ID: 1141367272

View in Genome Browser
Species Human (GRCh38)
Location 16:83455378-83455400
Sequence CTGGCCCACCTGAGGCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 2, 2: 3, 3: 39, 4: 362}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141367268_1141367272 -10 Left 1141367268 16:83455365-83455387 CCTGGTGTGATCACTGGCCCACC 0: 1
1: 0
2: 1
3: 4
4: 140
Right 1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG 0: 1
1: 2
2: 3
3: 39
4: 362
1141367263_1141367272 29 Left 1141367263 16:83455326-83455348 CCAATGACAGCTGTTTCTGAGCA 0: 1
1: 0
2: 0
3: 19
4: 201
Right 1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG 0: 1
1: 2
2: 3
3: 39
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141367272 Original CRISPR CTGGCCCACCTGAGGCTCTG GGG Intronic
900031066 1:373602-373624 CTGTCCCACATGTGGCTGTGTGG - Intergenic
900051637 1:601856-601878 CTGTCCCACATGTGGCTGTGTGG - Intergenic
900321210 1:2085096-2085118 CTGCCCTCCCTGTGGCTCTGCGG + Intronic
900601132 1:3503124-3503146 CTGACCCCGCTGAGGCCCTGAGG + Intronic
900754470 1:4424216-4424238 CTGGCTCCCTTGAGGCTCCGTGG - Intergenic
901157902 1:7152758-7152780 CATGGCCACATGAGGCTCTGGGG - Intronic
901231227 1:7642600-7642622 CTGGCCCAGCTGAGGCTCTGCGG - Intronic
901732062 1:11287141-11287163 CTGCCCATCCTGTGGCTCTGTGG - Exonic
902082758 1:13832556-13832578 CCTGGCCACCTAAGGCTCTGTGG + Intergenic
902171306 1:14613741-14613763 CTGGCCACCCAGAGTCTCTGCGG + Intronic
902573386 1:17361149-17361171 CAGCCCCACCTGGGGCTCCGGGG + Intronic
903262246 1:22137563-22137585 CTCGCCCAACTCAGGCTCTGTGG - Intronic
903328433 1:22584737-22584759 TTGGCCCACCTGAACCTCTGGGG + Intronic
903501495 1:23802436-23802458 CTTGCCCACCTGAAGCCCTGGGG - Exonic
903516421 1:23913899-23913921 CTGGCCCAGATCAGGGTCTGGGG - Intergenic
904054787 1:27662907-27662929 CTGGGCCAGCCGAGGGTCTGGGG - Intergenic
904088289 1:27926653-27926675 CTGGCTTCCCAGAGGCTCTGAGG + Intergenic
904359085 1:29960700-29960722 TTGGAGCAGCTGAGGCTCTGAGG - Intergenic
904704425 1:32379269-32379291 TTGGTCCATCTGAGTCTCTGTGG + Intronic
905262568 1:36729992-36730014 CTGGCCCTTCTGAGGCATTGGGG - Intergenic
905309652 1:37040542-37040564 CTGGCTCACCGCAGCCTCTGAGG - Intergenic
905890134 1:41513548-41513570 CTGGCCCACCACATGCACTGCGG - Exonic
906292397 1:44627800-44627822 CTGGCACACCTGACCCTTTGTGG + Intronic
911122290 1:94308753-94308775 CTTCCTCCCCTGAGGCTCTGTGG + Intergenic
912453171 1:109779930-109779952 CAGGGCCACCTGGAGCTCTGAGG - Intergenic
912565682 1:110585609-110585631 CTGGCCAAGCTGAGGCCCAGGGG + Intergenic
912690741 1:111802979-111803001 CTGGCTCACCTGACTCCCTGAGG + Intronic
914827665 1:151146934-151146956 CTGGCACAGGAGAGGCTCTGGGG + Intergenic
915276019 1:154788701-154788723 CTGGCTCACAGGAGGCTGTGGGG - Intronic
916395652 1:164384313-164384335 ATGGAGGACCTGAGGCTCTGAGG - Intergenic
918138272 1:181697238-181697260 CTGTGCCACCTGAGGCCCTTAGG - Intronic
919761165 1:201099124-201099146 CTGGCCCGCATGGGGCTTTGTGG + Intronic
920201664 1:204263305-204263327 CTGGCCCCACAGAGGCTCCGGGG - Intronic
920249953 1:204616973-204616995 CTGGCCCCCAAGAGTCTCTGTGG - Intergenic
921157832 1:212452156-212452178 CTGGGAAACCTGAGACTCTGAGG - Intergenic
921252993 1:213314571-213314593 CTAGCCTACCAAAGGCTCTGAGG + Intergenic
921834317 1:219762163-219762185 CTGGTCCACTGGAGGCACTGGGG - Intronic
922217909 1:223535593-223535615 CTGGCCTATCTGAGCCTCTGAGG - Intergenic
922573376 1:226646592-226646614 CGGGCTCACCTGGGGCCCTGCGG + Intronic
922851748 1:228738621-228738643 CTGGCGTAGATGAGGCTCTGGGG - Intronic
1062932974 10:1364438-1364460 CTGGCCCAGGTGAGGCACTGCGG + Intronic
1065948246 10:30626622-30626644 CTGGCCTAACTGTGGCTCTCTGG - Intronic
1066291395 10:34017444-34017466 CTGGGGCACCTGAGGCTTGGAGG + Intergenic
1067877415 10:50018536-50018558 CAGGCCCACCACAGCCTCTGGGG - Intergenic
1068000689 10:51330987-51331009 GTGGCACACCTGAGACTATGAGG - Intronic
1069685119 10:70312980-70313002 CTGGCCAACCTGGGGCACAGAGG - Intronic
1070132633 10:73665796-73665818 CAGGCCCACCACAGCCTCTGGGG + Intergenic
1070526339 10:77298937-77298959 GAGGCCCATCTGATGCTCTGGGG - Intronic
1070562096 10:77575819-77575841 CTGGCCTTCCAGTGGCTCTGAGG - Intronic
1070993487 10:80753987-80754009 CTGGCACACCTTTGGCTCAGAGG + Intergenic
1071475056 10:86018764-86018786 CTGCCCCACCAAAGGCTGTGTGG + Intronic
1071490233 10:86131253-86131275 CTGACTCACCTCAGGCTCAGAGG + Intronic
1072285087 10:93906430-93906452 CTGCCCCAGCTGATGCTGTGTGG + Intronic
1072631719 10:97151196-97151218 CTGGCCCACAGGAGGCCCTCAGG + Intronic
1073108780 10:101048427-101048449 CCCGCGCACCTGAGGCTCTCAGG + Intergenic
1073249365 10:102112468-102112490 CTTGCCCTCCTGAGACCCTGAGG - Intronic
1074120782 10:110493243-110493265 CTGGCCCACCTTATGGGCTGAGG + Intergenic
1074995529 10:118754595-118754617 CTGCCCCCCCGGAGGCTCTCGGG + Exonic
1075223675 10:120605923-120605945 CTTGCCCAGCTGAGGGCCTGGGG - Intergenic
1075399110 10:122148977-122148999 GTAGCCCTCCTGAGGCTTTGTGG + Intronic
1075448167 10:122528210-122528232 GTGGCCCAGCTGTGGCTATGGGG + Intergenic
1075651566 10:124130898-124130920 CTGCCCCACCTCAGGCTCTCAGG + Intergenic
1077097019 11:803379-803401 CTGAGCTGCCTGAGGCTCTGGGG - Exonic
1077289512 11:1782416-1782438 CTGGCACCCCTGGGGCACTGGGG - Intergenic
1077440621 11:2567057-2567079 GGGGCCCACGGGAGGCTCTGGGG + Intronic
1077538762 11:3136665-3136687 CAGGCCCACAGGAGGCCCTGGGG + Intronic
1077787316 11:5398510-5398532 CCATCCCACCTGAGGCTCAGAGG + Intronic
1078070530 11:8106324-8106346 CTTACCCACCTGAGGCTCCTAGG - Intronic
1079055963 11:17207363-17207385 CTGTCCCATCTCTGGCTCTGGGG - Intronic
1080416405 11:32073371-32073393 CTGCCCCAGCAGAGGCCCTGAGG - Intronic
1080723331 11:34870655-34870677 CTGGGGCAGCTGAGGCTCTCAGG - Intronic
1082784360 11:57308787-57308809 CTGGCCCACCCCAAGCTCTTTGG + Exonic
1083309021 11:61775173-61775195 CTGCCCCACTTGAGACTCAGGGG + Intronic
1083336442 11:61924471-61924493 CTGGCCCATCTCCTGCTCTGGGG + Intergenic
1084433731 11:69126063-69126085 CTGGCTCACCTGAGGCTCTCAGG + Intergenic
1085083634 11:73652579-73652601 TGGGCCTTCCTGAGGCTCTGGGG + Intronic
1085195539 11:74669643-74669665 ATGGGCCACCTGGGGCTCTAAGG - Intergenic
1086955224 11:92928585-92928607 CTGTCCCAACAAAGGCTCTGTGG - Intergenic
1087102885 11:94381873-94381895 CTGCCCCACAGGAGGCTCTGGGG - Intronic
1088390162 11:109305371-109305393 CTGTCCAACCTGATGCTCTGGGG + Intergenic
1089158627 11:116421287-116421309 CAGGCTCACCTGTGGCTCAGGGG - Intergenic
1089383977 11:118056177-118056199 CTGGCCCAAGTGAGCCTCTCAGG - Intergenic
1090434156 11:126673003-126673025 CTGGCCCTCCTCCGTCTCTGGGG + Intronic
1090831190 11:130421936-130421958 CTGGCCCCCCTGAGGAGCAGAGG + Intronic
1091129614 11:133134462-133134484 CTCACCCACCTAAGACTCTGAGG - Intronic
1094142868 12:27198939-27198961 CTGGAGCAACAGAGGCTCTGGGG - Intergenic
1094508598 12:31082421-31082443 CTCCCCCACCTGCAGCTCTGTGG - Intronic
1095929867 12:47614494-47614516 CTGCCCCAGCTGTGGCTCAGAGG - Intergenic
1096520488 12:52182032-52182054 CCAGCCCACCTGAGGAGCTGAGG + Intronic
1096621627 12:52869149-52869171 CTGGCCCACCACTGGCTTTGAGG - Intergenic
1096651677 12:53064980-53065002 CTTGCTCAGCTAAGGCTCTGGGG + Exonic
1096718791 12:53506312-53506334 CTGGGCTGGCTGAGGCTCTGTGG - Exonic
1101493087 12:105227989-105228011 CTGGCCCCTCTAAGGCTCTCTGG + Intronic
1102257486 12:111424676-111424698 CTGTTCCACCTGATGCTCCGAGG - Intronic
1103344608 12:120241044-120241066 CTGACCCTCCTGGGGATCTGTGG + Intronic
1104039728 12:125121974-125121996 GAGGCCAACCTCAGGCTCTGAGG + Intronic
1104373184 12:128242504-128242526 CTTGCTCACCTGTGACTCTGAGG + Intergenic
1106466881 13:30021337-30021359 CTTGCCCATCTGCGGTTCTGGGG + Intergenic
1109745598 13:66619636-66619658 CTAGCAAACCTGTGGCTCTGAGG + Intronic
1111915666 13:94357430-94357452 CTGGACCATCTGATGCTCCGCGG + Intronic
1112715706 13:102182325-102182347 CTGCCCCTCCAGAGGCTCTGAGG - Intronic
1113117019 13:106885055-106885077 TCTGCCCACCTGAGGCTCTCTGG + Intergenic
1113532760 13:111041338-111041360 CCGGCCCACCTGTGGCTTTTAGG - Intergenic
1113882458 13:113635335-113635357 CTGTCCCTCCTGACACTCTGTGG - Intronic
1116958178 14:50944619-50944641 CGGCCCCTCCCGAGGCTCTGGGG + Exonic
1118355937 14:65013797-65013819 CTCAGCCTCCTGAGGCTCTGGGG + Intronic
1118857129 14:69632323-69632345 CTGGCCCTCCTGTTGCTCTCAGG + Intronic
1119175046 14:72562653-72562675 CGGGCCCAGCCCAGGCTCTGTGG - Intronic
1119437826 14:74609669-74609691 CTGGGGCCCCTGGGGCTCTGTGG - Intronic
1119649138 14:76371440-76371462 CAGGCCCACCTTAGTCACTGTGG + Intronic
1121317942 14:92973405-92973427 CTGGCCACCCTGTGGCGCTGTGG + Intronic
1122081775 14:99271934-99271956 CTGACCCTTCCGAGGCTCTGGGG + Intergenic
1122231339 14:100307497-100307519 CTGGACCTCCAGAGGCGCTGGGG - Intergenic
1122537117 14:102473157-102473179 CTGCCTCTCCTGTGGCTCTGAGG + Intronic
1122695682 14:103551006-103551028 AGGGCCCTCCTGGGGCTCTGGGG + Intergenic
1122855194 14:104556695-104556717 CTGGCCCACGTGAGCCTGTCTGG - Intronic
1123099865 14:105790430-105790452 CTGCCCTACTGGAGGCTCTGTGG - Intergenic
1124132259 15:27001337-27001359 CTGGCCCACCTGGGCCTCAGAGG - Intronic
1126978783 15:54217550-54217572 CTGGCCCACCTGCTGCCCTGTGG - Intronic
1127649708 15:60995206-60995228 CTGGCTCAGCTGAGCATCTGCGG - Intronic
1128744561 15:70104264-70104286 CATGCCCACCTGAGACTTTGTGG + Intergenic
1129237307 15:74231385-74231407 CATGCCCAGCTGAGCCTCTGGGG + Intergenic
1131258665 15:90877327-90877349 CTGGCCCACCTGGGGCTCTGAGG + Intronic
1131306811 15:91252271-91252293 ATACCCCACCTTAGGCTCTGTGG - Intronic
1131735223 15:95324985-95325007 CAGGCCCACCTGAGCCACTGAGG - Intergenic
1132342133 15:101085491-101085513 CTGGCCAGGCTGGGGCTCTGGGG - Intergenic
1132390642 15:101435963-101435985 CTGGCCCACCTGTGGCCCACAGG - Intronic
1132853515 16:2035009-2035031 GTGGCCCAGCTGAGCCCCTGTGG + Intronic
1132893201 16:2214616-2214638 CTGGCGCGCCCGAGGCCCTGCGG - Exonic
1133025809 16:2988530-2988552 CTGCCCCATCTCAGCCTCTGGGG + Intergenic
1133231902 16:4370917-4370939 CTGGGCCCCCAAAGGCTCTGAGG + Intronic
1134043848 16:11087289-11087311 CGGGTCCAGGTGAGGCTCTGTGG - Intronic
1135166272 16:20141849-20141871 CTGGACCACCAGGTGCTCTGGGG - Intergenic
1136686214 16:31996296-31996318 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136786826 16:32939825-32939847 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1136882946 16:33913965-33913987 CTGGCCCCACTGAGGTTTTGGGG - Intergenic
1137822823 16:51462065-51462087 CTGTTCCATCTGAGGTTCTGGGG - Intergenic
1138164141 16:54784541-54784563 CTGGCCAAGGTCAGGCTCTGGGG - Intergenic
1139751928 16:69114188-69114210 CTGGGAAACCTGAGGCTCAGAGG - Intronic
1141142444 16:81505472-81505494 AGGTCCCAGCTGAGGCTCTGGGG - Intronic
1141367272 16:83455378-83455400 CTGGCCCACCTGAGGCTCTGGGG + Intronic
1141664337 16:85458185-85458207 CTGGACCCCCTGCAGCTCTGGGG + Intergenic
1142130502 16:88429709-88429731 CTGGCCCACCGGCAGTTCTGTGG + Exonic
1142284976 16:89167952-89167974 CTGGCCCTCCTGAGGACCTGGGG - Intergenic
1142308964 16:89301031-89301053 CTGGCCTCCCTGGGGTTCTGGGG - Intronic
1203089062 16_KI270728v1_random:1201495-1201517 CTGGCCCCACTGAGGTTTTGGGG + Intergenic
1143112085 17:4558542-4558564 CTGGGCCAGCTGAGGGACTGGGG + Exonic
1143592525 17:7894183-7894205 CAGGCCGGCCTGAGGCACTGTGG - Exonic
1143865191 17:9918200-9918222 CTGTCCCATCTGACTCTCTGGGG + Intronic
1147147175 17:38491964-38491986 CTGGCCCCACTGAGGTTTTGGGG + Intronic
1147921200 17:43918085-43918107 CTCGCCCAGCTCTGGCTCTGAGG - Intergenic
1148168656 17:45501707-45501729 CTCGCCCAGCTCTGGCTCTGAGG - Intergenic
1148219544 17:45851827-45851849 CTGGGCCACCTGGGGCCCTGGGG - Intergenic
1148280155 17:46341234-46341256 CTCGCCCAGCTCTGGCTCTGAGG + Intronic
1148302383 17:46559171-46559193 CTCGCCCAGCTCTGGCTCTGAGG + Intronic
1149026274 17:52030842-52030864 TTTCCCCACCTGAGGCTCTCAGG + Intronic
1149033965 17:52114420-52114442 CTGGGCAAACTGAGGCTCAGTGG - Intronic
1149431245 17:56596626-56596648 CTGGCCCACGTGGAGCTGTGAGG - Intergenic
1150399850 17:64848157-64848179 CTCGCCCAGCTCTGGCTCTGAGG - Intergenic
1151030071 17:70727290-70727312 CTGGCTCTCCTGAGACACTGTGG - Intergenic
1152065080 17:78107985-78108007 CTGTGCCACCTGAGATTCTGGGG - Exonic
1152112860 17:78366639-78366661 CTGACTCTCCTGGGGCTCTGGGG + Intergenic
1152378477 17:79930387-79930409 CCGGCCCACCTGAGGCCTTGGGG - Intergenic
1152655466 17:81517390-81517412 GTGGCCCATCAGGGGCTCTGAGG + Intronic
1152746773 17:82043972-82043994 CTGGGGCACCAAAGGCTCTGGGG - Intergenic
1152925934 17:83087772-83087794 CAGGCTCACCTCAGGCTCGGCGG - Intronic
1152948574 17:83212067-83212089 CTGTCCCACATGTGGCTGTGTGG + Intergenic
1156067738 18:33165243-33165265 TTTGCCCACCTCAGACTCTGGGG - Intronic
1157263882 18:46199994-46200016 CTGTCTCACCTGCGGCCCTGTGG + Intronic
1157501150 18:48191577-48191599 CTGCCCCATGTGAGGCACTGAGG - Intronic
1157958051 18:52121115-52121137 CTGGACCACATGTGGCCCTGTGG + Intergenic
1158791436 18:60784725-60784747 GTGACCCAACTGAGACTCTGTGG - Intergenic
1160220316 18:76972262-76972284 CTGGCCCACGAAAAGCTCTGTGG - Intergenic
1160524417 18:79526553-79526575 CTGGCTCGCCCAAGGCTCTGCGG - Intronic
1160686344 19:438669-438691 CTGGCCCCTCTGGGGGTCTGGGG + Intronic
1160827156 19:1085932-1085954 CTGCCCCCCATGAGGCTCCGTGG + Exonic
1160986592 19:1841822-1841844 CTCTCCCATCTCAGGCTCTGGGG + Intronic
1161047799 19:2145575-2145597 CTGGCCCAGCCGTGGCACTGTGG - Intronic
1161417393 19:4155057-4155079 TTGGCCCGCCTGGAGCTCTGTGG - Intronic
1161568204 19:5015196-5015218 TTGGCACACCTGGGGCTCGGTGG - Intronic
1161864709 19:6825418-6825440 CTGGCCAGACTGAAGCTCTGGGG + Intronic
1162808013 19:13148987-13149009 CCTGCCCACCTGAGCCCCTGGGG - Intronic
1162971258 19:14182709-14182731 CCGGCCCAGCTGGGGCTATGGGG + Intronic
1164513813 19:28917711-28917733 CTTCCCCAGCTGAGGTTCTGTGG - Intergenic
1164563228 19:29308396-29308418 CTGGGCCATCTCTGGCTCTGGGG + Intergenic
1164739482 19:30565796-30565818 CTGGCCAAGCTGAGGCTCAGAGG - Intronic
1165115265 19:33524576-33524598 CTGGTCTACCAGAGGCTCTGTGG + Intergenic
1165128290 19:33616509-33616531 CCTGCCCACCTCAGGCTGTGGGG + Intergenic
1165348203 19:35262103-35262125 CTGGCCTGACTGTGGCTCTGAGG + Intronic
1166252083 19:41578093-41578115 CTTGCCCAGATGGGGCTCTGGGG - Intronic
1166255613 19:41602069-41602091 CTTGCCCAGATGAGGCTCTGGGG - Intronic
1166266230 19:41686311-41686333 CTTGCCCAGATGAGGCCCTGGGG + Intronic
1166321550 19:42022144-42022166 CCGGCCCATCTGAGGTCCTGGGG + Intronic
1166415574 19:42592970-42592992 CTTGCCCAGATGAGGCTCTGGGG + Intronic
1166432305 19:42738159-42738181 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166435424 19:42763348-42763370 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166445290 19:42853380-42853402 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166448283 19:42877344-42877366 CTGGCCCAGATGAGGCTCTGAGG + Intronic
1166452688 19:42915556-42915578 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166455173 19:42934837-42934859 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166464965 19:43024123-43024145 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166471093 19:43080312-43080334 ATTGCCCAGATGAGGCTCTGAGG + Intronic
1166482246 19:43184215-43184237 TTTGCCCAGATGAGGCTCTGAGG + Intronic
1166484728 19:43203320-43203342 CTTGCCCAGATGAGGCTCTGAGG + Intronic
1166491849 19:43267216-43267238 CTTGCCCAGATGAGACTCTGAGG + Intronic
1167412848 19:49355303-49355325 CTGGACCACCTGAGGACCAGTGG + Exonic
1167421250 19:49404632-49404654 CTGGCTCACATGAGAGTCTGAGG + Intronic
1168244355 19:55103689-55103711 CTGGGCCTCCTGAGTCTCAGAGG - Intronic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
925580643 2:5406732-5406754 CTGGCGCAGCTTAAGCTCTGAGG + Intergenic
926230975 2:11003572-11003594 CTGGTCCCTCTGAAGCTCTGGGG - Intergenic
926235984 2:11044355-11044377 CAGGCCCACCTCAGACACTGGGG - Intergenic
926311114 2:11676982-11677004 CCGGCTCTCCTGATGCTCTGCGG + Intergenic
926805037 2:16700465-16700487 CTGGCACAACTGATGATCTGGGG + Intergenic
927152598 2:20204392-20204414 CTGGCCAAGCTCAGGCTATGAGG + Intronic
927331276 2:21866696-21866718 TTGGCCCACCTGTGGGACTGGGG + Intergenic
927480674 2:23451559-23451581 TGGCCCCACTTGAGGCTCTGAGG + Intronic
927856345 2:26530125-26530147 TTGGTCCCCCTGAGGGTCTGTGG + Intronic
927882245 2:26697068-26697090 CTGAGGAACCTGAGGCTCTGAGG + Intronic
928984424 2:37166935-37166957 CATGCCTACTTGAGGCTCTGTGG + Intergenic
929291142 2:40193341-40193363 CTGGCCCACATTAGGCATTGGGG + Intronic
929573803 2:43039820-43039842 CTGGCCCACCTGAGTCCCCTGGG - Intergenic
930273392 2:49282793-49282815 CTGGCTCAGCTGAGGCCCTTTGG - Intergenic
931265609 2:60657398-60657420 CTTGCCCGCCAGAGGTTCTGTGG - Intergenic
932215406 2:69962972-69962994 ATGGCACACCTGTGGCTCTGGGG + Intergenic
932732523 2:74231363-74231385 CTGGCCCTCCTGCCCCTCTGTGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
936075240 2:109397619-109397641 CTGACCTAACTGAGGCCCTGAGG + Intronic
937628403 2:124069388-124069410 CTGGCCCTGCTTAGGGTCTGGGG + Intronic
937888408 2:126916121-126916143 CAGACCCACATGACGCTCTGAGG + Intergenic
937924001 2:127153959-127153981 CTATCCCAGCAGAGGCTCTGAGG + Intergenic
938073897 2:128322132-128322154 CAGCCCCACGGGAGGCTCTGAGG - Intergenic
938083788 2:128385101-128385123 CTGGCCCACCCGAGCTTCAGAGG + Intergenic
938920539 2:135990535-135990557 CTGGCCCACCTGCTGCTTTTTGG + Intergenic
940517140 2:154697428-154697450 CAGGCTCAACTGAGGCTCGGAGG + Intergenic
941844794 2:170122003-170122025 ATGGCCCTCCTCAGGCTGTGAGG - Intergenic
942382138 2:175403145-175403167 CTGGGGCAACTGAGGCTGTGAGG - Intergenic
944410827 2:199440587-199440609 CTGGTCCACCTGTGGACCTGTGG - Intronic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
944772263 2:202926135-202926157 CTGGCCGACCAGAGCCTGTGGGG + Intronic
944999288 2:205331409-205331431 CTAGCCCAGATGAGGCTGTGAGG - Intronic
946291082 2:218746011-218746033 CTGTCCTACATGAGGCCCTGGGG - Intronic
946385694 2:219383155-219383177 CATGCGCACGTGAGGCTCTGTGG + Exonic
946434948 2:219645119-219645141 CAGGCCCACTTCAGGCCCTGAGG + Intergenic
948779389 2:240308531-240308553 CTGGTCCTCCTGGGGCTCTGAGG + Intergenic
1168836298 20:879942-879964 CAGGCTCACCTGTTGCTCTGTGG - Intronic
1170957903 20:20998149-20998171 CTGGCCTCCCTGGGGCTCTGTGG - Intergenic
1172143766 20:32742732-32742754 CAGGCCCCACTGGGGCTCTGTGG - Intronic
1172853928 20:37986664-37986686 CAGGTCCTTCTGAGGCTCTGAGG + Intronic
1174210791 20:48876272-48876294 CCTGCCCACCTGAGGCTGGGTGG - Intergenic
1175480961 20:59310537-59310559 TTGGCCCTCCTAAGACTCTGAGG - Intronic
1175540195 20:59743448-59743470 CTGGCCTCCCTGAAGCCCTGGGG + Intronic
1175768966 20:61611058-61611080 CTGGGCCCCCTCAGGCTCTTCGG + Intronic
1175874341 20:62222283-62222305 CTGTCCCTCCTGAGGCTCTGGGG - Intergenic
1175935249 20:62511009-62511031 CTGCCCCAACTCAGGCCCTGGGG - Intergenic
1176045936 20:63092574-63092596 CTGCCCCACGTGGGGCTTTGAGG + Intergenic
1176131168 20:63497450-63497472 CTGCCCCACCAGACCCTCTGAGG + Intronic
1176991329 21:15500248-15500270 CTGGCTCACATGAGTCTCTCAGG - Intergenic
1179412482 21:41172877-41172899 CTGTCCCTCCGGAGGCTCTGGGG + Intronic
1179888514 21:44324709-44324731 CTGGCCGGCCTGAGTGTCTGGGG - Intronic
1179891119 21:44335541-44335563 GAGGCCCAGGTGAGGCTCTGAGG + Intronic
1179962738 21:44779396-44779418 CTGGTCATGCTGAGGCTCTGGGG - Intronic
1181168198 22:20994361-20994383 ATGGGCCCCCTGAGGCTCAGAGG + Intronic
1181627992 22:24134296-24134318 CGGGCCCACTGGAGGTTCTGGGG - Exonic
1181968562 22:26673175-26673197 CTGGCCGGCCTGAGCATCTGCGG - Intergenic
1183469892 22:37999594-37999616 GTGGCCAGCCTGAGGCCCTGGGG - Intronic
1183585612 22:38751313-38751335 CGGGCCCAGCTGTGGCGCTGGGG + Exonic
1183694787 22:39415583-39415605 CTGGCCCAGCAGGAGCTCTGCGG - Exonic
1184405920 22:44300788-44300810 CTGGCCCATCTGGGGTTCTGGGG - Intronic
1184751857 22:46490900-46490922 CTGGACCTCCTGATCCTCTGAGG - Intronic
1185097954 22:48821921-48821943 CTGGCCCCACGGAGGCACTGGGG + Intronic
1185177060 22:49333916-49333938 CAGAGCCACGTGAGGCTCTGGGG - Intergenic
1185301775 22:50084634-50084656 CTGTCCCACCTGGGGCTCCAGGG + Intronic
1185309810 22:50148030-50148052 GTGGGACACCTGAGGCTCAGAGG + Intronic
1185418590 22:50722698-50722720 ATGCCCAACCTGAGTCTCTGAGG - Intergenic
950004346 3:9682026-9682048 CTAGCCCACCTGACGCTCACTGG + Intronic
950138958 3:10601995-10602017 CTGGACAACCTGAGGCCCAGTGG + Intronic
950499087 3:13352713-13352735 CTGGCACACCTGTGGCCCTGAGG - Intronic
950522635 3:13505786-13505808 CTGGCCCACCTGGGGCCCCTGGG - Exonic
950689490 3:14644195-14644217 CTGGCCCACCTGCAGCGATGCGG - Intergenic
952901351 3:38113974-38113996 CTGGCAAGCCTGAGGCTCTTCGG - Intronic
952965804 3:38620605-38620627 CTGGCTCACCTGGGGCTCCACGG - Intronic
953413457 3:42702608-42702630 ACTGCCCACCTCAGGCTCTGGGG + Exonic
953913873 3:46905952-46905974 ATGGCCCAGGTGGGGCTCTGAGG - Intergenic
954426319 3:50445068-50445090 CAGGCCTGCGTGAGGCTCTGTGG + Intronic
954864591 3:53718156-53718178 TTAGCCCAGCTGAGGCCCTGAGG + Intronic
956637433 3:71380252-71380274 CTGGCCAACCTGATGTTCTTGGG - Intronic
956644750 3:71444723-71444745 CTGGCCTACCCAAGGCTCAGAGG + Intronic
956883933 3:73539531-73539553 CTTGCCCTTCTGATGCTCTGAGG + Intronic
958700968 3:97589056-97589078 CTGGGCCACATGAGGCTCCCAGG - Intronic
959121627 3:102240061-102240083 GTGCCCCACCTGAGACTCTGGGG + Intronic
961488307 3:127233045-127233067 CTGGATCTCCTGAGGCTCTCAGG + Intergenic
961711920 3:128834392-128834414 CTGGTCCATCTGAGGACCTGAGG + Intergenic
961915400 3:130368953-130368975 CACTCCCACCTGAGGATCTGAGG - Intronic
962311695 3:134331434-134331456 CTGGCCCAGCTGCCCCTCTGTGG - Intergenic
963378669 3:144502625-144502647 TTGGCAGGCCTGAGGCTCTGAGG - Intergenic
963945010 3:151136053-151136075 CTGTGCCACCTGAGGTTTTGTGG + Intronic
967892708 3:194374318-194374340 TTCGGCCACCTGAGTCTCTGTGG + Intergenic
968153268 3:196356574-196356596 CTTGCCCAACTTTGGCTCTGTGG + Exonic
968438818 4:611155-611177 CTGGCCCACCTGGGTCCATGTGG - Intergenic
969538956 4:7773962-7773984 CTGGACCACCCAGGGCTCTGAGG + Intronic
969586501 4:8097198-8097220 CTGGACTACCAGAGGCTCTACGG - Exonic
975724515 4:77278952-77278974 CGGGCCCACGTGGAGCTCTGAGG + Intronic
976113834 4:81705701-81705723 CTCTCCCTCCAGAGGCTCTGGGG + Intronic
980017885 4:127674393-127674415 CTGGCCCAGCTGAGGCTTCATGG - Intronic
983519782 4:168696107-168696129 CTGGGCCACATGTGGCTCAGAGG + Intronic
984548385 4:181133097-181133119 TTGGCCCAACTCAGGCTCTCAGG + Intergenic
985935648 5:3095796-3095818 CTGCCACGCCTGAGCCTCTGGGG - Intergenic
987114485 5:14715102-14715124 CTGGCCTACCTGGGGCTCCATGG + Intronic
990496584 5:56354138-56354160 CTTGCCCACCTGGGGAACTGTGG - Intergenic
992112036 5:73504079-73504101 CTGGGCCACCATAGGCCCTGAGG - Intronic
992468542 5:77030816-77030838 CTGGGCCAGCTCAGGCTCGGGGG - Exonic
996653310 5:125909158-125909180 CTGGCCCACATGAGGCCCAGAGG + Intergenic
997606237 5:135177462-135177484 CTCTCTCACCTGAGGCTCTCAGG - Intronic
998690458 5:144581730-144581752 CTGGCCGACCTGTGGCTTTTTGG + Intergenic
1002164735 5:177337291-177337313 CCTGCCCTCCTGAGCCTCTGTGG + Intronic
1002293145 5:178213192-178213214 CTGGCCCATGGAAGGCTCTGAGG - Intronic
1002359924 5:178662349-178662371 CTGGTCCACGTGATGCTCTATGG + Intergenic
1002431609 5:179207429-179207451 CTGGCCCAGCTGGGCCTCTCTGG + Intronic
1002463194 5:179387153-179387175 ATGGCTCACCTGAGGCCATGGGG - Intergenic
1002742754 5:181445266-181445288 CTGTCCCACATGTGGCTGTGTGG + Intergenic
1003188757 6:3854813-3854835 CTGGCACACCTGGGAGTCTGAGG - Intergenic
1004477692 6:15989057-15989079 CTCATGCACCTGAGGCTCTGTGG - Intergenic
1005801208 6:29427130-29427152 GTGGCCCAGCTGAGGTTCTGTGG - Exonic
1006450898 6:34105252-34105274 GAGGCCCCCCTGGGGCTCTGGGG + Intronic
1007603120 6:43096222-43096244 CTCTCCAACCTGAGGCTCAGGGG - Intronic
1009180556 6:60512659-60512681 CTGGCCCTCATGTTGCTCTGTGG - Intergenic
1010123334 6:72405184-72405206 CTGGCTCACCTCTGGCTGTGTGG - Intergenic
1011935398 6:92770401-92770423 CAGGGCTACCTGAGGCACTGGGG + Intergenic
1012234278 6:96795119-96795141 CTGGGCCTCCAGAGGGTCTGTGG - Exonic
1013461288 6:110377573-110377595 CTCAGCCACCTGAGCCTCTGAGG - Intergenic
1014252538 6:119129258-119129280 CAGGACCTCCTGAGGATCTGTGG + Intronic
1017726338 6:157278515-157278537 CTGGCCCTCCTGAGGCCCAGAGG - Intergenic
1019128678 6:169858519-169858541 CTCTCCCTCCTGAAGCTCTGCGG - Intergenic
1019247887 6:170721005-170721027 CTGTCCCACATGTGGCTGTGTGG + Intergenic
1019427174 7:983236-983258 CTGGGCCTCCTGGGGCTCTGGGG + Exonic
1019478834 7:1256840-1256862 CTGGCCCACCCGGTGCCCTGGGG - Intergenic
1019604081 7:1899782-1899804 CTGGCCCATCAGAGCCTCTTCGG - Intronic
1019614792 7:1954343-1954365 GTGGCCCACCCCAGGCTGTGGGG + Intronic
1019663483 7:2239366-2239388 CTGGCTCCCCTGAGGCTGAGTGG - Intronic
1020085837 7:5309710-5309732 CTCTCCCACCTCAGCCTCTGAGG + Intronic
1020117190 7:5482352-5482374 GTGGCCCACCTGCGGCTGTGGGG - Intronic
1020255919 7:6503213-6503235 CTGCCCCACCGCAGGCTTTGGGG + Intronic
1022030533 7:26488088-26488110 CTGGCCCAACTGAGGCAAGGGGG - Intergenic
1022565223 7:31392693-31392715 CTAGCCCCCTTGAGGCTGTGTGG + Intergenic
1023330336 7:39108501-39108523 GTGGCCCAGGGGAGGCTCTGGGG + Intronic
1023935574 7:44737570-44737592 CTGGCCCACAGGAAGTTCTGGGG + Intergenic
1024242942 7:47449333-47449355 CTGGCTCACCCAGGGCTCTGAGG - Intronic
1025208466 7:57007440-57007462 CTCTCCCACCTCAGCCTCTGAGG - Intergenic
1025663484 7:63569438-63569460 CTCTCCCACCTCAGCCTCTGAGG + Intergenic
1029298584 7:99560642-99560664 CTGCACAAACTGAGGCTCTGGGG - Exonic
1029437974 7:100573288-100573310 CTGTCCTACCTGGGGCTCCGGGG + Exonic
1030748972 7:113205756-113205778 CTGCCCCAGCTGATGCTATGTGG + Intergenic
1031560516 7:123232409-123232431 CTGGCCCACCAGAGTGGCTGGGG + Intergenic
1031980455 7:128121267-128121289 AAGAGCCACCTGAGGCTCTGAGG - Intergenic
1034052283 7:147996018-147996040 CAGGCCCTTCTGAGGCTGTGAGG + Intronic
1034345637 7:150383823-150383845 CTGCCCGACCTGGGGCGCTGAGG + Intronic
1035254631 7:157618496-157618518 CTGGCTTCCCTGTGGCTCTGTGG - Exonic
1035500228 8:86859-86881 CTGTCCCACATGTGGCTGTGTGG - Intergenic
1035888999 8:3324076-3324098 CTCCCCCACCTGGGTCTCTGGGG - Intronic
1036744059 8:11391485-11391507 CTGGCCCATGGGAGGCGCTGGGG + Intronic
1037810836 8:22086125-22086147 CTGGCCCTCCTCAGGGCCTGAGG + Intergenic
1039457560 8:37717607-37717629 CTGGCCCAGCAGGGGCTCTCTGG + Intergenic
1039979174 8:42392007-42392029 CGGGCCTAACGGAGGCTCTGTGG + Intronic
1042796182 8:72665596-72665618 CAGGCCCACCTTAGGTTCTGAGG - Intronic
1045510301 8:102807883-102807905 CTGGAAGACCTGAGGCTCAGAGG + Intergenic
1047220097 8:122911925-122911947 ATGGCTCCCCTAAGGCTCTGAGG + Intronic
1047592052 8:126336815-126336837 CTGGCTAACCAGAGGCCCTGAGG + Intergenic
1048030243 8:130624764-130624786 CTAGCCCACATGAGTCTCTCTGG - Intergenic
1049310133 8:141929481-141929503 CAACCCCATCTGAGGCTCTGAGG - Intergenic
1050388003 9:5111066-5111088 CTGGCCCAGCTCAGGCTCCTGGG + Intronic
1051017642 9:12499856-12499878 TTAGGCAACCTGAGGCTCTGGGG + Intergenic
1052153419 9:25150114-25150136 CTGGCCCCACTGAGCTTCTGAGG + Intergenic
1052742914 9:32411011-32411033 CTTGCCCCCTTGAGTCTCTGTGG - Intronic
1052844663 9:33324509-33324531 CTTGCCCACCTGAAGCGCAGTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053137487 9:35660551-35660573 CTGGGCCAGCTGTTGCTCTGGGG - Exonic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055603015 9:77939253-77939275 TTGGCCCAGTGGAGGCTCTGAGG - Intronic
1056365810 9:85903489-85903511 CTGGTTCATCTGAGGCTCAGAGG + Intergenic
1057228275 9:93303941-93303963 CTGACCCACCTGAGGGTGCGCGG + Intronic
1060915977 9:127390914-127390936 CTGGCAGGCCTGAGGGTCTGGGG - Intronic
1061866108 9:133492519-133492541 CTGGGCCACCTGCAGCCCTGGGG - Intergenic
1062285756 9:135771835-135771857 CTGGCCCGGCTGTGGGTCTGTGG - Intronic
1062435164 9:136543774-136543796 GTGGGCCACCTCAGGCTCCGGGG - Intronic
1062451785 9:136618822-136618844 CTGGCCCAGCTGCGGCTGTTGGG - Intergenic
1062568985 9:137175829-137175851 CTGGCCCTCCTTAGGCCATGCGG - Exonic
1062656524 9:137606639-137606661 CTGCACCGCCTGAGGCTGTGGGG + Intronic
1203770742 EBV:48830-48852 CTGCTCCAACTGCGGCTCTGCGG + Intergenic
1203608657 Un_KI270748v1:76484-76506 CTGTCCCACATGTGGCTGTGTGG + Intergenic
1188999906 X:36933028-36933050 CGGGCCCAAGTGAGGTTCTGGGG + Intergenic
1189223047 X:39389103-39389125 CTGCCCCAACTGATGCTTTGTGG + Intergenic
1189363617 X:40371536-40371558 CAGGCTCACCTGAGGCACAGTGG - Intergenic
1191230080 X:58086871-58086893 CTGGCCTACCTGAGGCATTCTGG + Intergenic
1191670050 X:63740659-63740681 GTAACCCAACTGAGGCTCTGAGG + Intronic
1195687572 X:107600591-107600613 CTGGCCCCCCTGGCGCTCGGAGG + Exonic
1198801174 X:140449149-140449171 TTTGCCCACCTGAGCCTCAGAGG + Intergenic
1199400184 X:147389821-147389843 CTGCCCCACCTGATGCCCTATGG + Intergenic
1199868419 X:151874939-151874961 CTGGCCCAGAGTAGGCTCTGTGG + Intergenic
1200059062 X:153476024-153476046 CCGGCCCCCCTCAGGCTGTGGGG - Intronic
1200706492 Y:6447287-6447309 CAGGATCCCCTGAGGCTCTGTGG + Intergenic
1201027620 Y:9717421-9717443 CAGGATCCCCTGAGGCTCTGTGG - Intergenic