ID: 1141363600

View in Genome Browser
Species Human (GRCh38)
Location 16:83420911-83420933
Sequence CAGGGGAAAAAGAAGTAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 935
Summary {0: 1, 1: 0, 2: 6, 3: 67, 4: 861}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141363600 Original CRISPR CAGGGGAAAAAGAAGTAAGA CGG Intronic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
903553663 1:24177489-24177511 CACGGGAGAAAGAAGGAAGCTGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
904824374 1:33265140-33265162 CAGGAGAAATAGAAGTAGGGAGG + Intronic
904848849 1:33441632-33441654 CATTAGAAAAAGAAGAAAGAAGG - Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905126679 1:35720255-35720277 AAAGGGAAAAGGAAATAAGAAGG + Intronic
905389686 1:37628480-37628502 CAGGGAAACATGAAGCAAGAGGG + Intronic
905949652 1:41938457-41938479 CAGGGGAAGATGAAGTAATGGGG + Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906362676 1:45176987-45177009 CAAGAGAAAAGGAAGTGAGATGG - Intronic
906395357 1:45458889-45458911 CATGGAAAAAAGTAGAAAGAGGG - Intronic
906867599 1:49439731-49439753 CATGGGAAAAAGATGTAGGCTGG - Intronic
906925421 1:50110691-50110713 CTAGGGAAAAATAAGTAAGATGG - Intronic
907208912 1:52801126-52801148 AAGGGGAAAAGGAAATAAAAAGG + Intronic
908068849 1:60436351-60436373 CAGGCGAGAAAGAAGGAAAATGG - Intergenic
908376607 1:63548585-63548607 AAGTGGAAGAAGAAGAAAGAGGG - Intronic
908382122 1:63606544-63606566 CAGGGGAGAAAGATGGAGGAAGG + Intronic
908737128 1:67288594-67288616 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
908817795 1:68051712-68051734 CAAGGGAGAAAGAAGCCAGACGG - Intergenic
909059386 1:70862734-70862756 GAGGAGGAAAAGAAGAAAGAAGG + Intronic
909251630 1:73364353-73364375 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
909471453 1:76033430-76033452 GAGGAGAGAAAGAATTAAGAAGG + Intergenic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910937556 1:92497475-92497497 CACGGGAGAAAGATGTAGGATGG + Intergenic
911471571 1:98325652-98325674 CATTTGAAAAAGAAGGAAGAAGG - Intergenic
911658169 1:100468139-100468161 CAGGGGAACAAGAGGTAGAAAGG - Intronic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
912446055 1:109737644-109737666 CCGGGGAAAAGGTAGGAAGAAGG - Exonic
912581262 1:110723016-110723038 CAGGGAAGAAATGAGTAAGAAGG - Intergenic
912733762 1:112132367-112132389 CATGGGAAAAAGATGTAGGCTGG + Intergenic
912738585 1:112172808-112172830 AAGGGGAAATAGAAGGAAAAAGG - Intergenic
913404810 1:118477840-118477862 CAGAGGAAAGAGAAGATAGATGG - Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
913559489 1:120003187-120003209 CACGGGAAAAAGATGTAGGCTGG - Intronic
913638371 1:120787353-120787375 CACGGGAAAAAGATGTAGGCTGG + Intergenic
913988337 1:143585697-143585719 GAGGGGAAAAAGCAGACAGAAGG + Intergenic
914280077 1:146162609-146162631 CACGGGAAAAAGATGTAGGCTGG - Intronic
914541122 1:148613548-148613570 CACGGGAAAAAGATGTAGGCTGG - Intronic
914625518 1:149457698-149457720 CACGGGAAAAAGATGTAGGCTGG + Intergenic
914843031 1:151264082-151264104 CAGGGGAGAAATGAGTATGATGG - Intronic
915785044 1:158601352-158601374 CAGGGCAAAAAGAACAAAGCTGG + Intergenic
915806604 1:158860017-158860039 AAAGAGAAAAAGAATTAAGAAGG + Intergenic
915921135 1:159976194-159976216 AAGGGCAAAAACAACTAAGATGG + Intergenic
915982360 1:160428279-160428301 CAGAGGAAAGAGAAGACAGACGG - Exonic
916012542 1:160719026-160719048 CTGGATAAAAGGAAGTAAGAGGG + Intergenic
916415473 1:164588675-164588697 TAGGGGGAAAAAAAATAAGAGGG + Intronic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
916975212 1:170069829-170069851 CATGGGAAAAAAAAATAAAAAGG + Intronic
917077555 1:171220857-171220879 AAGGGGAAAAAAAAGTAAAAAGG + Intergenic
917165684 1:172110124-172110146 CAGGGGCAAGAGAAGGAACAGGG - Intronic
917606796 1:176639541-176639563 CAGGGAAAATGGAAGAAAGACGG - Intronic
917641857 1:176990521-176990543 GGGGGCAAAAGGAAGTAAGAGGG + Intronic
918245081 1:182652008-182652030 CAGTGGAAAATGTGGTAAGATGG - Intronic
919094205 1:193010356-193010378 AAGGGGAAGAAGAAGAAAGAAGG + Intergenic
919363724 1:196629823-196629845 GAGGGGAGAAAGAAGAAAGGAGG + Intergenic
919428770 1:197467608-197467630 CAGTGGCAAAAGAATTAAAAGGG - Intronic
919449126 1:197749188-197749210 CAAGGGAAAAAGAATAAAGGAGG + Intronic
919594568 1:199546063-199546085 CAGCTGAAAAAGAAGGAAGAAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920077218 1:203346170-203346192 CAGGGGAGAAAGGAATGAGAGGG + Intronic
920107154 1:203561996-203562018 AAGAGGAAGAAGAAGAAAGAAGG + Intergenic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920739813 1:208569867-208569889 CGGGGGAAAAGGTAGGAAGAGGG - Intergenic
921302204 1:213762052-213762074 GAGGAGAAAAGGAAGAAAGAGGG + Intergenic
921372174 1:214435196-214435218 CAGGATGAAAAGAAGTAAAATGG + Intronic
921415128 1:214877214-214877236 CAGGGGAGAAAGATGGGAGAAGG + Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921628980 1:217411053-217411075 CAGAGGCAAAAGGAGAAAGAGGG - Intergenic
921889146 1:220336378-220336400 AAAGGGCAAAAGAAGTGAGATGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922887684 1:229032411-229032433 CATTGGGAAAAGAAGTAAAATGG + Intergenic
923253240 1:232196838-232196860 CATGGGAAAAAGATGTAGGCTGG + Intergenic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924388135 1:243519754-243519776 TAGGGGAAAAATAAGTCAGAAGG - Intronic
1063308842 10:4933817-4933839 CAGAGGAAAAGGAGGAAAGACGG - Intronic
1064022532 10:11821335-11821357 CAGTTGAAAAAGAAATGAGAGGG - Intergenic
1064033097 10:11895151-11895173 CAGGGGAAGAAGAATTCACAAGG + Intergenic
1065110902 10:22438505-22438527 CAGTGGAAAAAAAAGAAACAGGG + Intronic
1065261280 10:23926113-23926135 CTCAGGAAAAAGAAGGAAGAAGG + Intronic
1066596380 10:37054753-37054775 AAAGAGAAAAAGAAGAAAGAAGG + Intergenic
1067255744 10:44638211-44638233 CAGGAGAAAAAGAAGAATAAAGG - Intergenic
1067393860 10:45893177-45893199 CAGGGGAAAAATATCTAATAAGG - Intergenic
1067862183 10:49862310-49862332 CAGGGGAAAAATATCTAATAAGG - Intronic
1067935446 10:50608339-50608361 GAGGGGAAAGAGAAGGAAAAGGG + Intronic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068199656 10:53766575-53766597 CAGGGAAAAAAGAAGTAATATGG + Intergenic
1068447516 10:57141201-57141223 CATGGGAAAAAGATGTAGGCTGG - Intergenic
1068809664 10:61241764-61241786 CAGGTGAAAAAGAACGAAAAAGG - Intergenic
1069290855 10:66778131-66778153 CAAGGGAGAAAAAAGCAAGAAGG - Intronic
1069345453 10:67464226-67464248 CATGAGGAAAAGAATTAAGAAGG - Intronic
1070267920 10:74922413-74922435 AAGGAAAAAAAGAAGAAAGATGG + Intronic
1070493527 10:76999645-76999667 CAGGGGAAAATAAAGTGATAAGG + Intronic
1071378707 10:85035968-85035990 CATGGGAGAAAGATGTAGGATGG - Intergenic
1071393142 10:85195515-85195537 CAGGGCAAAATGAAGAGAGAAGG + Intergenic
1071887589 10:89967841-89967863 AAGAGGAAAAAGAGGAAAGAAGG - Intergenic
1072128360 10:92467599-92467621 TAGAGTCAAAAGAAGTAAGAAGG + Intronic
1072130637 10:92490884-92490906 TAGGGGAAAAAAATGTAACAAGG + Intronic
1072222299 10:93336780-93336802 CAGGAGAAAAGGAAGAAGGAAGG + Intronic
1072290802 10:93962684-93962706 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1072436168 10:95416218-95416240 CAGGGAAAAAAGAAAGAGGAGGG + Intronic
1072777481 10:98213520-98213542 CAGGGGAAAAAGAACAAAAGGGG + Intronic
1073012555 10:100372916-100372938 CAGGGGAAAGAGAAGTCTGTGGG - Intergenic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1074320240 10:112395056-112395078 CAGGTCAAGAAGAGGTAAGACGG - Exonic
1074395771 10:113096875-113096897 CAGAGAAAGAAGAAATAAGAGGG + Intronic
1074409396 10:113212303-113212325 CATGGGATAATGCAGTAAGAAGG + Intergenic
1075270000 10:121041297-121041319 AATGGTAAAATGAAGTAAGAGGG + Intergenic
1075661894 10:124203145-124203167 CAGAGGAAAAGGGAGCAAGATGG - Intergenic
1077978235 11:7272443-7272465 GAGGATAAAATGAAGTAAGAGGG - Intronic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1078155593 11:8797447-8797469 AAGGGGAAGAAGGAGGAAGAAGG - Intronic
1078323369 11:10357345-10357367 CAGAGGAAAGAGAAGACAGAAGG + Intronic
1078612930 11:12837669-12837691 GAAGGGAGAAAGAAGGAAGAAGG - Intronic
1078761286 11:14253822-14253844 GAGGGGAAAATGAAATAATATGG + Intronic
1080498990 11:32850281-32850303 CAGGGGAAAAAAAAGGTAAAAGG - Intronic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081372207 11:42317623-42317645 CAGGGGAAAAAAAAGAAAGTAGG - Intergenic
1081809002 11:45904942-45904964 GAGGGAGAAAAGAAGCAAGAGGG - Intronic
1082071335 11:47942155-47942177 GAGGGGAACAAGAAGAAAGTGGG + Intergenic
1082085545 11:48046698-48046720 CAGGGGAAAATGTAGTAACATGG - Intronic
1082589065 11:54982682-54982704 CTGGGGAAAAAAAAGCTAGAAGG + Intergenic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083222692 11:61263915-61263937 AAGGGGATAAAGAAGAAAAAGGG + Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085509372 11:77080373-77080395 CAGGGGAATAATAAGAACGAAGG - Intronic
1085542953 11:77289379-77289401 GAGGGGAAAAGGAGGGAAGACGG + Intronic
1085619257 11:78025299-78025321 CACGGGAAAAAGATGTAGGCTGG + Intronic
1085770862 11:79324903-79324925 CAGGTGAAATGGAAGTCAGAAGG + Intronic
1085849764 11:80106456-80106478 CTGGGGAAGAATAAGAAAGAGGG + Intergenic
1085901334 11:80703355-80703377 TAGGGGAAAATGAGGTAACATGG + Intergenic
1086774332 11:90811121-90811143 GAGGGGAGAAAGAACTAGGATGG + Intergenic
1086841423 11:91689631-91689653 AAGGGACAAAAGAAGGAAGAGGG - Intergenic
1086917366 11:92546480-92546502 ATGAGGAGAAAGAAGTAAGAAGG + Intronic
1087236406 11:95723746-95723768 CAGGGGAAGATGCAGCAAGAAGG - Intergenic
1087261780 11:96020238-96020260 GAGGGGAAAAAGCAGCAAAAGGG - Intronic
1087461410 11:98453417-98453439 CGGGGGAGCAAGAAGGAAGATGG + Intergenic
1087992292 11:104759033-104759055 CCGGGGATAAGAAAGTAAGATGG - Intergenic
1088052651 11:105536657-105536679 CTGGAGAAAAATAATTAAGAGGG - Intergenic
1088365780 11:109038565-109038587 CAGGGGAAAAAGGAAAAACATGG - Intergenic
1088565727 11:111170667-111170689 AAGGGGAAATAAAAGTAAAATGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1088746278 11:112807642-112807664 CAGGGGAAGTGGAAGTTAGAGGG + Intergenic
1088788651 11:113204813-113204835 CAGGGGAGAGGGAAATAAGAAGG - Intronic
1089220828 11:116870058-116870080 CAGGGGACAAGGAAGAAGGAGGG + Intronic
1090857940 11:130627075-130627097 CAAGGGAAAAAGAAGGACAAAGG + Intergenic
1091051297 11:132375264-132375286 CAGGGGAGAAAGACGTAGGCTGG - Intergenic
1091116478 11:133018368-133018390 GAGGGGAAAAAGAAGTAAAAAGG - Intronic
1091224049 11:133947051-133947073 CAGAGGAAAACGAAATCAGACGG + Intronic
1091489543 12:921125-921147 CAGGGAAAGAAGTCGTAAGAGGG + Intronic
1091535383 12:1403200-1403222 AGGGGGAAAAAAAAGGAAGAAGG - Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1092858707 12:12699661-12699683 GAGGGGAAAAGGGAGAAAGAAGG + Intergenic
1093692278 12:22121874-22121896 CAGCAGAGAAAGAAGGAAGATGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093891640 12:24528500-24528522 AAGGGGAAAAAGAAAACAGAAGG + Intergenic
1094126793 12:27032060-27032082 TATGGGTAAAAGAAGAAAGAGGG - Intronic
1094129132 12:27055858-27055880 TGAGGCAAAAAGAAGTAAGAAGG + Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094321599 12:29189988-29190010 GAGGGGAAATAGAAGGATGAAGG + Intronic
1094715709 12:33013094-33013116 CACTGGTAAAAGAAGAAAGAGGG - Intergenic
1095544471 12:43348564-43348586 CAGAGGAAAAAGGAGTCAGAAGG + Intergenic
1095603636 12:44042603-44042625 CATGGGAGAAAGAGGTAAGCTGG - Intronic
1096585257 12:52615740-52615762 CAGGGGAGAAAGAAGGCACATGG + Intronic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097155894 12:57012166-57012188 CAGAGGAAAGAGATGAAAGACGG + Exonic
1097540721 12:60938784-60938806 CAGGGTAAAAAGAGGCAAAAAGG - Intergenic
1098659198 12:73071800-73071822 CATGGGAGAAAGATGTAAGCTGG - Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099438141 12:82668235-82668257 AAGGGGAAAAGAAAGAAAGAGGG - Intergenic
1100313917 12:93425843-93425865 GAGGGGCAAAAGAAGTGATAAGG - Intronic
1100465186 12:94838078-94838100 AAAGGAAAAAAGAAGAAAGATGG + Intergenic
1100942285 12:99737518-99737540 CATGGGGAAAAGAAGTGGGAAGG - Intronic
1101193764 12:102361687-102361709 GAGAGGAAGAAGAAGGAAGAAGG + Intergenic
1101320284 12:103667526-103667548 CCAGGGAAAGAGAAGGAAGAGGG + Intronic
1102194382 12:111014214-111014236 AGGGGGAATAAGAAGAAAGAGGG + Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102709878 12:114916547-114916569 GAGGGGAAGAAGAAGGAGGAAGG - Intergenic
1102766931 12:115441492-115441514 CACGGGAGAAAGATGTAAGCTGG - Intergenic
1103005817 12:117419259-117419281 CAGAGGTAAACGTAGTAAGATGG - Intronic
1103624010 12:122205100-122205122 GAGGGGAGAAAGAAGGGAGACGG - Intronic
1104143037 12:126006609-126006631 CAGGACAACAAGAAGTAAGAGGG - Intergenic
1104435995 12:128757082-128757104 GAAGGGAGAAAGAAGAAAGAAGG + Intergenic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1105318057 13:19286812-19286834 CATTGGAAAAAGAAGTCAAATGG + Intergenic
1105712705 13:23028375-23028397 CAGGAGAAAAAGAAGTGGGTTGG + Intergenic
1106012939 13:25842774-25842796 GGAGGGAAAAAGAAGAAAGAAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106299927 13:28454088-28454110 CTGGGGAAAGAGCAGTAAGAGGG - Intronic
1106696481 13:32179635-32179657 CAAGTGAAAAAGAGGTAACATGG - Intronic
1106838466 13:33661371-33661393 CAAGGGAAGAGGAAGTAAGAAGG + Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107149101 13:37091287-37091309 CATGGGAAAAAGGAAGAAGAGGG + Intergenic
1107167869 13:37303952-37303974 CAGTGGAAAATGAAGAAAGAAGG - Intergenic
1107361623 13:39624590-39624612 CAGGGGAGAACCAAGGAAGAAGG - Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108375771 13:49812786-49812808 ATGGGGAAAAAGAAGTCAGCAGG + Intergenic
1108735587 13:53280385-53280407 GAGGAGATTAAGAAGTAAGAGGG - Intergenic
1109005182 13:56865302-56865324 CATGTGAAGAAGAAGTAACAGGG + Intergenic
1109147692 13:58801808-58801830 GAAGGGAAAAGGAAGGAAGAAGG + Intergenic
1109178303 13:59182448-59182470 CAGAGGAAAAAAAAGCATGAAGG - Intergenic
1109231478 13:59762944-59762966 CATGGGAAGATGCAGTAAGAAGG + Intronic
1109261142 13:60146335-60146357 TAGAGGAAAAAGAAATAAGCTGG + Intronic
1109548405 13:63860062-63860084 CAGGGCAAAATGAAGTATGGTGG - Intergenic
1109819626 13:67636257-67636279 CAGGGGACAAAGTTGCAAGATGG + Intergenic
1110010891 13:70332028-70332050 CAGGGGAGAAAGATGGAAGCCGG - Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1110700560 13:78542842-78542864 AAAGGGAAAAAGAAGGAAAAAGG + Intergenic
1110784652 13:79509841-79509863 CACAGGAAAAAGATGTAAGCAGG + Intronic
1110865991 13:80397102-80397124 AAGGAGAACAAGAAGAAAGAAGG + Intergenic
1110870218 13:80443536-80443558 GAGGAGAAAAAGAAGAAAGGAGG - Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111208846 13:85050162-85050184 CATGGGAGAAAGATGTAAGCTGG + Intergenic
1111373003 13:87341534-87341556 CACGGGAGAAAGATGTAAGCTGG - Intergenic
1111374170 13:87355742-87355764 GAAGGGAAAAAGAAGTATGTTGG - Intergenic
1111472424 13:88700428-88700450 CAGGGCAGAAAGAAGTGAAATGG - Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112322171 13:98417612-98417634 CAGGGGTAAGAGATGTGAGAAGG + Intronic
1112603556 13:100880948-100880970 CAAGGGTAAAAGCATTAAGAAGG + Intergenic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1113350809 13:109527379-109527401 GAGGGAAAAAAGAAGGAAAAGGG - Intergenic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114326343 14:21593012-21593034 CAGGACAAGAAGAACTAAGAGGG + Intergenic
1114926632 14:27409381-27409403 CAGGGGAGAAAAATGTAAGCTGG + Intergenic
1114953059 14:27781371-27781393 CTGGGAAAAAGGAAGTAAGGTGG - Intergenic
1115827226 14:37291774-37291796 AAGGGCAAAAAGAGGCAAGAGGG + Intronic
1115952027 14:38732219-38732241 CATGGGAAAATGAATAAAGAAGG + Intergenic
1116541063 14:46101991-46102013 CAGGGGAAATAGTAGTTAGTAGG + Intergenic
1116717941 14:48451333-48451355 GAGGAGAAGAAGAAGAAAGAAGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116936259 14:50743539-50743561 GAAGGGAAAAAGAGGTAAGAGGG + Intronic
1117070449 14:52051185-52051207 AAGGGGAAAAAAATGTAAAAAGG + Intronic
1117134557 14:52721656-52721678 CAGGGGAAAAAAAAAGAAAAGGG + Intronic
1117402488 14:55370942-55370964 GAGGGGAAAAAGAAGCAGAAAGG - Intronic
1117688622 14:58281706-58281728 CAGAGGAATAAGAAACAAGAAGG + Intronic
1117726393 14:58678898-58678920 CAGAGGAAAGAAAAGTAAGTAGG + Intergenic
1117764331 14:59064796-59064818 AAGGGGGAAAGGAAGGAAGAAGG + Intergenic
1117916916 14:60687448-60687470 CAGGGCAAGAAGGAGAAAGAAGG + Intergenic
1118111276 14:62722746-62722768 AAGGGGAAAATGAGGTAACATGG - Intronic
1118436869 14:65779573-65779595 CAAGGAAAAAAGAAGGCAGAAGG + Intergenic
1118487750 14:66229860-66229882 CAGGTGAAAAAAAAGAAGGAAGG - Intergenic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118676331 14:68188411-68188433 AAGAGGAGAAAGAAGAAAGATGG - Intronic
1119930947 14:78545999-78546021 CATGGTAGAAAAAAGTAAGATGG - Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1119970262 14:78962395-78962417 CAGGGGAAAGAGAAGTAACTGGG - Intronic
1120068458 14:80074390-80074412 AAGGGGAAAAAGTAGAAAGGGGG + Intergenic
1120110925 14:80555176-80555198 CAGGGGAAAAAAATGTGAAAAGG + Intronic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120470540 14:84918273-84918295 GAGAAGAAAAAGAAGGAAGAAGG - Intergenic
1121075284 14:91062808-91062830 CAGGAGAAAGACAAGTAAGTAGG - Intronic
1121726179 14:96152125-96152147 CAAAGGAAATAGAAGAAAGAAGG + Intergenic
1121778702 14:96607970-96607992 CAGGTGGAAAAGAAGTCACAGGG - Intergenic
1121805342 14:96815420-96815442 GAGGGGAAAAATAATAAAGACGG + Intronic
1123172013 14:106382195-106382217 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123811156 15:23927530-23927552 CAGGGGACAAAAAAGTAGAATGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124608990 15:31194651-31194673 CAGGAGCAAAAGAGGTGAGAGGG + Intergenic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125135532 15:36336957-36336979 CAGGGGAGAAAGAGGTAGGCTGG - Intergenic
1125306205 15:38318577-38318599 CAGGGGAAAGAGAAGGAGGGAGG - Intronic
1125411653 15:39412487-39412509 AAGGACAAAAAGAAATAAGATGG - Intergenic
1126333522 15:47560614-47560636 GAGGGGAAAAAAAAGTAAAGGGG + Intronic
1126627755 15:50701455-50701477 TAGGGAGAAAGGAAGTAAGATGG - Intergenic
1126739880 15:51766835-51766857 TAGGGGAAAAAGAAGGAAAGAGG + Intronic
1127059152 15:55164255-55164277 GAGGAGAAAAATAAGTAATAGGG - Intergenic
1127568274 15:60214907-60214929 CAGAGGAAAAAGGAGAGAGAAGG + Intergenic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127800305 15:62471958-62471980 CAGGGGAGAAGGAAGAAAGGAGG - Intronic
1127836264 15:62793575-62793597 CTGGGGAAAAAGAAGTTTGGAGG - Intronic
1128613838 15:69094264-69094286 GAGGGAAAAAGGAAGGAAGAAGG + Intergenic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128844491 15:70878433-70878455 AAGGGGAAAAAAAGGAAAGAAGG - Intronic
1129121186 15:73397704-73397726 CAGGGGAAAAATAGGGAACAAGG + Intergenic
1129850937 15:78793527-78793549 CAGGGTTAAAAAAAGTAAAACGG - Intronic
1129962396 15:79699153-79699175 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1130251447 15:82302538-82302560 CAGGGTTAAAAAAAGTAAAACGG + Intergenic
1131437382 15:92434220-92434242 AAGGGAAAAAAAAAGAAAGAGGG - Intronic
1131494451 15:92893864-92893886 CAGGGGAAAAAAAAAAAAAAAGG - Intronic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131950920 15:97681012-97681034 CAGGAGTAATAGAAGTAAGTGGG + Intergenic
1132004092 15:98210628-98210650 AAGGAGAAAAAGAAGGAACAAGG + Intergenic
1132416180 15:101620688-101620710 CAGGGGAAAAGAAGGTGAGAGGG - Intergenic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1133037252 16:3040595-3040617 CAGGAGAAAAATGAGTAGGAGGG + Intergenic
1133430586 16:5733710-5733732 AAGGGAATAAAGAGGTAAGAGGG - Intergenic
1133623592 16:7549668-7549690 CATGGGAGAAAGATGTAAGCCGG + Intronic
1133833466 16:9345610-9345632 CAAGGGGAAGAGAAGTAACAGGG - Intergenic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134033284 16:11009752-11009774 CAGGGGAAACTGAAGTACCAAGG - Intronic
1134264751 16:12683548-12683570 TTGGGGCAAAAGAAGTAAGCGGG - Intronic
1134481463 16:14623204-14623226 CATGGGAAAAGGATATAAGAAGG + Intronic
1134824598 16:17274461-17274483 CAGGGGAAAAGGATATAGGAAGG + Intronic
1135294821 16:21270057-21270079 AAGTGGGAAAAGAAGGAAGAAGG + Intronic
1135491080 16:22910066-22910088 AAAGGAAAAAAGAAGTTAGAAGG + Intronic
1135644506 16:24149968-24149990 CAGGGGGAAAAAAACAAAGAAGG - Intronic
1135751296 16:25060502-25060524 CAGAGTAAAAAGATGTAAGTGGG - Intergenic
1135787789 16:25366028-25366050 CATGGGGAAAAGAAGTTAGCTGG + Intergenic
1135796863 16:25453450-25453472 CAGGGGAAAAAAAAGAAAAGAGG - Intergenic
1136331789 16:29584252-29584274 CAGGGAAAAAAAAAAAAAGATGG - Intergenic
1136415941 16:30103890-30103912 CTGGCGAAAAAGAAGAAAAACGG - Intergenic
1136701313 16:32146234-32146256 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1136766349 16:32781230-32781252 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1136801749 16:33089148-33089170 CAGTCGAGAAAGAAGCAAGAGGG + Intergenic
1138097905 16:54227035-54227057 TGGGGGAAAAGGAAGAAAGAAGG + Intergenic
1138404471 16:56778566-56778588 CAGAGGAAAAAGATGTGTGAGGG + Intronic
1138771643 16:59671638-59671660 AAGAAGAAAAAGAAGTCAGAAGG - Intergenic
1139328432 16:66169383-66169405 GAGGGGAAAGAAAAGTAGGAAGG + Intergenic
1139605162 16:68013062-68013084 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1139614969 16:68083453-68083475 CAGGGGTGAATGAAGTCAGAGGG - Intergenic
1140330790 16:74054880-74054902 AAGGGGAAGAAGAAATAAAAGGG + Intergenic
1140471385 16:75217198-75217220 CAGGGGAAAAAGAAAAAAAAAGG + Intergenic
1140638335 16:76942866-76942888 GAGGGAAAGAAAAAGTAAGAAGG + Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1141363600 16:83420911-83420933 CAGGGGAAAAAGAAGTAAGACGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1203068737 16_KI270728v1_random:1043476-1043498 CAGTCGAGAAAGAAGCAAGAGGG - Intergenic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143607298 17:7995761-7995783 CAAGGGAAAAAAAAGTATCATGG - Intergenic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144010920 17:11147721-11147743 TGGGGGACAAAGAAGCAAGATGG + Intergenic
1144334351 17:14255636-14255658 CAGGGGAAGAGGAATCAAGATGG - Intergenic
1144390469 17:14788945-14788967 CAGGGGAGACAGAAGTGAGATGG - Intergenic
1144405205 17:14945925-14945947 CAAGGAAAAAAGAAGATAGAAGG + Intergenic
1144656618 17:17041460-17041482 TAGGGGAAGAAGGAGCAAGAGGG - Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1146699261 17:34940543-34940565 CAGAGCAAAAAGAAGAAATATGG - Exonic
1146853420 17:36242999-36243021 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1146869330 17:36366891-36366913 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147072204 17:37967515-37967537 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1147083729 17:38047052-38047074 CAGGGGAAAAAAAAGGGTGAGGG + Intronic
1147099675 17:38171019-38171041 CAGGGGAAAAAAAAGGGTGAGGG + Intergenic
1148026095 17:44588678-44588700 AAGAAGAAAAAGGAGTAAGACGG - Intergenic
1148950938 17:51311792-51311814 CACGGGAGAAAGAAGTAGGCTGG + Intergenic
1149015888 17:51907800-51907822 GCGGGGAAAAGGAAGAAAGAAGG - Intronic
1149084194 17:52694582-52694604 CAAGGGAAAAAAACTTAAGATGG + Intergenic
1149378335 17:56068092-56068114 CAAGGTTAAAAGAAGTATGAAGG - Intergenic
1149600270 17:57888928-57888950 CAGGGGAGGAAGAAAGAAGATGG + Intronic
1150008709 17:61486069-61486091 CAGGGGACAGGGAAGTGAGAGGG + Intergenic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1152274737 17:79349666-79349688 CAGGGGGAAAGGAAATAAGCAGG - Intronic
1152322357 17:79614821-79614843 GAGGAGAAAAAGAAGAAAGAGGG + Intergenic
1152412793 17:80137690-80137712 ATGGAGAAAATGAAGTAAGAGGG - Intronic
1153299910 18:3583362-3583384 AAGGGGAAAGACAAGAAAGAGGG - Intronic
1153449672 18:5213248-5213270 CAAGCGAAAAAGGAGTAAAAAGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1155039197 18:22050808-22050830 CAAGAGAAAAACAAATAAGAGGG - Intergenic
1155450415 18:25957520-25957542 CAGGGCAAAGAGAAATAGGAAGG - Intergenic
1155692564 18:28643949-28643971 CCTGGGAAAAAGAAGAAAAAAGG + Intergenic
1155863773 18:30938606-30938628 CAGGCCAATAACAAGTAAGAAGG - Intergenic
1156211181 18:34944758-34944780 AAGGAGCAAAAGAAGGAAGAAGG + Intergenic
1156582716 18:38395838-38395860 CACGGGAGAAAGATGTAAGCTGG - Intergenic
1156671760 18:39479222-39479244 AAGGGGAAACAGGAGAAAGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156812946 18:41274238-41274260 CAGGGGAAAGAGTAGCAGGAGGG + Intergenic
1157437414 18:47682501-47682523 CAGAGGAATAACAAGTGAGAAGG + Intergenic
1157450445 18:47782791-47782813 CAGGGGAACAAAAACTGAGAAGG - Intergenic
1157465184 18:47937909-47937931 CTGGGGAAAAGGGAGCAAGATGG - Intergenic
1158005982 18:52672631-52672653 AAGGGGAAAAAGAGGAAAGAGGG - Intronic
1158021068 18:52842449-52842471 TAGAACAAAAAGAAGTAAGAAGG - Intronic
1158183972 18:54750420-54750442 AAGGAGGAAAAGAAGGAAGAAGG - Intronic
1158310108 18:56149023-56149045 AAGAGGAAGAAGAAGGAAGAGGG + Intergenic
1158523022 18:58187412-58187434 CCGGGGAAGAAGGAGTAAGAAGG + Intronic
1158606825 18:58902929-58902951 CAGAGGAAAAAGAAAAACGAGGG - Intronic
1158897721 18:61930875-61930897 CAGTAGAAATAGAAGCAAGATGG + Intergenic
1159723764 18:71927457-71927479 TAGAGAAAAAAGAGGTAAGAAGG - Intergenic
1159740367 18:72160538-72160560 CAGGAGAAAATGAAGAAAAAAGG - Intergenic
1159820449 18:73134953-73134975 CAGAAGAAAAAGAAGGAAGTGGG - Intergenic
1160174966 18:76585915-76585937 GAAGGGAGAAAGAAGAAAGAAGG - Intergenic
1160251024 18:77203530-77203552 CATGGGATAAAGAAGCCAGAAGG - Intergenic
1160289046 18:77573236-77573258 CTGGGGAAAAGAAAGTAAGAAGG - Intergenic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161994222 19:7702617-7702639 AAGGGGAAAAAAAAGACAGAAGG + Intergenic
1162075709 19:8185612-8185634 CAGGGGAAAAAAAAAAAAAAAGG + Intronic
1162227638 19:9237199-9237221 AAGGGAAAAGAGAAGTAAGAAGG - Intergenic
1162300478 19:9842177-9842199 AAGTGGAAGAAGAAGTGAGAGGG + Intronic
1163113042 19:15173001-15173023 AAGAGGAAGAAGAAGGAAGAGGG - Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1163194941 19:15711306-15711328 CTGAGGAAAAAGAACTTAGACGG + Intergenic
1163200933 19:15768583-15768605 AAAGGGAGAAAGAAGGAAGAGGG - Intergenic
1163912410 19:20208667-20208689 AAGGGGAAAAAGAAAAAAAAAGG - Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164441199 19:28282077-28282099 TCGGGGAAGAAGAAGAAAGAAGG - Intergenic
1164587067 19:29482614-29482636 CAGGGGGAAAAGAAGGGAGTTGG - Intergenic
1164808186 19:31133934-31133956 TAGGGGAAAAAGAAGAACCAAGG + Intergenic
1164916781 19:32058340-32058362 AAGGAAAAAAGGAAGTAAGAAGG - Intergenic
1165364675 19:35358199-35358221 CAGGGGAGAAAGCAGAAACATGG + Intergenic
1165533800 19:36426136-36426158 CAGGGACATAAGATGTAAGAGGG + Intergenic
1165971640 19:39636717-39636739 AAGAGAAAAATGAAGTAAGAGGG + Intergenic
1167051981 19:47084992-47085014 AAAGGGAAAAAGGACTAAGAAGG + Intronic
1167490400 19:49789736-49789758 TTGGGGAGAAAGAAATAAGATGG - Intronic
1167728711 19:51236825-51236847 CAGCAGAATAAGGAGTAAGAGGG - Intronic
1168143879 19:54408430-54408452 GAGGGGAAAAGGAAGGAAGAAGG + Intergenic
924993207 2:333340-333362 CACAGGAAAAAGAAATAAAAAGG + Intergenic
925032198 2:659626-659648 GAGGGAGAAAAGAAGGAAGAAGG + Intergenic
925481745 2:4283038-4283060 GAGGGGAATAAGAACTAAGATGG - Intergenic
925499088 2:4484309-4484331 CATGGGAAAAAGATGTAGGTTGG + Intergenic
926339078 2:11889229-11889251 CAGTGGAAAAAAAATCAAGAAGG + Intergenic
926377017 2:12240703-12240725 CAGAGGAAAGAGAAGGAACATGG - Intergenic
926561955 2:14427270-14427292 CACAGGAAAAAGAAGGAAGCGGG + Intergenic
926740208 2:16104271-16104293 CAGGGGACTAAGAAAAAAGAAGG + Intergenic
927417904 2:22898092-22898114 CAGAAGAAAAGGAAGAAAGAAGG + Intergenic
927943787 2:27122576-27122598 CAGGGGAAGAAGGAGGAACATGG - Intergenic
928070348 2:28208895-28208917 CAAGGAACAAAGAAGAAAGACGG - Intronic
928250810 2:29677221-29677243 GAGGGGAGAAGGAAGGAAGAAGG - Intronic
928627592 2:33156369-33156391 CAAGCCAAAGAGAAGTAAGATGG - Intronic
929019523 2:37537969-37537991 CAGGGGAAAATGAATTATCATGG + Intergenic
929027139 2:37615673-37615695 CAGGGGAACAAGAAGAGATAGGG + Intergenic
929087717 2:38184655-38184677 TATGAGAAAGAGAAGTAAGACGG + Intergenic
929200800 2:39233426-39233448 GAAGGGAAAAAGAAGCGAGAAGG + Intergenic
930121274 2:47762989-47763011 CAGGGGAGAAAGATGTAGGCTGG + Intronic
930236579 2:48894653-48894675 CAGGTGCTGAAGAAGTAAGAGGG - Intergenic
930424991 2:51201751-51201773 AAGGAGAAAAAGACATAAGAGGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930535329 2:52638684-52638706 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
930722260 2:54648908-54648930 CAGGGGAAAAACAAATGAGGTGG - Intronic
930883812 2:56301550-56301572 CAAGTGAATAGGAAGTAAGAAGG + Intronic
931012113 2:57929279-57929301 AAGGGGAAAGAAAAGTCAGAAGG - Intronic
931068991 2:58622832-58622854 CATGGGTAAAAGTAATAAGAAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932813330 2:74842629-74842651 CAGAGGACAGAGAAGTCAGAAGG + Intronic
932841529 2:75087721-75087743 CAGGGGAAAAGTGATTAAGAAGG - Intronic
932859080 2:75269793-75269815 CATGGGAGAAAGATGTAGGATGG + Intergenic
932880391 2:75495856-75495878 GAGAAGAAAAAGAAGTAAGTGGG - Intronic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933530796 2:83508982-83509004 CAGGGGAGAAAGAAATCAAAAGG - Intergenic
933649884 2:84842057-84842079 CATGGACAAAAGAAATAAGATGG - Intronic
934050241 2:88204359-88204381 CAGGGGAAAGGGTAGTGAGAGGG - Intergenic
934073466 2:88407345-88407367 CATGGGAAAAAGATGTAGGCTGG - Intergenic
934126235 2:88893701-88893723 CTGTGGAAAAGGAAGTAAGAGGG + Intergenic
934484262 2:94688062-94688084 CTGGGAAAAAGGAAGTAAGGTGG + Intergenic
934494912 2:94788428-94788450 CAGGAGAAAAAGAAGAGAGCAGG + Intergenic
934812334 2:97291081-97291103 CAGTGAAAATATAAGTAAGATGG + Intergenic
934825360 2:97416842-97416864 CAGTGAAAATATAAGTAAGATGG - Intergenic
935566357 2:104612205-104612227 CACGGGAAAAGGCAGGAAGAGGG - Intergenic
936314934 2:111416238-111416260 CAGGGGGAAAAAAAGGAAGGAGG + Intergenic
938505435 2:131875831-131875853 GAAGGAAAAAAGAAGTGAGAGGG - Intergenic
938713813 2:134000457-134000479 CAGGGGAAAAGGAAGTCAGATGG + Intergenic
939048034 2:137272742-137272764 TTGGTGAAAAATAAGTAAGAGGG + Intronic
939316413 2:140556186-140556208 CAGGGGAGAAAGGAGAGAGAAGG - Intronic
939545566 2:143548217-143548239 CAGGGGCAAAAGAAGGAAGTGGG + Intronic
939706822 2:145465172-145465194 CAGGAAAAGAAGAAGAAAGAAGG + Intergenic
939792242 2:146592340-146592362 CAGTGGCAAGAGAAATAAGATGG - Intergenic
939835823 2:147128227-147128249 CAGTGGCCAAAGAAGTAAGGTGG - Intergenic
941010769 2:160297197-160297219 CAGGGGAGAAAGATGGAGGAGGG + Intronic
941410153 2:165144689-165144711 TAAGGGAAAAAAAAGTAAGCAGG - Intronic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941752300 2:169145935-169145957 CAGGGGAAAAACAAAACAGAAGG + Intronic
941958105 2:171225447-171225469 AAGGGGAAAAAAAAGGAAAAAGG + Intronic
942457804 2:176149933-176149955 CAGAAGAAAAAGAAGCGAGAGGG - Intergenic
943108348 2:183574614-183574636 TAGGGAAAAAATAATTAAGAAGG + Intergenic
943881628 2:193152808-193152830 CATAGGAATAAGAAGTTAGAAGG + Intergenic
944397721 2:199288439-199288461 CAGGGGAAAGAGATGAAAGAAGG + Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944405355 2:199377820-199377842 CAAGGGAAAAAGATTTTAGATGG + Intronic
944868055 2:203881446-203881468 CACGGGAAAAAGATGTAGGCTGG - Intergenic
945024781 2:205609805-205609827 GAGGGGAAAAACAACTAAGTTGG - Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945318282 2:208393560-208393582 CAGGAGAAAAAGAGGAGAGAGGG - Intronic
945396154 2:209321465-209321487 CATGGGAGAAAGATGTAAGCTGG + Intergenic
946363603 2:219234932-219234954 GAGGAGAAAAAGGAATAAGAAGG + Exonic
946460035 2:219860810-219860832 AAGGAAAAAAAGAAGGAAGAAGG + Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
947169565 2:227297941-227297963 CAGGGAAAGAAGAAGCAACAAGG - Intronic
947286047 2:228516098-228516120 TAGGGGAAAAAAAAGCTAGAGGG + Intergenic
947391842 2:229647197-229647219 CAGGGTAAGAAGAGGTCAGAGGG + Intronic
948040785 2:234900055-234900077 AATGAGAAAAAGAAGTGAGAAGG + Intergenic
948228106 2:236328654-236328676 CAAGGCTAAAAGAAGGAAGAGGG - Intronic
948488304 2:238295259-238295281 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
948877105 2:240835442-240835464 CAGGAGAAAAACAAGAAATAGGG - Intergenic
949008748 2:241666768-241666790 CAGGGGAATGAGAAGTACCAGGG - Exonic
1169244327 20:4014258-4014280 AAGGGGAAAAAAAAGCAAGGAGG + Intronic
1169639793 20:7738530-7738552 CAGGGCAAAAAGAAGAGATAAGG - Intergenic
1169697284 20:8404510-8404532 CAGGGGAGAAAAAAGGAAGAAGG - Intronic
1169815797 20:9654801-9654823 CAGGGGAGGGAGAAGTTAGAGGG - Intronic
1170110060 20:12795427-12795449 CATGGGAAAAAGGAGAAGGAGGG - Intergenic
1170372056 20:15659829-15659851 CAGGGGAAACAGACATATGAGGG + Intronic
1171039187 20:21743976-21743998 CAGGGTAGAAAGAAAAAAGATGG - Intergenic
1171151901 20:22834835-22834857 GAAGGGAGAAAGAAGTAAAAAGG - Intergenic
1171343758 20:24450475-24450497 CAGTGGAAAGGCAAGTAAGATGG - Intergenic
1171570759 20:26249199-26249221 AAGATGAAAAAGGAGTAAGAGGG - Intergenic
1172062787 20:32197703-32197725 TAGGGGAGAAAGCAGAAAGAGGG + Intronic
1172073285 20:32274721-32274743 CAGGGGAAAAAAAAATAGGAGGG + Intergenic
1172973117 20:38887981-38888003 CAGGGGAAAAAGAAGCTGGTAGG - Intronic
1173300048 20:41794437-41794459 TAGGAGAAAAAGAGGAAAGAAGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1174214652 20:48906963-48906985 AAGGAGAGAAAGAAGGAAGAAGG - Intergenic
1174288199 20:49486984-49487006 CAGAAGAAAAACAAGTAACAAGG - Intergenic
1174508200 20:51030695-51030717 CAGATGAAAATGAAATAAGAGGG - Intergenic
1174627569 20:51928013-51928035 CAGGGGAATTAGAAGTAAGGAGG + Intergenic
1174666192 20:52260257-52260279 CATGGGAGAAAGATGTAAGCTGG - Intergenic
1174980788 20:55392262-55392284 CATAGGAAAAGGAAGTAAAAAGG + Intergenic
1175153139 20:56951006-56951028 AAGGGGAGAAAGAAAGAAGAAGG + Intergenic
1175427772 20:58880290-58880312 CCGAGGGAAAATAAGTAAGATGG - Intronic
1175474529 20:59261824-59261846 TAGGGCAAAAAGCATTAAGATGG - Intergenic
1175663463 20:60837642-60837664 CAGGATAGAAAGAAGTAAGGAGG + Intergenic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1176998763 21:15586093-15586115 AAGAGGAAAAAGAAGCAACACGG + Intergenic
1177014441 21:15767656-15767678 GAGGGGAAAAAGAAACTAGATGG + Intronic
1177177322 21:17714159-17714181 CAGGGGAAGAGGAAAAAAGAAGG + Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177516982 21:22165886-22165908 CAGTAGAAAAAGAAGAAACAAGG + Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178061725 21:28860280-28860302 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
1178106348 21:29323479-29323501 CAGGGGAGAAAGATGAAAGCTGG + Intronic
1178286688 21:31331413-31331435 CAGGGGAAAAATGAGGAAGGAGG + Intronic
1178370559 21:32023582-32023604 CTGGGGAAAGAAAAGTCAGAGGG - Intronic
1178459680 21:32791495-32791517 AAGGGGAAAAAGGAGGAAAAAGG - Exonic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179473237 21:41626043-41626065 CAGGGGAGAGAGAAGAACGAAGG + Intergenic
1180572919 22:16746215-16746237 AAGATGAAAAAGGAGTAAGAGGG - Intergenic
1181008906 22:20028841-20028863 CATGGGGAAAAGAAGCAAGGGGG - Intronic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182342317 22:29633377-29633399 CAGAGGAGACAGAATTAAGAGGG - Intronic
1182888063 22:33792878-33792900 CACGGGAAAAAGAAAGGAGAAGG + Intronic
1184706195 22:46215150-46215172 CTGGGGAAAAAGAGGAGAGACGG - Intronic
1184822053 22:46916840-46916862 CAAGTGAAAACGAAGTGAGAGGG + Intronic
949140957 3:632298-632320 CATGGGAAAAAAAAGTAAGTGGG + Intergenic
949246190 3:1927427-1927449 CACGGGAAAAAGATGTAGGCTGG + Intergenic
949425850 3:3914991-3915013 CATGGGAGAAAGATGTAAGCTGG - Intronic
949635356 3:5976296-5976318 CGGGGGAAAAAGATGTAGGCTGG + Intergenic
949984248 3:9527056-9527078 GAAGGGAGAAAGAAGTAAGCAGG + Intronic
950210949 3:11122720-11122742 TGGGGTAAAATGAAGTAAGATGG - Intergenic
950281266 3:11710048-11710070 CAGGAGCAAAAGAGGCAAGAAGG + Intronic
950755651 3:15169756-15169778 CAGGAGAATATGAAGTAAAAAGG - Intergenic
951290952 3:20871857-20871879 CATGGGAGAAAGATGTAAGCTGG - Intergenic
951329404 3:21347883-21347905 CAGAGGAGAAAGGTGTAAGAAGG - Intergenic
952202421 3:31144828-31144850 CAGGGAAAACAGAACTAAGAGGG - Intergenic
952276326 3:31880640-31880662 CAGTGGAAGATGAAGTGAGAAGG - Intronic
952437813 3:33289762-33289784 CAAGGGAAAGAGAGCTAAGAAGG + Intronic
952447908 3:33401017-33401039 CTGGGGAGAAAGGAGAAAGAAGG + Intronic
952523526 3:34185903-34185925 CAGGGGAAAAAGAGAGAAAAAGG + Intergenic
952909074 3:38166489-38166511 GAAGACAAAAAGAAGTAAGAAGG + Intronic
952993314 3:38852376-38852398 AAGGGCAAAAAGAAATATGAGGG + Intronic
953180680 3:40591578-40591600 CAAGGGAAAAAGATGTAGGCTGG + Intergenic
953186532 3:40643060-40643082 CAGGGAAAAAAAAAGCAAGTGGG - Intergenic
953244741 3:41180449-41180471 TATGGGAAAAAGAGGTATGATGG - Intergenic
953647555 3:44769194-44769216 AAGGGGAAAAGGAAAAAAGAAGG + Intronic
954354438 3:50073142-50073164 CAGGGGATAAAGGAGGAGGATGG - Intronic
954494003 3:50935476-50935498 CAGTGGAATATGAAGTAAGGAGG + Intronic
955148014 3:56339338-56339360 CAGGGGAAAGAGAAGTGTAAGGG + Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955307473 3:57848655-57848677 AAGAGGAAAAAGAAGAAGGAAGG - Intronic
955864112 3:63363965-63363987 CAGGGACAATAGAAGTAATAAGG - Intronic
956014484 3:64867331-64867353 CAGGGGAAAGGGAAGTCACATGG - Intergenic
956095210 3:65708809-65708831 AAGAAGAAAAAGAAGAAAGAAGG - Intronic
956349660 3:68320848-68320870 CAGGGGAGAAGGAGGTAAGCAGG - Intronic
956400044 3:68868650-68868672 AATGGGAAAATGAAGCAAGAAGG + Intronic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
956608960 3:71102592-71102614 CTTGGGAAAGAGAAGAAAGACGG - Intronic
956794356 3:72704551-72704573 TAGGGGAGAAGGAAGAAAGAAGG - Intergenic
956863698 3:73349132-73349154 CAGTGAAGAAAGAAGTAGGATGG + Intergenic
956873208 3:73438509-73438531 CATGTCAAAAAGAAGTGAGATGG + Intronic
957104772 3:75872703-75872725 AAGATGAAAAAGGAGTAAGAGGG + Intergenic
957523638 3:81352558-81352580 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
957574666 3:81991540-81991562 CAGGTGAAAAGGAAGAAAAAAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
957824141 3:85418965-85418987 GAGGGGAAAAAAAAATGAGAAGG + Intronic
957892285 3:86376128-86376150 AAGGGGAAGAAGATGAAAGAAGG - Intergenic
958552449 3:95634662-95634684 TAGTGGAAAAAGAAGGTAGAAGG - Intergenic
958906504 3:99947671-99947693 TAAGGGAAAAAGAATTTAGAGGG - Intronic
959118272 3:102203775-102203797 CAGAGGAAAAAAAGGAAAGAAGG - Intronic
959157064 3:102679606-102679628 TAGGGGAAAAAAATGTAATAAGG - Intergenic
959217481 3:103470444-103470466 AAGGGCAAAAGGCAGTAAGAGGG + Intergenic
959236624 3:103730945-103730967 GAGGAAAAAAAAAAGTAAGATGG - Intergenic
959456839 3:106573187-106573209 CATGGGAGAAAGATGTAGGATGG + Intergenic
959999716 3:112717916-112717938 GATGGGAAAAAGAAGAAAGGAGG + Intergenic
960192120 3:114719194-114719216 GGGGGGAAATAGAAGCAAGAAGG + Intronic
960360412 3:116704241-116704263 CAGGAGAGAAACAGGTAAGAGGG + Intronic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
961746373 3:129065998-129066020 CAGGGGAGAAAGATGAAAGCCGG - Intergenic
962006840 3:131358233-131358255 CAAGGGAAAAAGAAATATGGTGG - Intergenic
962174451 3:133138355-133138377 CAGGAGAAAAAGGAGTGAAAAGG + Intronic
962268867 3:133963378-133963400 CAAGGGAATAAATAGTAAGAGGG + Intronic
962292487 3:134148151-134148173 CAGGGGAGGAAGATGTAGGATGG - Intronic
962482853 3:135812623-135812645 AAGGGGAAAAAGAAGTCAGGGGG - Intergenic
962842930 3:139251979-139252001 CAGGGGAAGAAGAGAAAAGAGGG + Intronic
963042814 3:141081763-141081785 AATGGGAAAAATAAGAAAGAGGG + Intronic
963627159 3:147688386-147688408 CAGGAGAAAAAGAAGCTAGAGGG + Intergenic
963794368 3:149616900-149616922 AAGTGGAAGAAAAAGTAAGAAGG + Intronic
963923642 3:150929020-150929042 CTGTGGAAAAACAAGAAAGAGGG + Intronic
963986603 3:151602724-151602746 GATGGGAAAATGAAGTATGAAGG - Intergenic
964450064 3:156803534-156803556 CAGGGAAAAAATAAGTAGAATGG - Intergenic
964591027 3:158361806-158361828 AGGGGGAAAAGGAAGAAAGAAGG - Intronic
965316711 3:167200568-167200590 AATGGGATAAAGAAGAAAGAAGG - Intergenic
965474375 3:169136774-169136796 AAGGGGGAAAATAAGAAAGAAGG + Intronic
965979865 3:174674727-174674749 AAGGGAGAAAAGAAGTAAAAAGG - Intronic
966521895 3:180882295-180882317 CGGAGGAAGAAGAAGGAAGAAGG - Intronic
967934610 3:194716849-194716871 AAGGGGAAACAGAAGTACCAAGG + Intergenic
969547680 4:7842506-7842528 CAGGAGGAAAAGAAGGAAGGTGG + Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970127258 4:12828869-12828891 CACGGGAGAAAGATGTAAGCTGG - Intergenic
970974727 4:22030340-22030362 CAGCGTAGAAAAAAGTAAGATGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971291909 4:25350419-25350441 CAGGGGAAAAAAAATTAGGTGGG - Intronic
971303024 4:25457305-25457327 CAGGGGAAAAAGCGGTAAGGAGG - Intergenic
971420251 4:26467893-26467915 GAGGGGAAGAAGAAGAAGGAGGG + Intergenic
972095087 4:35339066-35339088 CACAGGAAAAAGATGTAAGCTGG - Intergenic
972368071 4:38394500-38394522 CAGGGGACAAAGAAGGAAAGGGG + Intergenic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
972732562 4:41809213-41809235 AAGGGGAAACAGTAGTAGGAAGG - Intergenic
974247499 4:59339578-59339600 CAGAGGATAAAGAAGAGAGAAGG + Intergenic
974352016 4:60760670-60760692 GAGAAGAAAAAGAAGAAAGATGG + Intergenic
974500158 4:62689095-62689117 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
974685185 4:65217817-65217839 CAGAGGAAAAAAAATTAAAAAGG + Intergenic
975028215 4:69578513-69578535 AAGGAGAAGAAGAAGAAAGAAGG - Intergenic
975436117 4:74353820-74353842 AAGGGGAAAGAAAAGAAAGATGG + Intergenic
975711531 4:77164865-77164887 CAAGGGAAATAGGAGAAAGATGG - Intronic
975876191 4:78839773-78839795 CATGGGAGAAAGATGTAAGCTGG + Intronic
976048862 4:80986328-80986350 GATGGCAAAAAGAAGAAAGAAGG + Intergenic
976659559 4:87525577-87525599 CAGGGGAAAAACAACTGGGAAGG - Intronic
977287944 4:95132610-95132632 CAGAGGAAAAAAAAATCAGAAGG - Intronic
978071614 4:104479732-104479754 GAGGGGAAAAAGAAAGAAGGAGG - Intronic
978593137 4:110348118-110348140 AAGGGGAAAAAAAGGAAAGACGG - Intergenic
978886194 4:113768976-113768998 CAGGAGAATAAGAAATAACAGGG - Intergenic
979117207 4:116840720-116840742 CAAGGGTAAAGGAAGTAAGCTGG - Intergenic
979130291 4:117036381-117036403 CAGGGGAAAAAAAAGAGAGCAGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
979772513 4:124546152-124546174 CAGTGGGTAAAGAAGCAAGAGGG + Intergenic
980252018 4:130329334-130329356 CAGGGAAAAAGAAAGTAGGAAGG + Intergenic
980429571 4:132676071-132676093 AAGGGGAAAATGAGGGAAGATGG + Intergenic
980617725 4:135253484-135253506 CAAGGGAAGAAAAAGAAAGATGG - Intergenic
980725300 4:136751118-136751140 CAGGGCAGAATGAAGCAAGATGG + Intergenic
981452575 4:144915653-144915675 CACGGGAGAAAGATGTAGGATGG + Intergenic
981716633 4:147758595-147758617 CAGGGGACAAAGAATGGAGAAGG - Intronic
982526771 4:156488880-156488902 CATGGGAGAAAGATGTAAGCTGG - Intergenic
982981038 4:162135617-162135639 CAGATGAGAAAGTAGTAAGAGGG - Intronic
983184170 4:164682242-164682264 CATGGGAAAAGGGCGTAAGATGG - Intergenic
983390468 4:167124394-167124416 GTGGGGAACAAGAAATAAGAGGG - Intronic
983701177 4:170596095-170596117 CATGGGAGAAAGATGTAAGCTGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
985349988 4:189049829-189049851 GAGGGGAAAAATAAGAATGAAGG - Intergenic
985823470 5:2176658-2176680 CAAGGAACAAAGAAGAAAGATGG - Intergenic
986278649 5:6304497-6304519 GAAGGGAAAAAGATGGAAGAAGG + Intergenic
986694299 5:10338488-10338510 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
986722257 5:10567734-10567756 TAGGGGAAAGAGGAGTTAGACGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987619677 5:20324687-20324709 GAGGGTAAAATGTAGTAAGAAGG + Intronic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988964078 5:36398426-36398448 CAGGGGTACATGAAGTTAGATGG + Intergenic
988976123 5:36517264-36517286 ATGTAGAAAAAGAAGTAAGATGG - Intergenic
989092754 5:37751061-37751083 CAGGGGGAAAAAAAGGAACAAGG - Intronic
989421991 5:41251129-41251151 CAGGAGAATAATATGTAAGATGG - Intronic
989566718 5:42908701-42908723 CAGGGGAAAATGAGGTGAGGAGG + Intergenic
990024426 5:51167997-51168019 TGGGGGAAAAAAAAGGAAGAAGG - Intergenic
990501340 5:56399486-56399508 ACAGGGAAAAAGGAGTAAGATGG + Intergenic
990989112 5:61668131-61668153 CAGGGGAAGAAGACCCAAGAAGG - Intronic
991013460 5:61908320-61908342 CATGGGAGAAAGACGTAAGCTGG + Intergenic
991482175 5:67092543-67092565 CAGGGAAAAAAGGATTAAGTAGG - Intronic
991665060 5:68991366-68991388 AATGAGAAAAAGAAGAAAGAAGG - Intergenic
991945686 5:71896649-71896671 CATGGGAGAAAGATGTAAGCTGG - Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992145142 5:73839401-73839423 AAGGGGAAAAAGAAGCAAAAGGG - Intronic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
993144572 5:84077775-84077797 GAGGGGAAGAGGAAGAAAGAAGG - Intronic
993503272 5:88684906-88684928 CGGGGGAGAGAGAAGTAAAAGGG + Intergenic
993513624 5:88801929-88801951 TCATGGAAAAAGAAGTAAGATGG - Intronic
993884099 5:93396453-93396475 AAGGGGAAAGAGAAGTAAAGAGG - Intergenic
993931314 5:93944713-93944735 GAGATGAAAAAGAAGAAAGAGGG + Intronic
994110765 5:96001357-96001379 CTGGGGAAGAAGAATCAAGAAGG + Intergenic
994749189 5:103717647-103717669 CAAGGGAAAAAGAAAAAATAGGG - Intergenic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995239941 5:109874259-109874281 GAGGGGAAGAATAAGTAAAAGGG + Intergenic
995265093 5:110150951-110150973 CATAGGAAAAATAAGTCAGAAGG - Intergenic
995394979 5:111677921-111677943 CAAGGTAAAAAGAGTTAAGAGGG - Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995459701 5:112390065-112390087 TTTAGGAAAAAGAAGTAAGATGG + Intronic
995611200 5:113912254-113912276 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
995673875 5:114640348-114640370 AAGGGGAAAAAAATGTAAAAGGG + Intergenic
995936812 5:117526721-117526743 CAAGGAAAAGAGAAGAAAGAAGG + Intergenic
996343750 5:122467580-122467602 AAGAAGAAAAAGAAGAAAGAAGG + Intergenic
996831163 5:127742077-127742099 CAGGGAAATAAGGAGTAACAAGG - Intergenic
996860705 5:128062544-128062566 CAGGTGAAAGGGAAGTAGGATGG + Intergenic
996867187 5:128138259-128138281 CTGAGGTAAAAGAAGCAAGAAGG - Intronic
996904167 5:128578489-128578511 GAGGGGAAACAAAAGAAAGAAGG - Intronic
997022976 5:130023806-130023828 GAGAGGAAAAATGAGTAAGACGG + Intronic
997035243 5:130183079-130183101 GAGGTGAAAAAGAAGAAAAAAGG - Intronic
997232583 5:132255378-132255400 CAGGGGAAAAGGAAATCTGAGGG + Intronic
997317957 5:132953754-132953776 CAGTGGAAAAAGAAGTGAGGAGG - Intronic
998425727 5:142027027-142027049 GAAAGGAAAAAGAAGAAAGAAGG - Intergenic
998813697 5:145991568-145991590 ACGGAGAAAAAGAAGAAAGAGGG + Intronic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999076861 5:148804535-148804557 GAGGGGAAAAAGGAGCAAGTTGG + Intergenic
999092509 5:148949491-148949513 GAGGGAAAAAAGAAATAATAAGG - Intronic
999505860 5:152195273-152195295 CAGTGAAAAATGAATTAAGAAGG - Intergenic
999695397 5:154184489-154184511 CAAGGAAAGAAGAAGCAAGAAGG + Intronic
999949434 5:156633052-156633074 CAGAGAAAAAAGAAGTCACATGG - Intronic
1000127790 5:158263745-158263767 CAGGGTTAAAATAAGTAAGTAGG - Intergenic
1000311190 5:160046479-160046501 GAGGGGAAAAAAAAAGAAGAGGG - Intronic
1000841048 5:166219049-166219071 GAGGGGAAAAGGAAGGAAGGAGG + Intergenic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001196309 5:169676371-169676393 TGGGAGAAAAAGAAGAAAGAGGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001780848 5:174367839-174367861 TAGGAGAAAAAGAGGCAAGATGG + Intergenic
1001791222 5:174459414-174459436 AAGGCAAAAAAGAAGAAAGAGGG + Intergenic
1003341471 6:5225293-5225315 CAGGTAAAAAAGATGTAAGGTGG + Intronic
1003913885 6:10767440-10767462 CAGGGGATAAGGAAGTATTAGGG + Intronic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1004319652 6:14622378-14622400 CAAGGGAAAGAGAAGTCAGAAGG + Intergenic
1004469087 6:15912594-15912616 CAAGAGAAAAGGAAGGAAGAAGG - Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1005088490 6:22032037-22032059 GAAGGCAAAAAGAAATAAGATGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006880344 6:37333436-37333458 CAGAGTAGAAAGAACTAAGATGG + Intergenic
1007343455 6:41208896-41208918 CAGGGGAAGTAGATCTAAGAGGG + Intergenic
1008261724 6:49374093-49374115 CATGGGAAAAAGATGTAGGCTGG - Intergenic
1008366175 6:50683112-50683134 CAAGGGCAAAAGAAGTTAGGAGG - Intergenic
1008374046 6:50771252-50771274 CAGGGACAAAACAAGTTAGAAGG - Intronic
1009489220 6:64266853-64266875 CAGTAGCAAAAGAAGTTAGAAGG + Intronic
1009714916 6:67378945-67378967 AAGGGGAAACAGAAGGAAAAGGG - Intergenic
1009760752 6:68002350-68002372 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1009950860 6:70394165-70394187 CAGTGGAAAAATAAAGAAGAAGG + Intergenic
1010024166 6:71196548-71196570 CAAGGGAAAGTGAATTAAGAAGG - Intergenic
1010705263 6:79101264-79101286 CATGGCAAAAAGATGTAAGCCGG + Intergenic
1011294176 6:85808803-85808825 CATGGGAGAAAGATGTAAGCTGG - Intergenic
1011409190 6:87048938-87048960 CAGAGGAACAACAAGTAAGAAGG + Intergenic
1012088358 6:94858949-94858971 TAGGGGAAAAAGCAGAAAGAGGG + Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012179591 6:96135643-96135665 CGGGGGAGAAAGAAGTGGGAGGG + Intronic
1012415817 6:99012206-99012228 CAGAGGAAGAAGAAGTGATATGG + Intergenic
1012738570 6:102982580-102982602 CAGGGGGAAAAATATTAAGAAGG + Intergenic
1012928433 6:105291561-105291583 CATGGGAGAAAGATGTAAGCTGG - Intronic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013945504 6:115717628-115717650 CAGGGGAAAAAGAAGAACAATGG + Intergenic
1014264693 6:119263031-119263053 CACGGGAAAAAGATGTAGGCTGG - Intronic
1014294914 6:119606219-119606241 CATGGGACAGAGAAGTAGGAGGG - Intergenic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1014599193 6:123387857-123387879 CAGGGGAAAAAGAAAAAAATGGG + Intronic
1015238932 6:131002344-131002366 GAGGGGAGAGAGAAGAAAGAAGG + Intronic
1015383023 6:132591399-132591421 CAGGTCAAAAAGAAGGAAGGAGG + Intergenic
1015907948 6:138136763-138136785 CAGTGGAGAAAGGAGTGAGAGGG + Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016623395 6:146138547-146138569 CAGGCCAATAACAAGTAAGAAGG - Intronic
1016645810 6:146406876-146406898 AAGGAGAAGAAGAAGAAAGAAGG + Intronic
1017381846 6:153840276-153840298 CAGGGGACAAAGCAATAAGAAGG - Intergenic
1018540588 6:164875391-164875413 CTGGGTAAAAAGAAATAATAAGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019771681 7:2887233-2887255 CAGAGGAAAAAAAAGGAAGAAGG + Intergenic
1019785205 7:2972408-2972430 CAGAAGAAAAAGAAGTAGGGTGG + Intronic
1020385278 7:7594072-7594094 TACGGGCAAAAGAACTAAGAAGG + Intronic
1020618813 7:10494367-10494389 CACGGGCAAAAGATGTAGGATGG - Intergenic
1020746340 7:12083266-12083288 CAGAGGAAAAAGAATTACAAAGG + Intergenic
1020850708 7:13348887-13348909 AAGTGGTAAAAGAAGGAAGAGGG + Intergenic
1020938434 7:14499216-14499238 CTGGGCAAAAAGCAGTAAAAGGG - Intronic
1021090793 7:16480256-16480278 GATGGCAAAAAGAAGTAAGTTGG + Intronic
1021132588 7:16928973-16928995 AAGGGGAAAAAAAATAAAGATGG - Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1021681157 7:23133732-23133754 AATGTGAAAAAGAAATAAGAGGG - Intronic
1021953913 7:25804512-25804534 CAGACGAGAAAGATGTAAGAAGG + Intergenic
1022037238 7:26546037-26546059 CAGAGGAAAAAGTAGCCAGATGG - Intergenic
1022343211 7:29487653-29487675 AAGGAGAAAAAGAAGAAAGGAGG - Intronic
1023117467 7:36876307-36876329 CAAGAAAAAAAAAAGTAAGAAGG - Intronic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023413660 7:39911675-39911697 GAGGGGAAAAAAAAGAAATAAGG + Intergenic
1024185485 7:46944335-46944357 CAGTGGAAACAGAAGTGAGCAGG - Intergenic
1024725157 7:52185797-52185819 CAGGGGAGAAAGATGTAGGCTGG - Intergenic
1024859974 7:53827400-53827422 CAAAGGAAAAAGAAGAAAGCTGG + Intergenic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1024883648 7:54116990-54117012 CAGGTGATACAGAAGTGAGAGGG - Intergenic
1025873098 7:65453344-65453366 CAGGGGAAAATGGAGTAGAAGGG + Intergenic
1026261421 7:68758928-68758950 GAGGGGAAAAAGAAGAGTGAGGG + Intergenic
1026525213 7:71147350-71147372 CACGGGAGAAAGAAGTAGGCTGG + Intronic
1027361095 7:77411053-77411075 TAGCGGAAAAAAAAGTAAAAAGG + Intronic
1027456239 7:78395309-78395331 CAATGGAAAAAGAAGAAAAAGGG + Intronic
1027457434 7:78410698-78410720 CAGGGAGAAAAAGAGTAAGATGG + Intronic
1027593673 7:80145871-80145893 CTGGGAAAAACCAAGTAAGAAGG - Intronic
1027920613 7:84389046-84389068 GAGGGGGAAAATAAGTAAAAGGG + Intronic
1028218725 7:88168112-88168134 GAGAGGAAAAAAAAGAAAGAAGG - Intronic
1028417330 7:90595195-90595217 CAGGGGAGAGAGAAGGAAGGTGG - Intronic
1028593123 7:92519817-92519839 GAAGGGGAAAGGAAGTAAGATGG - Intronic
1029317483 7:99727585-99727607 CAGGTGAAAAACAGGAAAGAAGG - Intronic
1030011464 7:105172355-105172377 CAGGGGAGTAGGAAGGAAGAAGG + Intronic
1030535375 7:110759908-110759930 CAGGGGTAAAAGGAGTAACTGGG - Intronic
1030880992 7:114879487-114879509 CAGGGAAAACAGTACTAAGAGGG - Intergenic
1030931533 7:115529179-115529201 TAGGGAAAAAAGAAACAAGAGGG + Intergenic
1031281951 7:119815749-119815771 AAGGGGAAAAAGAAGAAATGTGG - Intergenic
1031792578 7:126126617-126126639 TAGGGTAATCAGAAGTAAGATGG + Intergenic
1031871460 7:127092706-127092728 CAGGGGGAAAAGAAAAAAGAAGG + Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032259058 7:130319967-130319989 ATGGGGAACAAGAAGTTAGAGGG + Intronic
1032337543 7:131040102-131040124 AAGGGGAAAAAAAAGTATGTGGG + Intergenic
1032622042 7:133544830-133544852 CAGGGGAAAAAAAAAAAAAAAGG - Intronic
1032672331 7:134096711-134096733 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1033531774 7:142271328-142271350 AAAGGGAAAAAGAAGTTAAAAGG + Intergenic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033666256 7:143443517-143443539 CAGGCGTAAAAGGAGTAAAATGG - Exonic
1034194655 7:149237173-149237195 CATGGGAGAAAGAAGTAGGCTGG - Intergenic
1034353380 7:150431942-150431964 AAGGGGGAAAAGGAGTGAGAAGG + Intergenic
1034596675 7:152201736-152201758 GAGGGGAAAAACATGTATGAAGG + Intronic
1035793461 8:2330486-2330508 CAGGGAAATAAGAAAAAAGATGG - Intergenic
1035799343 8:2391219-2391241 CAGGGAAATAAGAAAAAAGATGG + Intergenic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1037293646 8:17378224-17378246 GAGGGAAAAAAGAAATAAGGAGG + Intronic
1037579701 8:20237088-20237110 CTTGGGGAAAAGAAGTCAGAAGG - Intergenic
1038082372 8:24153428-24153450 TAGGGGAAAAAAAAGTAAAAAGG + Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1039094057 8:33864246-33864268 CAGGGGAAAAGGAGGTCAAATGG - Intergenic
1039100949 8:33941588-33941610 CACGGAAAAAAGAAGTAAGAAGG - Intergenic
1039169811 8:34731027-34731049 AGGAGCAAAAAGAAGTAAGAAGG + Intergenic
1039909961 8:41818656-41818678 GAAAGGAAAAAGAAGAAAGAAGG - Intronic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1041097173 8:54361598-54361620 AAGGAGAAAAGGAAGGAAGAAGG - Intergenic
1041241983 8:55855991-55856013 CAGTGGCAAAAGAAGAAAGAGGG + Intergenic
1041342564 8:56861352-56861374 CAGTGGAAAAATAACTAAAAGGG - Intergenic
1041989265 8:63966238-63966260 GAGGGAAGAAAGAAGAAAGAAGG - Intergenic
1042000740 8:64121418-64121440 CACGGGAGAAAGAAGTAGGCTGG + Intergenic
1042030635 8:64471945-64471967 CAGGTGAACAGGAAGTAAGTAGG + Intergenic
1042289844 8:67158499-67158521 CAGAAGAAAAAGAAGAAAGACGG + Exonic
1042781479 8:72495690-72495712 CTAGGAAAAAAGCAGTAAGATGG - Intergenic
1043116432 8:76259745-76259767 TAGGTGAGAAAGAAATAAGAAGG + Intergenic
1043203481 8:77405316-77405338 CAGGGAAGAAAGAAGCAAAATGG + Intergenic
1043540203 8:81253894-81253916 CAAGGGAAAAATAAATAACATGG - Intergenic
1043577429 8:81674173-81674195 CAGGAGGAAGAGAAGTAAGGTGG - Intronic
1043769278 8:84177489-84177511 CAGGGGAAAAAGAAGGAATTTGG + Intergenic
1044150382 8:88769665-88769687 CATGGGAAAAAGATGTAGGCTGG - Intergenic
1044761587 8:95523106-95523128 CATGGGAAAAACATGAAAGAAGG + Intergenic
1044923138 8:97186714-97186736 CAGGGAACAGAGAAGTACGAAGG + Intergenic
1045393712 8:101739610-101739632 CAGGGGAGAAAGATGGAAGCCGG - Intronic
1045632409 8:104140842-104140864 AAGGGGAAAAAGAAACAAAATGG + Intronic
1045692199 8:104771428-104771450 CAGGTGCAAAAGAAGAAACAAGG - Intronic
1045702187 8:104879959-104879981 CTGGGGAAATAAAAGTGAGATGG - Intronic
1046115661 8:109780260-109780282 CAGAGGAAGAAGAGGTGAGAAGG - Intergenic
1046400285 8:113696567-113696589 CATGGGAGAAAGATGTAGGATGG - Intergenic
1046549151 8:115691043-115691065 CATGGGAAAAGAAAGAAAGAAGG - Intronic
1047151766 8:122272081-122272103 AAGGGAAGAAAGAAGGAAGAAGG - Intergenic
1047177644 8:122556593-122556615 AAGGGGACAAAGAAGAAGGAAGG + Intergenic
1047891267 8:129313782-129313804 CAGGGAAAAATGATCTAAGAGGG - Intergenic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048005674 8:130417614-130417636 CAGGGGAAAAAAAAAAAAAAAGG + Intronic
1048158534 8:131988909-131988931 CAGGGTAAAAAGAAATAACAGGG - Intronic
1048715424 8:137263441-137263463 CAAGTTAAAAAGAAGAAAGAGGG - Intergenic
1048731484 8:137446310-137446332 TAAAGGAACAAGAAGTAAGAGGG - Intergenic
1048803098 8:138212426-138212448 GAGGGAAAAAGGAAATAAGAGGG + Intronic
1048978102 8:139684558-139684580 CAGGGGAAAAAGAAGGCAAAAGG + Intronic
1049547750 8:143241888-143241910 AAAGAGAAAAAGAAGCAAGAAGG + Intergenic
1049566498 8:143341816-143341838 AAGAGGAAGAAGAAGGAAGAAGG - Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050134755 9:2450159-2450181 CATGGGAAAAAGATGTAGGCTGG - Intergenic
1051255907 9:15213209-15213231 CAGGAGACAAAGAAGTCTGAGGG + Intronic
1051461372 9:17320386-17320408 CATGGAAAAAAAAAGAAAGATGG - Intronic
1052087717 9:24288913-24288935 CTGGGCAAAAAGAAATAAAATGG - Intergenic
1052495745 9:29221291-29221313 CAGAGGAAGAAGAATGAAGAAGG + Intergenic
1052496672 9:29234858-29234880 CCGGGGCTAAAGAAGAAAGAAGG - Intergenic
1053030627 9:34774431-34774453 CATGGGAAAAAGACTTGAGAAGG + Intergenic
1053180311 9:35962569-35962591 AAGAGGAAAAAGAAGAAAGAGGG - Intergenic
1053464911 9:38298902-38298924 AAAGGGAAAAAGGACTAAGAAGG + Intergenic
1053554764 9:39124362-39124384 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1053818882 9:41944620-41944642 CAGGAAAAAAAGAAGAAACAAGG + Intronic
1054109150 9:61088272-61088294 CAGGAAAAAAAGAAGAAACAAGG + Intergenic
1054611707 9:67242853-67242875 CAGGAAAAAAAGAAGAAACAAGG - Intergenic
1054737526 9:68770423-68770445 CAGGGTAAAAATAAGGATGAAGG + Intronic
1055098561 9:72439818-72439840 CAGGGGAAGAAGGAATAATAAGG - Intergenic
1055177336 9:73336259-73336281 AGGGGGAAAAGGAAGGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055747076 9:79459854-79459876 CATGGGAAAAAGAACAAAGCAGG + Intergenic
1056879332 9:90375742-90375764 CAAGGGAAAAAGAAAAAAGACGG + Intergenic
1057051474 9:91927444-91927466 CAGGGGAGAAAAAAGTCCGAGGG + Intronic
1057265450 9:93614374-93614396 CAGGGGAAACAGAAGTCACTGGG - Intronic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1059178972 9:112193744-112193766 CGGGAGAAAAAGAACTAAGCAGG - Intergenic
1059548206 9:115200555-115200577 TAGGGAAAAAAGAAAAAAGAAGG - Intronic
1059575795 9:115486945-115486967 CAGAGGCAAAAGAAGTGGGATGG - Intergenic
1059929420 9:119246399-119246421 CAGGGGAAAAAGATGTAGCCTGG - Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060378833 9:123145089-123145111 CAAGGTAAATAAAAGTAAGAAGG + Intronic
1060683693 9:125588589-125588611 CAGTGGAGATAGAAGTGAGATGG - Intronic
1062196111 9:135275129-135275151 CAGAGGAAAATGAACCAAGACGG - Intergenic
1062488625 9:136793276-136793298 CAGGTGAAAAACAAATCAGAAGG + Intronic
1185708453 X:2282595-2282617 GAGGGGAGAGAGAAGAAAGAGGG + Intronic
1186240394 X:7559296-7559318 CAGAGGGAAAAAAAGAAAGAAGG - Intergenic
1186303133 X:8222495-8222517 GAGGGGGAGAAGTAGTAAGATGG - Intergenic
1186603924 X:11069005-11069027 CAGTGGAAAAAAAAAGAAGAAGG + Intergenic
1187169567 X:16838139-16838161 CAGGGGAGAAAGAATTCAGTGGG - Intronic
1187396878 X:18927013-18927035 CGGGGGAAAGAAGAGTAAGATGG + Intronic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1188115899 X:26242014-26242036 AAGGGGAGAGAGAAGTAAAAAGG - Intergenic
1188752571 X:33922566-33922588 AAGAGGAAAAAGAAAAAAGAAGG + Intergenic
1190718748 X:53129010-53129032 CTGAGGTAAAAGAAGAAAGATGG - Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191595727 X:62942156-62942178 AAGGGGAAGAAGGAGTAAGGTGG - Intergenic
1191731212 X:64337624-64337646 CAGGGCAAAAAGAAAGATGAGGG + Intronic
1192196691 X:69033508-69033530 TAGGGGAAAAAGAAGCAAAAAGG + Intergenic
1192220868 X:69196572-69196594 GAGGGGAAAAAGAAGTTATTTGG - Intergenic
1192829426 X:74735754-74735776 CAGAGTAACAAGAAGTCAGAAGG + Exonic
1192940676 X:75908635-75908657 CATGGGAGAAAGATGTAAGCTGG - Intergenic
1193080743 X:77403847-77403869 CATGGGATGATGAAGTAAGAAGG - Intergenic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193381471 X:80820898-80820920 AAGGGGAAAAAAAAGAGAGAAGG + Intergenic
1193573394 X:83172605-83172627 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1193574119 X:83178701-83178723 CAGGGGAGAAAGATGTAGGCTGG + Intergenic
1193656678 X:84206748-84206770 CAGGAGAAAATAAAGGAAGAGGG - Intergenic
1193818622 X:86133989-86134011 CAGGAGGAAAAGCAGTAAAATGG + Intergenic
1194443842 X:93963683-93963705 CATGGGAAAAAGATGTAAACTGG - Intergenic
1194604842 X:95965668-95965690 CATGGGAAAAAGATGTAGGGTGG + Intergenic
1194777907 X:97988370-97988392 AAGAGGAACAAGATGTAAGAAGG - Intergenic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1195787231 X:108540327-108540349 CAGGGGAAAAACACTTAAGAAGG + Intronic
1195950823 X:110270799-110270821 CAGGAAAAAATGAAGTGAGAAGG - Intronic
1196113579 X:111973210-111973232 CAGTGGAAATAGATGTAGGAGGG - Intronic
1196139805 X:112248630-112248652 CATTGGGAAAAGAAATAAGAAGG + Intergenic
1196351294 X:114733617-114733639 GAAAGGAAAAAGAAGCAAGAGGG + Intronic
1197889951 X:131259630-131259652 CTGGGGAACAAGGAGTGAGAGGG - Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198152135 X:133921898-133921920 GCGGGGAGAAAGAAGTAGGATGG - Intronic
1198423857 X:136496277-136496299 CAGGGGAGACAGAATTAAGATGG - Intergenic
1198508117 X:137321528-137321550 CAAGGAAAAAAGAAGAAAGTAGG - Intergenic
1198596736 X:138244104-138244126 CATGAGAAAAAGAAAAAAGAAGG + Intergenic
1198974228 X:142317817-142317839 CAGGGGAAACAGATGTCAGGGGG - Intergenic
1199058975 X:143330513-143330535 CTGGGCAAAAAGAAAAAAGAGGG - Intergenic
1199229946 X:145425036-145425058 CATGGGAGAAAGATGTAAGCTGG + Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199498207 X:148477934-148477956 CAGGGAGAAGAAAAGTAAGAAGG + Intergenic
1199552216 X:149072828-149072850 CTGGGGAAAAATTTGTAAGAGGG - Intergenic
1200947356 Y:8858396-8858418 CAATGGAAAAATAAATAAGATGG - Intergenic
1201537730 Y:15069085-15069107 CAGGGGAGAAACCAGCAAGATGG + Intergenic