenic
990474519 5:56149029-56149051 TAATTCCAATTTTTTATCTAAGG - Intronic
991393630 5:66178504-66178526 CAATTCTAATTTAATTTCCATGG + Intronic
991706051 5:69359920-69359942 CAACTCCAATGTCATATCTTTGG - Intronic
991996315 5:72390633-72390655 CAATTCCAACCTATTTTCTTGGG - Intergenic
992917796 5:81477392-81477414 CAATTCCAATCTGATACTTCAGG + Intronic
995627971 5:114099795-114099817 CAATTCAAACGTAATACCTATGG - Intergenic
998605586 5:143631322-143631344 AAAATGCAATCTAATATATAGGG - Intergenic
999345006 5:150810062-150810084 CAATTCCAATCTAACAGCACAGG + Intergenic
1004132046 6:12929750-12929772 CTATTCCAAAATATTATCTAGGG - Intronic
1008212722 6:48745056-48745078 CATTTCCAATCTAACATTGAGGG - Intergenic
1008479554 6:51971201-51971223 CAATGCCGATTTATTATCTATGG - Intronic
1010679137 6:78779666-78779688 CAAGATCAATCTAATATGTAGGG - Intergenic
1010930924 6:81802150-81802172 CAATACCAATCTCATTTCTCTGG + Intergenic
1011806507 6:91078874-91078896 AAACTCCAATCTAAATTCTAGGG - Intergenic
1011927904 6:92671483-92671505 CATTTCCTATATAATACCTAGGG - Intergenic
1014244156 6:119049627-119049649 CAATTCCAATCTTCTACATATGG - Intronic
1015686035 6:135861992-135862014 AAATTCCAATACATTATCTATGG + Intronic
1021690456 7:23225724-23225746 CAATTCCAATCTAATATCGCAGG - Intergenic
1022190043 7:28008470-28008492 CAATTCCAGTATAAATTCTAAGG + Intronic
1022387966 7:29919158-29919180 GACTTCCATTCTAATAACTATGG + Intergenic
1028783699 7:94767843-94767865 CAATTCCAATTCAATATCATGGG + Intergenic
1029314964 7:99703596-99703618 CCATTCCAATCTAATTTCATAGG + Intronic
1029320639 7:99756497-99756519 CCATTCCAATCTAATTTCATAGG + Intergenic
1030777644 7:113553914-113553936 CAAATCAAATCAAATATATATGG + Intergenic
1032475362 7:132208106-132208128 CAATTTCCATCAAATATCTTTGG - Intronic
1034615392 7:152411881-152411903 CCTTTCCAATCTACTATCTCTGG + Intronic
1035747355 8:1972016-1972038 CATTTCCAAATAAATATCTAAGG + Intergenic
1037377621 8:18249104-18249126 CAATTACAACGTAATATCTAGGG - Intergenic
1037961351 8:23100736-23100758 ATAGTCCTATCTAATATCTATGG - Intronic
1041001062 8:53454051-53454073 TAATTCCAATCTTATCTCCATGG - Intergenic
1041106338 8:54447520-54447542 CAATTCCAATCCAACATCTTAGG - Intergenic
1041576634 8:59404620-59404642 CAATTCCAATTTATTTTCTTTGG - Intergenic
1042301374 8:67286077-67286099 CAATTCCATTTTCATACCTAGGG - Intronic
1042811515 8:72830593-72830615 ACATTCCATTTTAATATCTATGG + Intronic
1043548209 8:81338877-81338899 CATTTCCAATTTAAAATGTAAGG - Intergenic
1044083971 8:87920938-87920960 CATTTCAAATCTAATCTTTATGG - Intergenic
1044343824 8:91079556-91079578 CATTTCCAATATGACATCTATGG - Intronic
1046108617 8:109694386-109694408 TAATTCAAATCTAAAATCTAGGG - Intergenic
1046541053 8:115583791-115583813 CAATTCCATACTAATAACAAGGG + Intronic
1046653852 8:116872267-116872289 CAATTCCCCTTTAATATCAAGGG + Intronic
1050818598 9:9848186-9848208 AAATTACAATGTAAAATCTATGG - Intronic
1054858739 9:69928330-69928352 ATATTCCCATCTAATGTCTAGGG + Intergenic
1061758775 9:132835213-132835235 AAATTCCTATCAAGTATCTATGG + Intronic
1186970096 X:14832614-14832636 CAATCCTGAACTAATATCTATGG - Intergenic
1191126535 X:56961125-56961147 CAATTCCTATCAAATTTCAATGG + Intergenic
1195094137 X:101489735-101489757 AAATACCAATGTCATATCTAAGG + Exonic
1195094434 X:101491259-101491281 CAATTCCAATGTTGTGTCTAAGG + Exonic
1195094458 X:101491379-101491401 CAATTCCAATGCTATTTCTAAGG + Exonic
1195295333 X:103470940-103470962 CAATTCCAAGCTCATTTATATGG + Intergenic
1196384072 X:115128885-115128907 CAATTAAATTATAATATCTAGGG + Intronic
1196620567 X:117818918-117818940 CAATTCCTATCAAATTACTAAGG + Intergenic
1197646746 X:129026272-129026294 TAATCCCAATGTAATATATAAGG - Intergenic
1198971157 X:142281986-142282008 CAATTGAAATCTAATCTCTTGGG - Intergenic
1199154640 X:144533077-144533099 GAATTGCACTCTATTATCTATGG + Intergenic