ID: 1141379948

View in Genome Browser
Species Human (GRCh38)
Location 16:83567159-83567181
Sequence GGCTTAGCTGCCACTCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 128}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141379942_1141379948 -6 Left 1141379942 16:83567142-83567164 CCTTGACTCCCCAGCCAGGCTTA 0: 1
1: 1
2: 5
3: 16
4: 237
Right 1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1141379939_1141379948 10 Left 1141379939 16:83567126-83567148 CCTTCTTCCAGGAGATCCTTGAC 0: 1
1: 0
2: 1
3: 14
4: 210
Right 1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1141379937_1141379948 14 Left 1141379937 16:83567122-83567144 CCTCCCTTCTTCCAGGAGATCCT 0: 1
1: 0
2: 4
3: 32
4: 284
Right 1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1141379938_1141379948 11 Left 1141379938 16:83567125-83567147 CCCTTCTTCCAGGAGATCCTTGA 0: 1
1: 0
2: 3
3: 25
4: 251
Right 1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128
1141379940_1141379948 3 Left 1141379940 16:83567133-83567155 CCAGGAGATCCTTGACTCCCCAG 0: 1
1: 0
2: 2
3: 12
4: 182
Right 1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG 0: 1
1: 0
2: 1
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141379948 Original CRISPR GGCTTAGCTGCCACTCTTCT GGG Intronic
900510416 1:3056918-3056940 GGTCTGGCTGCCAGTCTTCTTGG - Intergenic
901782339 1:11602322-11602344 GGCTGAGCTGCCCCTCTTCCAGG - Intergenic
902245079 1:15115345-15115367 GGCTTAGCAGCCACATTTCTAGG + Exonic
902743017 1:18453327-18453349 GGCTTAGGAGCCACTGCTCTTGG + Intergenic
903802725 1:25981686-25981708 GTCTTAGCTTCCACTAATCTGGG - Intronic
905811315 1:40915446-40915468 GCCTTGGCTTCTACTCTTCTTGG + Intergenic
905969152 1:42127944-42127966 GGCTCAGCTTCCAGTCATCTCGG - Intergenic
907462045 1:54610871-54610893 GGCTTAACTGCGGCTCTTCTGGG + Intronic
910044734 1:82898752-82898774 GGGTTAGATCCAACTCTTCTTGG + Intergenic
911047095 1:93637638-93637660 GGGGTAACTTCCACTCTTCTGGG + Intronic
915055280 1:153123302-153123324 GTCTTAGCTCACACTCTTCTTGG - Intergenic
916306296 1:163337679-163337701 GGGTTAGATGTCACTCTTGTTGG + Intronic
919141295 1:193574997-193575019 GACTTTGCTGCCACCCTACTTGG - Intergenic
921199606 1:212792294-212792316 GGCTGAGATGCCACTCTTTGTGG + Intronic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1063377798 10:5564410-5564432 GGCTTAACGGCCACACTTCCTGG + Intergenic
1063486457 10:6425007-6425029 GGCTTACCTGTCCCCCTTCTAGG - Intergenic
1065895661 10:30161194-30161216 GCCGTAGCTGCAAATCTTCTGGG + Intergenic
1068534686 10:58229113-58229135 AGCTTAGCTGCCAGCATTCTTGG - Intronic
1070713058 10:78697359-78697381 GGCTTAGCTGTGAATATTCTGGG + Intergenic
1070960966 10:80499962-80499984 GCCCTGGCTGCCAATCTTCTGGG - Intronic
1071504975 10:86226766-86226788 GGCCTGGCTGCCTCTCTGCTGGG - Intronic
1071963761 10:90832319-90832341 GCCTTAGCTGCCTCTCCTCGGGG - Intronic
1072715452 10:97749510-97749532 GTATTTGCTGCCACTCTGCTGGG + Exonic
1079031670 11:16990831-16990853 AGCTTAGCTGCAACTCTACAGGG + Intronic
1079689124 11:23400361-23400383 GCCTTAGCTGCCTCCCTTGTGGG + Intergenic
1081041023 11:38212714-38212736 GACTTAGATCCAACTCTTCTGGG - Intergenic
1083198478 11:61105049-61105071 GGCATTGCTGCCTCTCTCCTTGG - Intronic
1083223975 11:61273244-61273266 GGCCCAGCCGCCACTCTTCTCGG + Exonic
1086825418 11:91489831-91489853 GTCTGAGCTCACACTCTTCTTGG + Intergenic
1088505528 11:110523146-110523168 GGCCTGGCTGACACTTTTCTTGG + Intergenic
1089620477 11:119719370-119719392 GGCTGAGCTGCCTCTCTTCCTGG - Intronic
1089940374 11:122410412-122410434 AGCTTAGCTGCCCGTCTGCTAGG + Intergenic
1090108920 11:123883900-123883922 GCCTGACCTCCCACTCTTCTTGG + Intronic
1091689902 12:2588759-2588781 GAATTAGCTTCCACTCATCTGGG - Intronic
1092602547 12:10082512-10082534 GTCTGAGCTCCCACTCTCCTTGG - Intronic
1093078394 12:14781112-14781134 CGCTGAGCAACCACTCTTCTGGG - Intergenic
1093193116 12:16097867-16097889 GGCTTAACTGCTGCTATTCTTGG + Intergenic
1096916412 12:55038127-55038149 GGCTCAGAAGCCACACTTCTGGG - Intergenic
1103262832 12:119603337-119603359 ATCTTATCTGCCACTCATCTGGG - Intronic
1107736100 13:43399968-43399990 GGCTCCACTGCCACTCTTGTAGG + Intronic
1110470673 13:75856192-75856214 GCCTTACCTGCCATTCCTCTGGG + Intronic
1111952168 13:94717401-94717423 GGCTTATCTACCACCCTGCTGGG - Intergenic
1115498805 14:34031506-34031528 AGCCTAGCAGCCCCTCTTCTGGG + Intronic
1118509013 14:66449759-66449781 CAATTAGCTGCCACCCTTCTTGG + Intergenic
1119623829 14:76153097-76153119 GGCTTATCTGCCACACCTGTAGG - Intronic
1124172226 15:27386364-27386386 TGCTAAGCTGTCACTCATCTTGG - Intronic
1125534771 15:40436669-40436691 GGCTAAGATGCGACTCTGCTGGG + Intergenic
1130008676 15:80129117-80129139 GGCTTATCTGATACTGTTCTAGG + Intronic
1131066848 15:89439990-89440012 GACTTAGCTGCCCCTCTGCGAGG + Intergenic
1133235469 16:4385478-4385500 GTCTTGGGTGCCACGCTTCTGGG - Intronic
1137369483 16:47891652-47891674 GGCTTAGCTGCCTTTTCTCTGGG + Intergenic
1137442530 16:48508908-48508930 GCCTTAGCTGCCTCTCCTCGGGG + Intergenic
1137553833 16:49457806-49457828 GGGTTAGAGGCCACTCTCCTTGG - Intergenic
1141379948 16:83567159-83567181 GGCTTAGCTGCCACTCTTCTGGG + Intronic
1143845205 17:9768543-9768565 GGCCTAGATGCCACTCCTCCTGG + Intergenic
1144072629 17:11688481-11688503 GGCTTTGCAGCCAGTCTTCATGG + Intronic
1147859176 17:43507126-43507148 GACATAGCTGCCACTCTTCTGGG - Exonic
1148023384 17:44568392-44568414 GCCTTAGCTGCCTCCCTGCTGGG + Intergenic
1154071928 18:11160396-11160418 TGCTTAACTTCCACACTTCTGGG - Intergenic
1155062359 18:22240116-22240138 GGCTTGGCTGCCATTCTTACAGG - Intergenic
1155991447 18:32283108-32283130 GGCTCAGCTGCAACAGTTCTAGG + Intronic
1158414809 18:57240768-57240790 GGCTGATGTGACACTCTTCTTGG - Intergenic
1158585390 18:58728843-58728865 GGCTTAGCTTCCATTCATCCAGG - Intronic
1159094346 18:63885588-63885610 AGCCTAGCTGCCAGTCTTGTAGG - Intronic
1163131267 19:15274747-15274769 GGCTTTGCTGCAAGTCTTTTTGG - Intronic
1163889331 19:19997082-19997104 AGCAGAGCTGCCACTATTCTGGG - Intronic
1164577311 19:29413131-29413153 GGCTGAGCTGCCACTCTCTTTGG + Intergenic
1164784947 19:30922877-30922899 GGCTGAGCTGCTGCTCTTCAGGG - Intergenic
1164943310 19:32268566-32268588 GTCTTAGGTACCACCCTTCTTGG - Intergenic
1167459435 19:49616515-49616537 GGCTCAGTTGCAACTCTGCTGGG - Intronic
926277397 2:11414845-11414867 AGATAAGCTGCCAGTCTTCTTGG - Intergenic
927121259 2:19965541-19965563 TGCTTGGCTGCCAGTGTTCTGGG + Intronic
929226114 2:39513289-39513311 GGATGAGCTGCCACTCTGCTGGG + Intergenic
933700077 2:85248758-85248780 GGCTGAGCTGCCTCTGTTATTGG - Intronic
936725741 2:115312923-115312945 GGCCTGACTGCCACTCTTATTGG - Intronic
939325387 2:140681553-140681575 GACTAAGCTGACACTGTTCTTGG + Intronic
940368849 2:152878008-152878030 TGCTTAGATGCCACTTTTTTGGG + Intergenic
940709783 2:157147873-157147895 GACTTAGGTGCCTCTCCTCTGGG + Intergenic
941059185 2:160826719-160826741 GGCTTTGCTGCTACTCTTCCTGG - Intergenic
942691157 2:178586743-178586765 GGCTAAGGTGGCACTGTTCTTGG + Exonic
944504666 2:200398194-200398216 AGCCTAGCTGCCACTCCTCTTGG - Intronic
946232644 2:218302048-218302070 GCCTTGGGTGCCACTCTTTTAGG - Intronic
946957850 2:224951699-224951721 GGCTCAGCTGACTCTCTGCTTGG + Intronic
947995685 2:234525272-234525294 GCCTTTGCTGACAATCTTCTGGG + Intergenic
948020618 2:234730335-234730357 GGCTTGGCTGGCTCTCTGCTGGG - Intergenic
1172609152 20:36236557-36236579 GGCTGGGCCGCCCCTCTTCTCGG + Exonic
1175573047 20:60038605-60038627 GGCTTGTCTGCCCCTCCTCTAGG + Intergenic
1177182370 21:17757729-17757751 GTCTTAGCTGCCACCCTGCCGGG - Intergenic
1179576755 21:42312855-42312877 GGCTTAGCTGCCCCACATCGTGG - Intronic
1184159848 22:42691754-42691776 GGCTGAGCTGCCACCCATCCAGG - Intergenic
1185375813 22:50482177-50482199 GGCACAGCAGCCCCTCTTCTGGG + Intronic
949151037 3:767241-767263 GGCTGGGCTCTCACTCTTCTTGG - Intergenic
952996370 3:38886873-38886895 GGCTCAGCTGCCAAGCTGCTTGG - Intronic
953377763 3:42443148-42443170 GGCATTGCTGGCACTCTTCTGGG - Intergenic
953704324 3:45219889-45219911 GGCTCTGCTGCGCCTCTTCTGGG - Intergenic
954329939 3:49884492-49884514 GGCTGGGCTGCCTCTCCTCTAGG - Intergenic
955251482 3:57287361-57287383 GGCCTGGCTGCCAGCCTTCTAGG + Intronic
963895962 3:150685143-150685165 GGCTTTGCGGCCACTCTTACAGG + Intronic
964301442 3:155290080-155290102 GACTTAGCTATCCCTCTTCTAGG - Intergenic
965796311 3:172443040-172443062 TGCTTAGCCTCCTCTCTTCTGGG - Intergenic
969762440 4:9198873-9198895 GACTTAGCTGGCAGACTTCTAGG - Intergenic
970709257 4:18842858-18842880 GGAAGAGCTGCCACTCTTCTGGG - Intergenic
971567179 4:28160164-28160186 GGCTTAACTGTTACTCTTTTTGG - Intergenic
975605601 4:76150885-76150907 GGCCTGGCTGCCAATGTTCTGGG - Intergenic
975671780 4:76787466-76787488 TGCTGAGATGCCCCTCTTCTTGG + Intergenic
977453417 4:97226929-97226951 TGCATAGCTTCCACACTTCTTGG + Intronic
979770492 4:124518979-124519001 GGATTAGATGCTTCTCTTCTGGG + Intergenic
981127292 4:141121243-141121265 GGATGAGCTTCCACTGTTCTAGG - Intronic
982288138 4:153756013-153756035 GTCTTGGGAGCCACTCTTCTGGG - Intronic
988158487 5:27487070-27487092 AGCTTGGCTGCCAATCCTCTTGG + Intergenic
989525997 5:42454499-42454521 GTCTGAGCTGAGACTCTTCTTGG + Intronic
991420603 5:66437449-66437471 TGCTCACCTGCCACTCATCTCGG - Intergenic
995109960 5:108418107-108418129 GGATGAGCTGCGACCCTTCTGGG + Intergenic
1000035541 5:157444857-157444879 GGCTCATCTTCCCCTCTTCTGGG - Intronic
1001198209 5:169692629-169692651 GGCTTACCTGGGAATCTTCTAGG + Intronic
1002890457 6:1327172-1327194 GGCTTTGCTGCCCCACTGCTGGG - Intergenic
1007917320 6:45573466-45573488 GACTTAGCTGCCATTCTCATCGG + Intronic
1012482215 6:99679910-99679932 GGCTAAGCTGGCACTATTGTGGG - Intergenic
1012954305 6:105552545-105552567 GCCTTAGATGTCACTCCTCTGGG + Intergenic
1016938327 6:149464937-149464959 GGGTTGGCTGCCAGGCTTCTCGG - Intronic
1020402224 7:7792256-7792278 GGCTTAGCTGTTCCTGTTCTTGG + Intronic
1021460232 7:20878779-20878801 GGCTTAACTGCCTCTTTTTTTGG + Intergenic
1021767877 7:23967668-23967690 TCCTTTGCTGCCACTCTTCAAGG - Intergenic
1022965335 7:35466748-35466770 AGCATAGTTGCCACTCTGCTTGG - Intergenic
1024749708 7:52451194-52451216 TGCTTAGCTGGCCTTCTTCTGGG + Intergenic
1025922399 7:65925875-65925897 CGCTTGGCTGCCAGTGTTCTTGG - Intronic
1028391946 7:90326731-90326753 AGCTTTGCTGCCTCTCTGCTAGG - Intergenic
1028842087 7:95439746-95439768 GGCTTTGCTGCCTCTCTTCCAGG + Intergenic
1030980682 7:116182131-116182153 GCCTTAGCTGCCTCTCTGCAGGG - Intergenic
1032265739 7:130368728-130368750 GGCTTCGCTGCCTCTCGTGTTGG + Exonic
1034581736 7:152049876-152049898 CCCTTAGCTGCCACTGTCCTAGG + Intronic
1036285645 8:7442407-7442429 GGCTGATCTGTCACTCTTCCGGG + Intergenic
1036335828 8:7869122-7869144 GGCTGATCTGTCACTCTTCCGGG - Intergenic
1036754349 8:11462468-11462490 TGCTTGGCTGTCACTCTCCTTGG + Intronic
1037645680 8:20790688-20790710 GGCAGAGCTTCCACTCTCCTAGG - Intergenic
1043876988 8:85496683-85496705 GGCTTAGCTATCACTTTCCTGGG + Intergenic
1058667848 9:107336881-107336903 TGCTGAGCTGCCACTCGGCTTGG + Intergenic
1187510224 X:19910903-19910925 GAGTTAGCTGCCCCTCCTCTGGG - Intergenic
1190685688 X:52870641-52870663 GGCAGAGCTGCCACCCTACTAGG + Intergenic
1194510129 X:94783465-94783487 GTCTGAGTTGACACTCTTCTTGG - Intergenic
1195460257 X:105115894-105115916 GCCTTAGCTGCCTCTCTGCGGGG - Intronic
1198887216 X:141352660-141352682 GGCTTGCCAGGCACTCTTCTGGG - Intergenic