ID: 1141380188

View in Genome Browser
Species Human (GRCh38)
Location 16:83569260-83569282
Sequence GTTCCAATGGGGAGAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141380188_1141380198 6 Left 1141380188 16:83569260-83569282 CCCCTCCCTCTCCCCATTGGAAC 0: 1
1: 0
2: 2
3: 36
4: 429
Right 1141380198 16:83569289-83569311 CACACTGCACTCCACCATGTTGG 0: 1
1: 0
2: 2
3: 42
4: 677
1141380188_1141380201 24 Left 1141380188 16:83569260-83569282 CCCCTCCCTCTCCCCATTGGAAC 0: 1
1: 0
2: 2
3: 36
4: 429
Right 1141380201 16:83569307-83569329 GTTGGCATGTACAGTACATGTGG 0: 1
1: 0
2: 1
3: 6
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141380188 Original CRISPR GTTCCAATGGGGAGAGGGAG GGG (reversed) Intronic
900300640 1:1975187-1975209 GTTGCAGTGGGGAGAGAGACTGG - Intronic
900502553 1:3013585-3013607 GATTCAATGGGGAGTGAGAGGGG - Intergenic
900829691 1:4956980-4957002 TTCCCAATGTGGAGAGGGATGGG - Intergenic
900860188 1:5223375-5223397 GTTCAGATGGGGAGAGTGACTGG + Intergenic
900925025 1:5699589-5699611 TTTCCCAGGGAGAGAGGGAGAGG - Intergenic
901932304 1:12603303-12603325 GGTCCATCGAGGAGAGGGAGCGG + Intronic
903176865 1:21586634-21586656 GTTCCAGTGGCAGGAGGGAGAGG - Intergenic
904377328 1:30090103-30090125 GGTCCAGTGAGGAGATGGAGGGG + Intergenic
904610784 1:31725202-31725224 GAACCATGGGGGAGAGGGAGAGG - Intergenic
904812012 1:33169530-33169552 GGCACAATGGGGAGAGTGAGAGG - Intronic
905680696 1:39869092-39869114 GAGACCATGGGGAGAGGGAGGGG - Intronic
905859100 1:41335232-41335254 GTTAACATGAGGAGAGGGAGCGG - Intergenic
906060319 1:42944162-42944184 TTTCCAATGGGCAAAGGGATGGG + Intronic
906353207 1:45081266-45081288 GAGACCATGGGGAGAGGGAGAGG - Intronic
908312347 1:62897283-62897305 GTTACCAGGGGGAGGGGGAGGGG + Intergenic
908372882 1:63501440-63501462 GTTTCCAGGGGGAGGGGGAGAGG + Intronic
909641313 1:77871086-77871108 GTGGGAAGGGGGAGAGGGAGAGG + Intronic
913016855 1:114745953-114745975 GTTCCTTTGGGGAGAGGGGGTGG + Intronic
913021316 1:114791471-114791493 GAGACCATGGGGAGAGGGAGAGG + Intergenic
913450992 1:118992573-118992595 GGTGAGATGGGGAGAGGGAGTGG + Intergenic
914230810 1:145763903-145763925 GAGACCATGGGGAGAGGGAGAGG - Intronic
914374447 1:147061295-147061317 GTACAAAGAGGGAGAGGGAGAGG - Intergenic
914392012 1:147232488-147232510 GAGACCATGGGGAGAGGGAGAGG - Intronic
918966836 1:191361988-191362010 GCTCATATGGGGAGAGGGAAGGG - Intergenic
919087188 1:192934224-192934246 GTTCCACTGAAGAGATGGAGTGG - Intergenic
920234620 1:204494547-204494569 GCTCCAAGGGGCAGAGGGAGAGG + Intronic
920451341 1:206063381-206063403 GAGACCATGGGGAGAGGGAGAGG - Intronic
921060523 1:211580163-211580185 GTTGCTATGGGGAGGTGGAGGGG + Intergenic
921542015 1:216427985-216428007 GAGGCAATGGGGAGAGGGAAGGG + Intergenic
922029480 1:221784070-221784092 GTTTGAAGGGGGAGAGGCAGAGG + Intergenic
922982406 1:229838753-229838775 TTTCCAGAGGGGCGAGGGAGAGG - Intergenic
923384477 1:233453004-233453026 GGTCTTATGGGGAGATGGAGAGG - Intergenic
1063455538 10:6179827-6179849 GCTCCAAAGTGGGGAGGGAGTGG + Intronic
1066140680 10:32501032-32501054 CATGCAAAGGGGAGAGGGAGAGG + Intronic
1066563259 10:36692573-36692595 GCCGCAATGGGGAGATGGAGAGG - Intergenic
1067030453 10:42875947-42875969 CTTCCACTGTGGAGAGGAAGGGG + Intergenic
1067415838 10:46101719-46101741 GATTAAATGGGGAGAGGGAAGGG + Intergenic
1067435907 10:46276997-46277019 GATTAAATGGGGAGAGGGAAGGG + Intergenic
1069631183 10:69897873-69897895 GCTTCAATGGGTAGAGGGACTGG + Intronic
1070325726 10:75387746-75387768 TGTCCAATGGGGTGAGGGTGAGG + Intergenic
1070754891 10:78985790-78985812 GTTCCAAAGGGGAGAGGGGCTGG + Intergenic
1070932608 10:80272001-80272023 CTTCCCATGGAGGGAGGGAGTGG - Exonic
1071489809 10:86128544-86128566 AATGCACTGGGGAGAGGGAGAGG + Intronic
1071969980 10:90894478-90894500 GTCCCAATGGCGTGAGAGAGGGG - Intronic
1072639981 10:97204670-97204692 GTTCCACTGGAGAGAGGGAAAGG + Intronic
1073061885 10:100738186-100738208 GCCCGAATGGGGAGAGGGAGAGG - Intronic
1073382397 10:103089571-103089593 GTTCTACTCGGGGGAGGGAGGGG - Exonic
1074159561 10:110826395-110826417 GTTGCACTGTGGGGAGGGAGGGG - Intronic
1074712695 10:116190557-116190579 GTCCCAAAGAGGAGATGGAGTGG - Intronic
1075058465 10:119237755-119237777 GTTCCCATGGGGAGTGGGGAAGG - Intronic
1075061831 10:119261905-119261927 GAGACCATGGGGAGAGGGAGAGG + Intronic
1076392121 10:130110856-130110878 GAGCCAATAAGGAGAGGGAGGGG + Intergenic
1077839498 11:5960247-5960269 CGTGCAAAGGGGAGAGGGAGAGG - Intergenic
1078141193 11:8694183-8694205 GCTACAAGGAGGAGAGGGAGTGG - Intronic
1078641107 11:13097534-13097556 GTTCCAGTTTGGAAAGGGAGAGG + Intergenic
1078849360 11:15149836-15149858 GTTGCAAGTGGGAGAGAGAGAGG - Intronic
1081492691 11:43580059-43580081 GTACTAATGGGGGGGGGGAGGGG + Intronic
1081526503 11:43931439-43931461 GGTTCAGTGGGCAGAGGGAGAGG - Intronic
1081704994 11:45177494-45177516 CTTCCACTGGGGAGAGAGAGAGG - Intronic
1081844740 11:46231833-46231855 GTTGCAGTGGGGAGAGAGGGAGG + Intergenic
1083857742 11:65401399-65401421 GACCCAAGTGGGAGAGGGAGGGG - Intronic
1083987876 11:66228733-66228755 GTTACCCAGGGGAGAGGGAGGGG + Intronic
1084369989 11:68734970-68734992 TTTCCCATGGGGAGTGGGATGGG - Intronic
1084624631 11:70296705-70296727 GAGACCATGGGGAGAGGGAGAGG + Intronic
1084745885 11:71168802-71168824 GAGACCATGGGGAGAGGGAGAGG + Intronic
1085097628 11:73774381-73774403 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1085097638 11:73774410-73774432 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1085672512 11:78481234-78481256 AATCCAATGGGGAGGGTGAGAGG + Intronic
1086366950 11:86116711-86116733 CTTCCAATTGGGAGAGGCAGAGG + Intergenic
1089257272 11:117200525-117200547 GAGCCAGTGGGGAGGGGGAGAGG - Intronic
1089419337 11:118319457-118319479 GTAATACTGGGGAGAGGGAGAGG - Intergenic
1089616158 11:119696026-119696048 GTGCCAAAGGGGTGAGGAAGAGG + Intronic
1090008197 11:123021297-123021319 GTTACAATGGGAAGATTGAGCGG - Intergenic
1090423919 11:126594073-126594095 GTGCCAATGGACAGAGGGAAGGG - Intronic
1090620963 11:128560841-128560863 GTACCAATGTGTAGGGGGAGGGG + Intronic
1090907070 11:131085146-131085168 GTGTGAAGGGGGAGAGGGAGAGG + Intergenic
1090951055 11:131473685-131473707 GCTCCATGGTGGAGAGGGAGGGG + Intronic
1092023372 12:5221187-5221209 GTTCCAAGAGGCAGAGGCAGAGG - Intergenic
1092401606 12:8183399-8183421 GAGACCATGGGGAGAGGGAGAGG - Intronic
1093765839 12:22961493-22961515 ATTGGAATGGGGAGAGAGAGTGG + Intergenic
1095304920 12:40627584-40627606 GTTCCCATGTGGACAGAGAGTGG + Intergenic
1095970525 12:47898915-47898937 ATGCAAATGGGGAGAGGCAGAGG + Intronic
1096044501 12:48551222-48551244 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1096093196 12:48916623-48916645 GAGACCATGGGGAGAGGGAGAGG + Intronic
1097709630 12:62903719-62903741 GTTGCCATGGGGTGGGGGAGTGG + Intronic
1097735636 12:63178186-63178208 GATGCCATGTGGAGAGGGAGAGG + Intergenic
1098774047 12:74588920-74588942 GTGCAAAGAGGGAGAGGGAGAGG + Intergenic
1099018254 12:77371445-77371467 TTACCAGTGGGAAGAGGGAGAGG + Intergenic
1099177879 12:79442702-79442724 GTTCTACTGGGGATAGGGAGAGG + Intronic
1099328159 12:81245998-81246020 GTGCCTCTGGGGAGAGGAAGGGG + Intronic
1100952519 12:99867276-99867298 GTTGCAATGGGGAGGGGATGGGG - Intronic
1101789673 12:107915154-107915176 GAACCAAGAGGGAGAGGGAGAGG + Intergenic
1102157520 12:110742860-110742882 GTTCCAGTGGGGAGAGAAGGAGG - Exonic
1102166269 12:110809239-110809261 CATCCAATGTGGGGAGGGAGGGG + Intergenic
1102191683 12:110993476-110993498 CTTGCACTGGGGTGAGGGAGGGG - Intergenic
1102198512 12:111041665-111041687 GGTCCAATGGAGAAGGGGAGTGG + Intronic
1102323119 12:111956501-111956523 CATGCAAAGGGGAGAGGGAGAGG - Intronic
1102707570 12:114895541-114895563 GCTCCAATGGAGAGATGGGGGGG + Intergenic
1103152831 12:118656209-118656231 GTTTCAGTGGGGAGATGGGGAGG + Intergenic
1103234685 12:119361159-119361181 GAGACCATGGGGAGAGGGAGAGG + Intronic
1103467822 12:121156062-121156084 GTTCCCCTGTGGAGAAGGAGAGG - Exonic
1104935788 12:132363753-132363775 ATTCCAACAGGGAGAGGGAACGG - Intergenic
1105248336 13:18673309-18673331 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1106223979 13:27771405-27771427 GTGCCGTTGGGGAGTGGGAGAGG - Intergenic
1107042686 13:35966513-35966535 GTGCAAAGAGGGAGAGGGAGAGG - Intronic
1107143541 13:37032224-37032246 GAAGGAATGGGGAGAGGGAGGGG + Intronic
1107151566 13:37117461-37117483 GTTGAAATGGGGTGGGGGAGGGG + Intergenic
1107869136 13:44730963-44730985 AATCCAATGTGGAGAGGAAGAGG - Intergenic
1108685720 13:52817482-52817504 CGTGCAAAGGGGAGAGGGAGGGG - Intergenic
1110201215 13:72852153-72852175 GTTGCAATGTGGCGAGTGAGGGG - Intronic
1110208391 13:72945042-72945064 CTAGCAATGGGGAGAGGGAGAGG - Intronic
1112063558 13:95767184-95767206 GTTCCCAGGGGCCGAGGGAGAGG - Intronic
1113167462 13:107458403-107458425 GTGCCAATGCGCAGAGGCAGGGG + Intronic
1113995121 14:16058076-16058098 GGTCCACCGGGGAGAGGGTGGGG + Intergenic
1114336528 14:21697299-21697321 CGTGCAAAGGGGAGAGGGAGAGG - Intergenic
1117059860 14:51951069-51951091 GTTTCCATGAGGACAGGGAGGGG - Intronic
1117665310 14:58050407-58050429 GGTCGAATGGGTAGAGAGAGAGG - Intronic
1118113156 14:62745676-62745698 CTTCAAAAGGGGAGAGGAAGTGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1118819225 14:69334246-69334268 GTTCCAGTAGGGAGCTGGAGGGG + Intronic
1119179100 14:72592676-72592698 TTTCCAAGAGGGAGAGAGAGAGG + Intergenic
1119633715 14:76256928-76256950 GTTCCCATTGGGAGATGGGGAGG - Intergenic
1119718314 14:76874307-76874329 GTTCCACTCCTGAGAGGGAGAGG + Intergenic
1120170707 14:81245236-81245258 GTGCCGAGAGGGAGAGGGAGGGG + Intergenic
1120505960 14:85353493-85353515 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1121109128 14:91300532-91300554 GCTCCTAAGGGGAGAGGGAGAGG - Intronic
1122432201 14:101659871-101659893 GTTCCAAAGAGAAGAGAGAGAGG - Intergenic
1122612057 14:102991650-102991672 GTACACATGTGGAGAGGGAGGGG + Intronic
1123780865 15:23626998-23627020 GTACACATGGGAAGAGGGAGAGG + Intronic
1124148141 15:27150271-27150293 TTTCCTCTGGGGAGTGGGAGTGG + Intronic
1124364970 15:29064735-29064757 GTTCCACTGGGGGCATGGAGGGG + Intronic
1124902481 15:33837243-33837265 AAAGCAATGGGGAGAGGGAGAGG - Intronic
1125359190 15:38847996-38848018 GTGCCAGTGGGGTGAGGGAAGGG + Intergenic
1125459847 15:39895249-39895271 GAGACCATGGGGAGAGGGAGAGG + Intronic
1125700688 15:41680708-41680730 GTTTCCATGGGGAGAGGGCATGG - Intronic
1125727480 15:41875436-41875458 GGTCCACTGGGAAGAGGGACAGG - Exonic
1127609733 15:60625123-60625145 GCTCCAATGGAGAGAGGGCAAGG + Intronic
1128304276 15:66587904-66587926 GTTTGAATGGGCAGAGGAAGAGG - Intronic
1128597660 15:68965557-68965579 GAGACCATGGGGAGAGGGAGAGG + Intronic
1129246833 15:74284259-74284281 ATTGAAATGGGGAGAAGGAGGGG + Intronic
1129761604 15:78131847-78131869 GTCCCTCTGGGGAGAAGGAGGGG + Intronic
1130871867 15:87978178-87978200 GATCCACTGAGGAGAGGGAAGGG - Intronic
1131741148 15:95393630-95393652 GTGCAAATGGGGAGTGGGAATGG - Intergenic
1132854393 16:2038418-2038440 GTCCCAAGGGGGAGGGGAAGGGG - Exonic
1134390600 16:13816556-13816578 GTTCCAATGGCCAAAGGCAGTGG + Intergenic
1135288140 16:21211623-21211645 CCCCCAATGGGGAGAGGGTGTGG - Exonic
1135630313 16:24031392-24031414 GAACCAGTGGGGAGAGGGAAAGG + Intronic
1135975800 16:27108397-27108419 GTGCCAGTGGGCAGAGGGTGCGG + Intergenic
1136415037 16:30097682-30097704 CCTCCAATGGGAAAAGGGAGAGG + Intergenic
1136593387 16:31231594-31231616 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1137483988 16:48876482-48876504 GTTACACTGGGGCCAGGGAGTGG + Intergenic
1139378217 16:66514129-66514151 CGTGCAAAGGGGAGAGGGAGAGG - Intronic
1139480148 16:67226275-67226297 TTTCCCATGGGCAGAGAGAGGGG + Intronic
1139712481 16:68786895-68786917 GTTCCAAAGGTCAGAGGCAGAGG + Intronic
1139775956 16:69317126-69317148 GTTCCCATCCGCAGAGGGAGAGG + Intronic
1140063890 16:71593669-71593691 GTACCAATAGAGAGAGAGAGAGG - Intergenic
1140725707 16:77809670-77809692 GCTGCTATGGGTAGAGGGAGGGG + Intronic
1140869842 16:79096361-79096383 GAGCCAATGGGGGAAGGGAGAGG - Intronic
1141253839 16:82382749-82382771 GTAACAATGGGGAGGGTGAGGGG + Intergenic
1141380188 16:83569260-83569282 GTTCCAATGGGGAGAGGGAGGGG - Intronic
1141600569 16:85123820-85123842 ATTCCACTGGGGAGAGGAGGGGG - Intergenic
1141840555 16:86571584-86571606 GTTTCAGTGGGGACAGGGATAGG + Intergenic
1142103193 16:88286428-88286450 GTTCAGATGGGGAGAGGATGGGG - Intergenic
1142256035 16:89014373-89014395 TTTCCAAAGAGGAGAGGAAGAGG + Intergenic
1142287004 16:89175556-89175578 GGACCAAAGGGGAGGGGGAGAGG + Intronic
1142332154 16:89462069-89462091 GAGACCATGGGGAGAGGGAGAGG - Intronic
1142681412 17:1551228-1551250 GTCACCATGGGGAGAGGTAGTGG + Intronic
1142890642 17:2940455-2940477 GTTGCCATGGCGAGAGGGGGAGG + Intronic
1142963373 17:3565030-3565052 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1143115417 17:4579049-4579071 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1143262443 17:5609780-5609802 ATTCCACTGGGTGGAGGGAGAGG - Intronic
1143357841 17:6343872-6343894 GCTGAAATGGAGAGAGGGAGAGG - Intergenic
1143455268 17:7063649-7063671 GTTCCACTGGGGAAAGAGACAGG + Intergenic
1144425597 17:15138407-15138429 GATCCAATGTGGACAGGGGGTGG - Intergenic
1144754790 17:17672737-17672759 GTTCCAGTGGGCAGAGGGACTGG - Intergenic
1145895963 17:28458168-28458190 GAGACCATGGGGAGAGGGAGCGG - Intronic
1147241158 17:39091327-39091349 ACTCCCATGGGGAGAGGCAGTGG + Intronic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1148528548 17:48366434-48366456 GTAGCAAAGGGGAGAGGAAGGGG + Intronic
1149414950 17:56449386-56449408 GTTCATATGGAGAGAGGGAGAGG - Intronic
1149613524 17:57977083-57977105 GTTAGAATGGGGAGAGGGGACGG - Intronic
1149793448 17:59499451-59499473 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1149936233 17:60810140-60810162 TGTCCAGTGGGGAGAGTGAGAGG - Intronic
1150214562 17:63459501-63459523 GTCCCAATGGGCAGGGGCAGAGG + Intergenic
1150363017 17:64554410-64554432 GTGGCTATGGGGGGAGGGAGTGG + Intronic
1150363023 17:64554429-64554451 GTGGCTATGGGGAGAGGGAGTGG + Intronic
1150469064 17:65420678-65420700 GTTTGCATGGGGAGAGGGAGGGG + Intergenic
1150475413 17:65471051-65471073 GCTCCACTGGGGAGAAGCAGAGG + Intergenic
1150937147 17:69648910-69648932 GTGCCACTGGGAAGAGGAAGTGG + Intergenic
1151769917 17:76153876-76153898 CTTCCACTGGGGGGAGGGGGAGG - Intronic
1151833365 17:76568841-76568863 ATTGCAAGGGGGAGATGGAGGGG + Intronic
1152234104 17:79129658-79129680 GCCCCAATGGGGAGAGGTAGTGG + Intronic
1153927780 18:9849657-9849679 GTTACTATGGGGCGAGGGAGTGG + Intronic
1154290118 18:13099161-13099183 GAGACCATGGGGAGAGGGAGGGG + Intronic
1155222956 18:23702000-23702022 GATGCAGTGGGGAGAGAGAGAGG + Intronic
1156595561 18:38544026-38544048 GATGCACTGAGGAGAGGGAGAGG + Intergenic
1156866794 18:41897630-41897652 GTCAGAATTGGGAGAGGGAGTGG + Intergenic
1157437910 18:47686725-47686747 GTTCCAGTGGGTGGAGAGAGGGG - Intergenic
1157914860 18:51654952-51654974 GTCACAATGGGGAGGCGGAGTGG - Intergenic
1157997212 18:52572612-52572634 GTGCTAAGGGGGAGAGGGAGTGG + Intronic
1160960437 19:1718482-1718504 GGTGCAGTGGGGAGGGGGAGGGG + Intergenic
1161442121 19:4297957-4297979 GAGCCAGCGGGGAGAGGGAGGGG - Intronic
1163751390 19:19080349-19080371 GATCCAATGGGTAGGGGGTGGGG - Intronic
1163865376 19:19769481-19769503 CGTGCAAAGGGGAGAGGGAGGGG - Intergenic
1163982703 19:20916017-20916039 GTTCCACTGAGGTGAGTGAGTGG - Intergenic
1164469294 19:28515808-28515830 GTTCCACTGGAAACAGGGAGAGG - Intergenic
1164591195 19:29508048-29508070 GCTCCAATGGGGAGAGAAGGTGG + Intergenic
1165852346 19:38856689-38856711 GAAACCATGGGGAGAGGGAGAGG + Intergenic
1166418206 19:42611277-42611299 GAGACCATGGGGAGAGGGAGAGG + Intronic
1166606999 19:44152213-44152235 ATTCCAGTGGGGAGAGAGAGGGG - Intronic
1166611528 19:44203334-44203356 CGTGCAAAGGGGAGAGGGAGAGG - Intergenic
1167499967 19:49840490-49840512 GATCCAGTGGGGGGAGGGCGGGG + Intergenic
1167636654 19:50659558-50659580 CTTCCAAGGGGGGGTGGGAGGGG - Intronic
1167743323 19:51337567-51337589 GTGCCAGAGGGGAGAGGGAAGGG + Intronic
1167897681 19:52594324-52594346 GAGACCATGGGGAGAGGGAGAGG + Intronic
1167980435 19:53270693-53270715 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1168152941 19:54458728-54458750 GGAACAGTGGGGAGAGGGAGAGG - Intronic
925902444 2:8518158-8518180 ATTCCAGTGGGGTGCGGGAGTGG + Intergenic
926086915 2:10026260-10026282 GTTCCCACTGGGAAAGGGAGTGG - Intergenic
926378675 2:12262110-12262132 GAAGCAAGGGGGAGAGGGAGAGG + Intergenic
927141161 2:20131794-20131816 TTTCCAGTGGGGAAGGGGAGGGG - Intergenic
927240135 2:20914010-20914032 GTTCCTATGGAGAGAGAGAATGG - Intergenic
927755467 2:25705065-25705087 GAGACCATGGGGAGAGGGAGAGG - Intergenic
927833512 2:26371876-26371898 GAGACCATGGGGAGAGGGAGAGG + Intronic
927882676 2:26699696-26699718 TGTCCAAGGTGGAGAGGGAGTGG - Intronic
928178792 2:29053196-29053218 GTTCCACTGGGGAAGGGCAGGGG - Exonic
928181982 2:29074434-29074456 GTCCAAATGTGAAGAGGGAGTGG + Intergenic
928722324 2:34133900-34133922 GAGACCATGGGGAGAGGGAGAGG + Intergenic
929238504 2:39629213-39629235 GAGACCATGGGGAGAGGGAGAGG + Intergenic
929252943 2:39779328-39779350 ATGCCAAAGGGGAGAGGGAGAGG + Intergenic
929448064 2:42015613-42015635 GAGACCATGGGGAGAGGGAGAGG + Intergenic
929677339 2:43950365-43950387 AATCCAATGGGAGGAGGGAGAGG - Intronic
930752285 2:54945301-54945323 AATCCAAAGGGGAGGGGGAGGGG - Intronic
930966612 2:57336179-57336201 GATCCAATGGTGAGAGAGAAAGG + Intergenic
931479728 2:62629564-62629586 GAGACCATGGGGAGAGGGAGAGG - Intergenic
932924362 2:75954934-75954956 GATCCAATTGGGTTAGGGAGGGG - Intergenic
933351151 2:81153532-81153554 GTACCAAGGTAGAGAGGGAGTGG + Intergenic
935553058 2:104478807-104478829 GTGGCTATGGGAAGAGGGAGAGG - Intergenic
937305698 2:120869167-120869189 GCCCCAGTGGGGACAGGGAGGGG + Intronic
937371777 2:121303297-121303319 GTCCCCCTGGGGAGAGAGAGAGG + Intergenic
938093473 2:128447758-128447780 GTTACAATGGGGGCAGGAAGGGG + Intergenic
938536354 2:132252679-132252701 GGTCCACCGGGGAGAGGGTGGGG - Intronic
940454882 2:153884422-153884444 GTTCCTCTGGGGAGAGGAACTGG + Intronic
941822528 2:169856818-169856840 CGTGCAAAGGGGAGAGGGAGGGG + Intronic
942113052 2:172700989-172701011 CGTGCAAAGGGGAGAGGGAGAGG + Intergenic
942355481 2:175107555-175107577 GAGACCATGGGGAGAGGGAGAGG - Intronic
943297361 2:186154999-186155021 GAGACCATGGGGAGAGGGAGAGG + Intergenic
943323271 2:186472240-186472262 GAGACCATGGGGAGAGGGAGAGG - Intergenic
945090964 2:206175209-206175231 GTTGCAATGGGAAGTGGAAGAGG - Intergenic
945127022 2:206523854-206523876 CTTCTAATGGAAAGAGGGAGCGG + Intronic
947402167 2:229742143-229742165 GAGACAATGGGGAGAGGGAGAGG - Intergenic
948847157 2:240688537-240688559 CTTCCAATGGGGTGAGGCTGAGG + Intergenic
1169441937 20:5640007-5640029 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1169718110 20:8643784-8643806 GAGACCATGGGGAGAGGGAGAGG - Intronic
1170073936 20:12398504-12398526 TTTTGAATGGAGAGAGGGAGAGG + Intergenic
1170763484 20:19272081-19272103 GTTCTGATGGAGAAAGGGAGAGG - Intronic
1172554892 20:35832259-35832281 GTGCAAAAGGGGAGAGGGAGAGG - Intronic
1172767004 20:37356303-37356325 GTGCCAATGGGTAGAGGGCCTGG + Intronic
1172902728 20:38346697-38346719 GGTACAGTGGGGACAGGGAGTGG + Intronic
1173135966 20:40439335-40439357 GTTCCCCTGGGCAGTGGGAGTGG + Intergenic
1173656579 20:44703995-44704017 TTTTCAATGGGAAGAGTGAGAGG - Intergenic
1174349467 20:49956717-49956739 TGTCCAGTGGGGAGAGCGAGAGG - Intergenic
1175921410 20:62452053-62452075 GTGAGAGTGGGGAGAGGGAGAGG + Intergenic
1175994498 20:62806004-62806026 GGTCCAAAGGGGAAGGGGAGGGG - Intronic
1176229420 20:64024398-64024420 TTTACAATGGGGAGAGTGTGGGG - Intronic
1177475808 21:21620476-21620498 GTTCCAGAGAGGAGGGGGAGAGG + Intergenic
1178034212 21:28563182-28563204 GGGACCATGGGGAGAGGGAGAGG - Intergenic
1178832304 21:36066316-36066338 ATTCCAAAAGGGGGAGGGAGGGG - Intronic
1179568088 21:42261541-42261563 GTTTCAGTGGAGAGAGGGGGTGG - Intronic
1179800768 21:43810642-43810664 GTTACAAGGGGGAGAGGCTGCGG - Intergenic
1179941423 21:44640953-44640975 GTCCCAATCTGGAGAGGAAGAGG + Intronic
1180311971 22:11249333-11249355 GGTCCACCGGGGAGAGGGTGGGG - Intergenic
1180320227 22:11313190-11313212 GTTCCCAGGGGGAGGGGCAGCGG + Intergenic
1180559037 22:16601319-16601341 GAACCCATGGGGAGGGGGAGGGG + Intergenic
1181598715 22:23936413-23936435 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1182050814 22:27311317-27311339 GTCCTAATGGGGACAGGGAGAGG - Intergenic
1182343811 22:29644944-29644966 GAGACCATGGGGAGAGGGAGAGG + Intronic
1182457326 22:30460275-30460297 GTTCCCATGGGGAAGGGAAGAGG - Intronic
1182564183 22:31184923-31184945 CGTGCAAAGGGGAGAGGGAGGGG + Intronic
1183031324 22:35108532-35108554 ACTCCAATAGGGAGAGAGAGAGG + Intergenic
1184469117 22:44685589-44685611 CTTTCACTGGGGAGAGGGTGTGG - Intronic
949510054 3:4759613-4759635 GTTTCAATGGCAAGAGGGAGGGG + Intronic
950044422 3:9940674-9940696 GAGACCATGGGGAGAGGGAGAGG + Intronic
950044431 3:9940697-9940719 GAGGCCATGGGGAGAGGGAGAGG + Intronic
951038558 3:17962589-17962611 ACTCCAATGGGGAGAAGGGGAGG + Intronic
953718353 3:45334624-45334646 ATTGCAAGTGGGAGAGGGAGAGG - Intergenic
954455040 3:50593167-50593189 GCTCCCATCGGGAGTGGGAGTGG - Intergenic
955960074 3:64331508-64331530 GTTACATTTGGGTGAGGGAGTGG + Intronic
956313552 3:67908897-67908919 CTTCCCATGGAGAGAGGGATGGG - Intergenic
956916177 3:73873832-73873854 GTCCCTAAGGGGAGTGGGAGAGG + Intergenic
957343966 3:78938775-78938797 GTACAAAGGGGGAGAGAGAGTGG - Exonic
957561578 3:81828701-81828723 ATTTTTATGGGGAGAGGGAGAGG + Intergenic
959169790 3:102830713-102830735 GTTACACTATGGAGAGGGAGTGG - Intergenic
960770934 3:121191525-121191547 TGTGCAAAGGGGAGAGGGAGAGG + Intronic
960866249 3:122202449-122202471 GAGACCATGGGGAGAGGGAGAGG + Intronic
963458052 3:145572526-145572548 ATTCTAATGGGGGGAGAGAGAGG + Intergenic
965060300 3:163776094-163776116 GTTCAAATGTGCAGAGGCAGAGG + Intergenic
965494571 3:169382206-169382228 TTTCCAGCGGGGAAAGGGAGAGG + Intronic
965864267 3:173185005-173185027 TTTCCAGTGAGAAGAGGGAGTGG - Intergenic
966623631 3:181993062-181993084 GTGGCAAGGGGGAGGGGGAGGGG + Intergenic
966650174 3:182291802-182291824 GTTCCAGTGGGAAGAGAAAGTGG - Intergenic
966838874 3:184072056-184072078 GTTACCATGGGCTGAGGGAGGGG + Intergenic
968156393 3:196385012-196385034 CGTGCAAAGGGGAGAGGGAGAGG - Intronic
969403985 4:6977076-6977098 GAGACAGTGGGGAGAGGGAGAGG - Intronic
969706361 4:8794304-8794326 GGTCCAATCAGCAGAGGGAGGGG + Intergenic
970033975 4:11710928-11710950 GTAGCACTGGGCAGAGGGAGTGG - Intergenic
970216268 4:13762091-13762113 GAGACCATGGGGAGAGGGAGAGG + Intergenic
970472917 4:16394324-16394346 GAGACCATGGGGAGAGGGAGAGG + Intergenic
970531244 4:16987721-16987743 GTCCCCATGGGGAGATGCAGGGG - Intergenic
972939555 4:44181160-44181182 GAGACCATGGGGAGAGGGAGAGG - Intronic
974010148 4:56599039-56599061 GTTCCATTGGGGAGTGGCTGGGG - Intronic
974761889 4:66286884-66286906 GTACAAATGGGAGGAGGGAGAGG + Intergenic
975757142 4:77582195-77582217 GCTCCAATGTATAGAGGGAGGGG - Intronic
976341038 4:83944668-83944690 GAGACCATGGGGAGAGGGAGAGG + Intergenic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
979482718 4:121237995-121238017 GTGGAAATCGGGAGAGGGAGGGG - Intergenic
979986558 4:127323582-127323604 ATTCTAATGAGCAGAGGGAGGGG - Intergenic
980894986 4:138853465-138853487 GAGACCATGGGGAGAGGGAGAGG - Intergenic
983103931 4:163661773-163661795 GTTGCAAGGGGAAAAGGGAGAGG - Intronic
984902393 4:184596841-184596863 GCTCCAAGCAGGAGAGGGAGAGG + Intergenic
985575553 5:671901-671923 GTACCACGGGGGAGGGGGAGGGG + Intronic
987035011 5:14011148-14011170 GTTCCCCTGGAGAGAGGGAGGGG - Intergenic
989152212 5:38311013-38311035 GTTCCAAGTGGGAGAAGGAATGG - Intronic
989828709 5:45889953-45889975 GAGACCATGGGGAGAGGGAGAGG - Intergenic
990208314 5:53453895-53453917 GTGCCATTGGGGAGGGGGTGGGG - Intergenic
990539331 5:56756838-56756860 TTTCCAGTGGGGAGGGGGTGGGG + Intergenic
990980171 5:61595285-61595307 AATAAAATGGGGAGAGGGAGGGG - Intergenic
991910285 5:71552826-71552848 GAGACCATGGGGAGAGGGAGAGG + Intronic
992701150 5:79343087-79343109 GATCCACTGGGAAGAGGGTGTGG + Intergenic
992951790 5:81865715-81865737 GTTCATGTGGGGAAAGGGAGAGG - Intergenic
993524310 5:88945397-88945419 CTTCCAGTGGGGAGAGGGATAGG + Intergenic
995849943 5:116534477-116534499 ACTTCACTGGGGAGAGGGAGCGG - Intronic
997420791 5:133765212-133765234 ATGCCAGTGGGGAGAGGGGGAGG + Intergenic
997685555 5:135785703-135785725 TATCCAGAGGGGAGAGGGAGAGG + Intergenic
997948261 5:138221397-138221419 GGCCCAGTGAGGAGAGGGAGTGG - Intergenic
998364370 5:141619116-141619138 CTACCAATGGGGGAAGGGAGAGG + Intergenic
998680948 5:144466407-144466429 TTTCCAATGGGCAGAGGGAAAGG + Intronic
998885671 5:146691307-146691329 GGGGCAATGGGGAGAGGAAGAGG + Intronic
999581752 5:153046243-153046265 GGTGGAAGGGGGAGAGGGAGAGG - Intergenic
1000726183 5:164773809-164773831 GTTCCAAAGGAGAAAGAGAGAGG - Intergenic
1001092424 5:168751145-168751167 GCTAGAATGGAGAGAGGGAGGGG + Intronic
1001147870 5:169200477-169200499 CCCCCAATGGAGAGAGGGAGAGG + Intronic
1001301020 5:170533889-170533911 GTTCCAGTGGGCAGCGGGAGTGG + Intronic
1001500618 5:172230197-172230219 GTGGCAATGGGGAGAGTAAGAGG - Intronic
1001521865 5:172400134-172400156 GTTTCAAAGGAGAAAGGGAGAGG - Intronic
1002306527 5:178286907-178286929 GGTCCAGAGGGGAGAGGGTGGGG - Intronic
1002613286 5:180435386-180435408 GTCCCTGTGGGGAGAGGCAGAGG + Intergenic
1002702261 5:181132725-181132747 GTTGTGAAGGGGAGAGGGAGAGG + Intergenic
1003309687 6:4958388-4958410 GTTCCCTAGGGAAGAGGGAGAGG - Intergenic
1004114230 6:12750227-12750249 GTTGGAGTGGGGAGAGGGGGCGG + Intronic
1004448998 6:15727323-15727345 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1005644890 6:27828482-27828504 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1005983553 6:30855901-30855923 GTTCCAGTGGTGAGAGGGAGGGG + Intergenic
1006105706 6:31715189-31715211 GCCCCAGTGGGGACAGGGAGGGG - Intronic
1006225201 6:32531552-32531574 GTGCAAAGAGGGAGAGGGAGAGG - Intergenic
1006870973 6:37251695-37251717 TTTCCACTGGAGAGACGGAGGGG + Intronic
1007399121 6:41593809-41593831 GTTGGAAGGGAGAGAGGGAGAGG + Intronic
1007643004 6:43357905-43357927 GTTCCCCTGGGGAAAGGGAGAGG - Intronic
1007829494 6:44627625-44627647 GAACCACTGGGGAGGGGGAGGGG - Intergenic
1008553949 6:52656989-52657011 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1010483694 6:76383423-76383445 TTGCCAGTGGGGATAGGGAGTGG + Intergenic
1011599654 6:89048246-89048268 GTTCTGATGGGGAGTGGGAGTGG + Intergenic
1012307112 6:97672386-97672408 ATTGCAATGGAGAGAGGGGGAGG - Intergenic
1014800172 6:125770172-125770194 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1015503113 6:133953408-133953430 GTTACCGTGGGAAGAGGGAGCGG - Exonic
1016413313 6:143806574-143806596 GTGCCATTGGCAAGAGGGAGTGG - Intronic
1016616298 6:146052456-146052478 CTTCCCATGGGGAGAAGGATGGG + Intronic
1017464988 6:154686648-154686670 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1018454988 6:163943833-163943855 GTTCTATGGGGGAGAGCGAGTGG + Intergenic
1018528333 6:164737079-164737101 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1019651382 7:2161116-2161138 CGTGCAAAGGGGAGAGGGAGGGG - Intronic
1019937458 7:4265727-4265749 GGTCAAGCGGGGAGAGGGAGTGG + Exonic
1023202328 7:37712168-37712190 GTCCCAAGGGGGAGAGTGGGTGG + Intronic
1023421893 7:39989347-39989369 TTTTTAATGGGGAGTGGGAGGGG - Intronic
1023631774 7:42172257-42172279 GCTCCAAAGGGCAGAGGGTGGGG + Intronic
1023794501 7:43780596-43780618 CTTCCAAAAGGGAGAGGGAATGG - Intronic
1024931455 7:54668729-54668751 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1025234794 7:57227381-57227403 GTCCCAGTGTGGAGCGGGAGTGG + Intergenic
1025828818 7:65032951-65032973 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1025964031 7:66251420-66251442 TTTGGGATGGGGAGAGGGAGGGG - Intronic
1027682285 7:81235890-81235912 GTTCCAATGGGGAAAGTGGAAGG - Intergenic
1027820887 7:83043112-83043134 GTCACAATGGGGAAAGGGAAGGG - Intronic
1028084403 7:86618368-86618390 GTTCCCAGGGCTAGAGGGAGAGG + Intergenic
1028595842 7:92545824-92545846 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1029279256 7:99426122-99426144 GAGACCATGGGGAGAGGGAGGGG - Intronic
1029421178 7:100472560-100472582 CTCCCAAGTGGGAGAGGGAGAGG + Intronic
1030036488 7:105411751-105411773 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1030453980 7:109749006-109749028 CTTCCAATTGGTAGAGTGAGAGG + Intergenic
1031743141 7:125459742-125459764 ATTCCCATGGGATGAGGGAGAGG - Intergenic
1032127170 7:129203513-129203535 GTGCCATCGTGGAGAGGGAGCGG + Exonic
1032167508 7:129557090-129557112 GTTCCAAAAGGGAGAAAGAGAGG - Intergenic
1032200221 7:129816179-129816201 GTTCGAATGGGCTGACGGAGTGG - Intergenic
1032259868 7:130326786-130326808 CTTCAAATGGGGAGAGGTAGAGG + Intergenic
1035933993 8:3817170-3817192 TTTTCATTGGGGAGGGGGAGGGG - Intronic
1036051989 8:5209302-5209324 TTTCCAAAGGAGAGAGGGAAGGG + Intergenic
1036979940 8:13459564-13459586 GTTCCAATGGGGGCAGGGGCTGG + Intronic
1037062382 8:14530963-14530985 GTTCCCAGGTGGACAGGGAGGGG + Intronic
1037103738 8:15079880-15079902 TTCCAAAAGGGGAGAGGGAGGGG - Intronic
1037456509 8:19069360-19069382 CTTCCAATGGGGGAAGGGAAAGG + Intronic
1037752565 8:21692437-21692459 CTCCCTTTGGGGAGAGGGAGGGG - Exonic
1038632663 8:29261358-29261380 AAACCAATGGGGAAAGGGAGAGG + Intronic
1039201181 8:35095081-35095103 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1039642047 8:39234263-39234285 ATTCTAATGGGGGGTGGGAGGGG - Intronic
1039676270 8:39671567-39671589 GTTCCAATTGGGAGAAGAATGGG + Intronic
1040121502 8:43688646-43688668 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1041066111 8:54085009-54085031 GTGCAAAGAGGGAGAGGGAGAGG - Intronic
1041223695 8:55676810-55676832 GTACATATGAGGAGAGGGAGGGG - Intergenic
1041488183 8:58402077-58402099 GTTCCAAAGGGGAGAATGTGTGG - Intergenic
1042341555 8:67685015-67685037 CTTGCAATGGGGAGAGAGATTGG - Intronic
1042546393 8:69955150-69955172 GTTCTAGTGGGTAGAGAGAGAGG + Intergenic
1044529151 8:93288618-93288640 GTTGCCAGGGGGTGAGGGAGAGG + Intergenic
1045045418 8:98270872-98270894 GTTTATATGGTGAGAGGGAGAGG + Intronic
1046551095 8:115718203-115718225 ATTGCATTGGGGAGAGGTAGGGG - Intronic
1046735916 8:117777119-117777141 CGTGCAAAGGGGAGAGGGAGAGG - Intergenic
1046834109 8:118780148-118780170 GATCCAAAAGAGAGAGGGAGAGG - Intergenic
1046871641 8:119210402-119210424 GATATAATGGGGAGGGGGAGGGG - Intronic
1047434689 8:124826376-124826398 GTTTCAATGGGGAGAGTGCCTGG - Intergenic
1047889928 8:129296499-129296521 GTTCCCATGTGTCGAGGGAGGGG - Intergenic
1048727024 8:137398169-137398191 GTGGCAAGGGGGAGGGGGAGGGG + Intergenic
1048926762 8:139278383-139278405 GGTGCAATGGGGAGAAGGAGAGG - Intergenic
1049853471 8:144847171-144847193 GTTCTTTTGTGGAGAGGGAGAGG + Intronic
1049976177 9:862504-862526 CGTGCAATGGGGAGGGGGAGGGG + Intronic
1052880875 9:33600277-33600299 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1052887849 9:33667099-33667121 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1053549433 9:39060390-39060412 GTCCTTATGGTGAGAGGGAGCGG + Intergenic
1053813548 9:41880464-41880486 GTCCTTATGGTGAGAGGGAGCGG + Intergenic
1054359531 9:64100279-64100301 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1054457140 9:65438880-65438902 GTTCCATTGGGCAGAGAGTGGGG - Intergenic
1054617048 9:67306975-67306997 GTCCTTATGGTGAGAGGGAGCGG - Intergenic
1055134107 9:72807259-72807281 GAGACCATGGGGAGAGGGAGAGG + Intronic
1055241910 9:74196834-74196856 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1056539919 9:87562087-87562109 ATTCTCATGGGGAGAGGGAAGGG + Intronic
1057272213 9:93657662-93657684 TCTTCAATGGGAAGAGGGAGGGG + Intronic
1058758362 9:108104752-108104774 GAACCAATGGGGAGCTGGAGTGG + Intergenic
1059313290 9:113403196-113403218 TTTCCACTGGGGAGATGGGGAGG + Intergenic
1059617706 9:115968578-115968600 GGACCAAGAGGGAGAGGGAGGGG + Intergenic
1060044202 9:120327201-120327223 GTTCCACTGGGGAGGGGAAGTGG + Intergenic
1060349913 9:122851469-122851491 GAGACCATGGGGAGAGGGAGAGG - Intronic
1061131873 9:128713033-128713055 GTCCCTGTGGGGAGAGTGAGCGG - Exonic
1061216573 9:129225199-129225221 GTCCCAAGGGGGAGAGGGAGGGG - Intergenic
1061238833 9:129357672-129357694 GTGCCAGTGGGGAGACGGAGGGG - Intergenic
1061916170 9:133755628-133755650 CCACCAGTGGGGAGAGGGAGAGG + Intergenic
1203441887 Un_GL000219v1:16406-16428 GACCCAGTGGGGAGAGAGAGTGG - Intergenic
1203368447 Un_KI270442v1:278944-278966 GTTCCCAGGGGGAGGGGCAGTGG + Intergenic
1203512695 Un_KI270741v1:135315-135337 GACCCAGTGGGGAGAGAGAGTGG - Intergenic
1203562461 Un_KI270744v1:70766-70788 GAGACAGTGGGGAGAGGGAGAGG - Intergenic
1185628952 X:1502360-1502382 GTTCGAAGTGGGGGAGGGAGGGG - Intronic
1186495587 X:10010645-10010667 GTTGGAATGGGGACAGGGTGAGG - Intergenic
1186685337 X:11919437-11919459 GGGCCAATAGGGAGTGGGAGTGG + Intergenic
1187772251 X:22713074-22713096 GTTCCAGTGGGGAGAGAAGGAGG + Intergenic
1188706618 X:33341329-33341351 GTTACCAAGGGCAGAGGGAGGGG - Intergenic
1189210029 X:39276878-39276900 GAGACCATGGGGAGAGGGAGAGG - Intergenic
1190174580 X:48138579-48138601 CGTGCAAAGGGGAGAGGGAGAGG - Intergenic
1190464323 X:50710507-50710529 CTACCAGAGGGGAGAGGGAGAGG + Intronic
1190891685 X:54573505-54573527 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1191679516 X:63826304-63826326 CATGCAAAGGGGAGAGGGAGAGG + Intergenic
1192530405 X:71877751-71877773 GAGACCATGGGGAGAGGGAGAGG + Intergenic
1193890153 X:87033959-87033981 GGTGCAAAGGGGAGTGGGAGTGG + Intergenic
1194479493 X:94402155-94402177 GTTCCAGTGCGGTGGGGGAGTGG + Intergenic
1195533336 X:105982463-105982485 GCTGCAGTGGGGAGAGGGAGAGG + Intergenic
1196215723 X:113049874-113049896 GTCCCTGTGCGGAGAGGGAGGGG - Intergenic
1196290061 X:113929672-113929694 CTTCCACTTGGGAGAAGGAGAGG - Intergenic
1196798814 X:119523959-119523981 GGCCCCATGGGGAAAGGGAGAGG + Intergenic
1196825666 X:119738382-119738404 GGCCCATGGGGGAGAGGGAGGGG - Intergenic
1198401081 X:136268971-136268993 ATTCCAGCTGGGAGAGGGAGAGG - Intergenic
1200246232 X:154527488-154527510 GTTCGGATGGAGGGAGGGAGAGG + Intergenic
1201077977 Y:10200771-10200793 GGTCCACTGGGGAGAGGGTGGGG + Intergenic
1201362352 Y:13166729-13166751 CTCCCAATGGTGGGAGGGAGGGG + Intergenic