ID: 1141362001

View in Genome Browser
Species Human (GRCh38)
Location 16:83404198-83404220
Sequence TGTTCACGTTTCAGAACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141362000_1141362001 -7 Left 1141362000 16:83404182-83404204 CCTTTGTTGGGGGAACTGTTCAC 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1141362001 16:83404198-83404220 TGTTCACGTTTCAGAACTTTTGG 0: 1
1: 0
2: 1
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141362001 Original CRISPR TGTTCACGTTTCAGAACTTT TGG Intronic
904707357 1:32401365-32401387 TGTTAACATTTCAGGAATTTTGG + Intergenic
909611753 1:77558188-77558210 TGTTCAGGTTTCAGCTCATTTGG + Intronic
910922005 1:92358370-92358392 TCTTCATCTTTCAGAACTTGAGG + Intronic
912119368 1:106451555-106451577 TGTGCTTGTTTCATAACTTTGGG + Intergenic
916065971 1:161135925-161135947 TGTTGATGTTTCAGAATTTCTGG - Intergenic
917534027 1:175861642-175861664 TGCTCACGTTTGAGAGCTGTGGG + Intergenic
922511446 1:226171444-226171466 TGGTCGAGTTTCAGTACTTTTGG + Intronic
923077982 1:230626782-230626804 GGCTCACGTCTCAGCACTTTGGG - Intergenic
1065547928 10:26840699-26840721 TGTTCACATCTCAGATTTTTTGG - Intronic
1069753309 10:70758655-70758677 AGTTCAGAATTCAGAACTTTTGG - Intronic
1070889535 10:79932113-79932135 TTTTCACGTATCAGTACTATTGG + Intergenic
1072408591 10:95178506-95178528 TGTGCACATTTCAAAACTGTGGG + Intergenic
1072824610 10:98593931-98593953 TTTTCAGGTCTCTGAACTTTTGG + Intronic
1078411871 11:11129305-11129327 CTTTCAACTTTCAGAACTTTAGG + Intergenic
1085483303 11:76840652-76840674 TTTTCATGTTTCCTAACTTTAGG + Intergenic
1087334674 11:96828702-96828724 TGTTCATGCTTCAAAAGTTTTGG + Intergenic
1089544275 11:119210908-119210930 TGTACACGGTTCAGTACTATTGG - Intronic
1092018475 12:5180112-5180134 TGTTCAGTTTTCAGGACTCTGGG - Intergenic
1093475410 12:19549259-19549281 TGTTCTCATTGCATAACTTTTGG - Intronic
1094223618 12:28022291-28022313 TCTTCAAATTTCAGAACTTCTGG - Intergenic
1099141696 12:78985284-78985306 TGTTCATATTTCAGAAATTTAGG - Intronic
1102781429 12:115569076-115569098 TGTCAAGTTTTCAGAACTTTTGG + Intergenic
1103401086 12:120643134-120643156 TGGTGACATTTCAGAACATTGGG - Intronic
1109866205 13:68268051-68268073 TGTTGTAGTTTCAGGACTTTGGG - Intergenic
1110432793 13:75444555-75444577 TGTTCATGTTTCATGTCTTTTGG + Intronic
1111678004 13:91410849-91410871 TTTTCACATCTCAGCACTTTGGG + Intronic
1113292233 13:108919792-108919814 TGTTTGGTTTTCAGAACTTTTGG - Intronic
1116525243 14:45896164-45896186 TATTCACTTGTCAGAACTATGGG + Intergenic
1116971673 14:51072343-51072365 AGTTCACATTTCAGAGGTTTAGG - Intronic
1117395895 14:55310206-55310228 TGTTCACACTCCAGTACTTTGGG - Intronic
1121107110 14:91288256-91288278 TGTTCTTGTTTCAGAACCTCTGG + Intronic
1125335446 15:38622092-38622114 TGTTCATGTTTCAAATATTTTGG - Intergenic
1126507784 15:49427881-49427903 TGCTCATGTCTCATAACTTTAGG + Intronic
1135215234 16:20560545-20560567 TGTACACTGTGCAGAACTTTGGG + Intronic
1136988325 16:35134185-35134207 CTTTCACATTTAAGAACTTTTGG - Intergenic
1138850973 16:60628922-60628944 GCTTCACTTTTCAGAGCTTTAGG + Intergenic
1140182073 16:72729885-72729907 GCTTAAAGTTTCAGAACTTTGGG - Intergenic
1140842672 16:78855469-78855491 TGTTCACTTTGCAGAAACTTTGG + Intronic
1141362001 16:83404198-83404220 TGTTCACGTTTCAGAACTTTTGG + Intronic
1141502265 16:84452263-84452285 TGTTCTCGTTTCTGAAATGTTGG + Intronic
1143905674 17:10207387-10207409 TGTTTAAGTTTCAGAATCTTTGG - Intergenic
1145199048 17:20923449-20923471 TGTTCACATTTTAGATCTTGAGG - Intergenic
1148084570 17:44986181-44986203 TTTTCTCGTTTCAGTACTCTGGG + Intergenic
1151133576 17:71923922-71923944 TGTGCTAGTTTCAGGACTTTGGG - Intergenic
1153994389 18:10427205-10427227 TTTTCACCTTTCCAAACTTTTGG + Intergenic
1158005010 18:52662444-52662466 TGATGACATTTCAGAACTTTAGG + Intronic
1160035052 18:75292643-75292665 TGTACAGGTTTCTGAACATTTGG - Intergenic
926701110 2:15804206-15804228 TGTGTACATCTCAGAACTTTTGG - Intergenic
929991871 2:46797058-46797080 TGTTCACATTTCAGAACATGGGG + Intergenic
931704227 2:64933847-64933869 TCTTCATGTATCAGAACCTTGGG + Intergenic
935114443 2:100122563-100122585 TGTTCAGTTTTTACAACTTTGGG - Intronic
936573458 2:113635037-113635059 TGTTCACATTGCAGACTTTTGGG + Exonic
937574114 2:123398264-123398286 TGTTCAAGTTTGAGAACCATTGG + Intergenic
938542991 2:132301626-132301648 TGTTCACATTCCAAAAGTTTCGG - Intergenic
938711960 2:133982640-133982662 TGTTCTCCTTACAGAACTTGTGG + Intergenic
939280152 2:140053791-140053813 TGTACACGTTACATAAATTTTGG - Intergenic
939407290 2:141774657-141774679 TGTTTACAGTACAGAACTTTTGG + Intronic
940196080 2:151095425-151095447 TGTTCTCGGTTCAGCAATTTTGG - Intergenic
940582123 2:155595066-155595088 TGTTTATGTTTCATAAATTTGGG - Intergenic
941752082 2:169144317-169144339 TGCTCAACTTTCAGAACTCTTGG + Intronic
943728030 2:191272345-191272367 TGTTCTAGTTTCAAAACTTTGGG - Intronic
944380259 2:199100946-199100968 TGATCAGATTTCAAAACTTTTGG + Intergenic
944641928 2:201736119-201736141 TGTTTACATTTGAGAACTTCTGG - Intronic
946605763 2:221402389-221402411 TTTTCTGGTTTCAGCACTTTGGG + Intergenic
946653487 2:221919519-221919541 TCTTCACGTTTAAGAATGTTTGG - Intergenic
1168905042 20:1396450-1396472 TTTTCAGGTTTTAGAACTTCAGG - Intergenic
1172636162 20:36411373-36411395 TGTTCACTTTACAGTACCTTTGG + Intronic
1172925553 20:38531183-38531205 TGTTCAAGATTCAGCACTTTTGG + Exonic
1174683157 20:52427679-52427701 TGCTCAAGTTTAAGAACTATTGG + Intergenic
1178588315 21:33888138-33888160 TGTTCTCTTTTCAGATTTTTTGG + Exonic
1182018476 22:27060951-27060973 TGTTCAAGTTTGAGAACCTCTGG - Intergenic
1184753217 22:46500954-46500976 TCTTAACATTTCAGATCTTTGGG - Intronic
1185426724 22:50775843-50775865 TGTTCACATTGCAGACTTTTGGG - Exonic
949457246 3:4252272-4252294 TGTTGACTTTTCAGAAGATTTGG - Intronic
949718575 3:6962191-6962213 TCTTCACGTTTCCTAAATTTAGG - Intronic
955200065 3:56843565-56843587 TTTTCAAGTTACAGAAATTTGGG - Intronic
957027758 3:75203724-75203746 TGTACAGATTTCAGATCTTTTGG + Intergenic
962903369 3:139779967-139779989 CGTTCACCTTGCAAAACTTTGGG + Intergenic
970756460 4:19432863-19432885 TTCTCAGGTTTCAAAACTTTGGG - Intergenic
971038913 4:22728362-22728384 TTTTCATATTTCTGAACTTTTGG + Intergenic
973673463 4:53240347-53240369 TTTTCACATTTCTGAAATTTGGG - Intronic
976781978 4:88770379-88770401 AATTCATGTTTCAGAGCTTTAGG - Intronic
977571926 4:98637905-98637927 TTTTCACCTTTCAGCACTGTTGG - Intronic
978845207 4:113265185-113265207 TGTTAATGTTTCTGAAATTTGGG - Intronic
979476325 4:121162260-121162282 TGTTTATGTTTCAGCATTTTAGG + Intronic
980276592 4:130659329-130659351 TGTTCTCTCTTCAGAACCTTAGG + Intergenic
980674188 4:136053172-136053194 TGTTCACTTTTCTGTACTTAGGG - Intergenic
981638226 4:146905551-146905573 TATTCAAGTTTCAAATCTTTGGG + Intronic
982472472 4:155809650-155809672 TGTTATCGTTTCACAACATTTGG - Intergenic
984206672 4:176793523-176793545 TCTTCACCTGTCAGAAGTTTAGG - Intergenic
989416548 5:41184173-41184195 TGTTAACTTTTCAGGAATTTTGG - Intronic
991277900 5:64872382-64872404 TTTTCACGTTTAGGAACTTTTGG - Intronic
993391822 5:87327662-87327684 TTTTCACATGTCAGAATTTTTGG + Intronic
993768318 5:91891702-91891724 TCTTCAAGATTCAAAACTTTGGG - Intergenic
993956385 5:94238969-94238991 TCTTCAATTTGCAGAACTTTTGG + Intronic
994822859 5:104676505-104676527 TGTTCTCCTTTCTGAACTCTTGG - Intergenic
994877453 5:105443703-105443725 ATTTCAGGTTTCAGAATTTTTGG - Intergenic
995638795 5:114229119-114229141 TGATTACTTTTCAGAACTTTAGG + Intergenic
995650828 5:114365651-114365673 TATTCACGTTTCACAGTTTTTGG - Intronic
999519057 5:152331741-152331763 TGTGCTTATTTCAGAACTTTTGG + Intergenic
1000924914 5:167181517-167181539 TGTTCACGTATCCCACCTTTAGG + Intergenic
1001522763 5:172406620-172406642 TGTTCACGTTTCAGATCCTGTGG - Intronic
1005176480 6:23051320-23051342 TTTTCACGTTTTGGAACTTTTGG + Intergenic
1005268199 6:24135369-24135391 TGTTCCCATTTCAGAGTTTTTGG - Intronic
1005688785 6:28281723-28281745 TGTGCGCGTTCCTGAACTTTTGG + Exonic
1008971969 6:57379202-57379224 TGTTCATGTTTTACTACTTTTGG + Intronic
1009160884 6:60280745-60280767 TGTTCATGTTTTACTACTTTTGG + Intergenic
1012823114 6:104113693-104113715 TGTTCATGTTACAGATCTTGAGG - Intergenic
1015433435 6:133157082-133157104 ACTTCACTTTTCAGAGCTTTAGG + Intergenic
1015637357 6:135290510-135290532 TTTTCTCATTTCAGAACTATAGG + Exonic
1015954731 6:138587902-138587924 TGTTTAAGTTACAGAACCTTGGG + Intronic
1016222883 6:141697328-141697350 TGTTCATGTATCAGAGCTCTTGG - Intergenic
1016385282 6:143524886-143524908 TGTTCCCTTTTCAGAAATGTGGG + Intergenic
1021409698 7:20316001-20316023 TTTTCAGGCTTCAGAACTATGGG + Intergenic
1021879735 7:25083088-25083110 TGTTTACTTTTCAGAACTTTTGG - Intergenic
1027708597 7:81567601-81567623 TGGTCCCGTTTCAGTAGTTTTGG + Intergenic
1028665427 7:93338045-93338067 TTTTCATGTTTCAGAGTTTTAGG + Intronic
1029352149 7:100021427-100021449 TGTTCACATTTTAGAAACTTGGG - Intronic
1030113460 7:106045781-106045803 TGTTCAAATATCAGAATTTTTGG + Intergenic
1030642364 7:112020970-112020992 TGTTGACCCTTCAGAACTCTGGG - Intronic
1033302372 7:140197869-140197891 TGTTAGCTTTTCAGAAATTTTGG + Intergenic
1037039523 8:14213249-14213271 TCTTTACTTTTCAGAAATTTAGG - Intronic
1038352923 8:26796987-26797009 TGTTCACCTTGCAGACCCTTTGG - Intronic
1038374808 8:27029274-27029296 TGTTCATGCTTAAAAACTTTCGG + Intergenic
1038950786 8:32411796-32411818 TGTACACGTTTCAGGCTTTTCGG - Intronic
1040878633 8:52179312-52179334 TAGTTACGTTTCAAAACTTTAGG - Intronic
1041977018 8:63811068-63811090 TCTTCAGGTGTCAGAACTCTAGG - Intergenic
1043709036 8:83391281-83391303 TTTTCACATTTCAAAACTTCTGG + Intergenic
1044124743 8:88444298-88444320 TTCTCACCTTTCAGAACTTTGGG + Intergenic
1045186251 8:99841577-99841599 AGTTCACCTCTCAGAGCTTTGGG - Intronic
1045660381 8:104431234-104431256 TGTTAAAATTGCAGAACTTTTGG - Intronic
1045757201 8:105557537-105557559 TGTTCAGATTTTAGAACTTAGGG - Intronic
1046607308 8:116385928-116385950 TGGTCATGTTTCAGAGCATTGGG - Intergenic
1047797643 8:128274122-128274144 TGTTCTTCTTTCAGAACTCTAGG + Intergenic
1048475173 8:134736350-134736372 TGTTCACATATCAGAGGTTTCGG + Intergenic
1052232055 9:26165459-26165481 AGTTCACCTTTATGAACTTTAGG + Intergenic
1055146552 9:72942343-72942365 TGAGCAAGCTTCAGAACTTTGGG - Intronic
1055275423 9:74610761-74610783 TGCTCATGTTTCAGAACTGCTGG - Intronic
1062110222 9:134778168-134778190 TGTTCTCTTTTCAAAACTCTGGG + Intronic
1188474349 X:30574238-30574260 TGTTAACATTTCAGAACCCTTGG + Intronic
1197352607 X:125396478-125396500 TGTTCTTGTTTTAGAAATTTTGG + Intergenic
1197534792 X:127674282-127674304 AGTTCAAGTTTCTGAACTTATGG - Intergenic
1198772044 X:140140843-140140865 TATTCAGGTTTGAGAATTTTTGG + Intergenic