ID: 1141382369

View in Genome Browser
Species Human (GRCh38)
Location 16:83588021-83588043
Sequence CAGGTGTACGGGATGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 195}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141382369_1141382376 -8 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382376 16:83588036-83588058 TACACCTGGAGATGTGTGGCTGG 0: 1
1: 0
2: 1
3: 11
4: 216
1141382369_1141382379 -1 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382379 16:83588043-83588065 GGAGATGTGTGGCTGGCCTAGGG 0: 1
1: 0
2: 0
3: 19
4: 253
1141382369_1141382378 -2 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382378 16:83588042-83588064 TGGAGATGTGTGGCTGGCCTAGG 0: 1
1: 0
2: 1
3: 31
4: 322
1141382369_1141382387 28 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382387 16:83588072-83588094 CTGGGGCTGGGACCAGCCAGTGG No data
1141382369_1141382382 11 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382382 16:83588055-83588077 CTGGCCTAGGGCTGAGCCTGGGG 0: 1
1: 0
2: 4
3: 45
4: 472
1141382369_1141382389 30 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382389 16:83588074-83588096 GGGGCTGGGACCAGCCAGTGGGG 0: 1
1: 0
2: 5
3: 62
4: 442
1141382369_1141382388 29 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382388 16:83588073-83588095 TGGGGCTGGGACCAGCCAGTGGG 0: 1
1: 0
2: 1
3: 29
4: 309
1141382369_1141382381 10 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382381 16:83588054-83588076 GCTGGCCTAGGGCTGAGCCTGGG 0: 1
1: 0
2: 3
3: 54
4: 376
1141382369_1141382384 15 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382384 16:83588059-83588081 CCTAGGGCTGAGCCTGGGGCTGG 0: 1
1: 0
2: 7
3: 121
4: 1010
1141382369_1141382380 9 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382380 16:83588053-83588075 GGCTGGCCTAGGGCTGAGCCTGG No data
1141382369_1141382385 16 Left 1141382369 16:83588021-83588043 CCTCCTTCCATCCCGTACACCTG 0: 1
1: 0
2: 0
3: 12
4: 195
Right 1141382385 16:83588060-83588082 CTAGGGCTGAGCCTGGGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141382369 Original CRISPR CAGGTGTACGGGATGGAAGG AGG (reversed) Intronic
900110250 1:1002147-1002169 AGGGAGTTCGGGATGGAAGGAGG + Intergenic
900366899 1:2315164-2315186 GAGGGGTACGGGGGGGAAGGGGG - Intergenic
901789680 1:11647716-11647738 CTGGGGTAGGGGATGGGAGGTGG - Intergenic
902437536 1:16408191-16408213 GAGGAGTAGGGGATGGAAGGAGG + Intronic
904456245 1:30649880-30649902 CAGGTGAACGGGCAGGGAGGAGG - Intergenic
904702594 1:32366742-32366764 CTGGGGTAGGGGATGGGAGGTGG - Intronic
905145332 1:35883410-35883432 CGGGTATATGGGATGGAAGCGGG + Exonic
905280000 1:36842984-36843006 CAGGTGGAGGGGGTGGATGGTGG - Intronic
906066984 1:42988029-42988051 CAGTGAAACGGGATGGAAGGAGG - Intergenic
907337491 1:53709943-53709965 CAGATGTACAGGATGGGAGGGGG + Intronic
907487545 1:54788002-54788024 TGGGGGTACGGGATGGAAGAGGG - Intronic
915125198 1:153658884-153658906 CAGGTGCCCGGGAGGGAAGTTGG + Exonic
915294257 1:154909071-154909093 CAGGAGGAAGGGATGGGAGGAGG + Intergenic
915536831 1:156541388-156541410 CAGGTAGACGGGATGGACAGTGG + Intronic
915838528 1:159197314-159197336 CAAGTGCAGGGGATGGAAGATGG - Intronic
916664417 1:166952574-166952596 CAGATGTATAGGGTGGAAGGAGG + Intronic
918094660 1:181324920-181324942 CAGATGCAGGAGATGGAAGGAGG - Intergenic
920874199 1:209819042-209819064 CAGGTGAATGGGTTGGAAGGAGG - Intergenic
922038964 1:221876980-221877002 CAGGTGTAAGCAATGGATGGAGG - Intergenic
924602546 1:245504260-245504282 AAAGTGTTTGGGATGGAAGGTGG - Intronic
924845551 1:247766605-247766627 CAGGGGTAGGGAATGGAAGACGG + Intergenic
1063533920 10:6863954-6863976 GAGGTGAAGGGGAAGGAAGGAGG + Intergenic
1068279917 10:54854888-54854910 CAGGTTTCCTGGGTGGAAGGGGG - Intronic
1069140515 10:64817254-64817276 CAGGTATATGTGATAGAAGGAGG + Intergenic
1069654267 10:70076033-70076055 CAGGTGATCAGCATGGAAGGCGG + Intronic
1070501653 10:77078322-77078344 CAGCTTTAGGGGAGGGAAGGTGG - Intronic
1070525173 10:77290020-77290042 CAGGGGTTAGAGATGGAAGGAGG + Intronic
1072333616 10:94377655-94377677 CACGTGTACAGGATGAGAGGAGG - Intergenic
1073026140 10:100488606-100488628 CAGGGGTACTGGAAGGAGGGTGG - Intronic
1073505042 10:103978883-103978905 AAGGAGGAAGGGATGGAAGGAGG - Intronic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1074110994 10:110422834-110422856 AAGGTGTGAGGGAAGGAAGGAGG + Intergenic
1077368745 11:2171888-2171910 CAGGGGTGGGGGATGTAAGGAGG - Intergenic
1077537653 11:3132119-3132141 GAGGTGAATGGGAAGGAAGGTGG - Intronic
1077615655 11:3671752-3671774 CAGGTGTGGGGAATGGAAGAAGG - Intronic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083430950 11:62613233-62613255 GAGGTGTCAGGGATGGAAGCTGG - Exonic
1084325198 11:68396179-68396201 CAGGTGGAAGGGATGGTTGGGGG + Intronic
1084938254 11:72598856-72598878 TGGGTGTAGGGGCTGGAAGGTGG - Intronic
1086683916 11:89708350-89708372 CAAGGGTAGGGGTTGGAAGGAGG - Intergenic
1086952777 11:92908095-92908117 CAGGTATACAGGATGGAGAGGGG + Intergenic
1089090761 11:115872953-115872975 GAGGTGTAAGGGGTGGTAGGAGG + Intergenic
1089316476 11:117594623-117594645 CAGGTCTGCGGGATGTCAGGTGG - Intronic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1091045154 11:132318739-132318761 CAGGGGATTGGGATGGAAGGTGG - Intronic
1092745569 12:11669334-11669356 CAGGAGGACGGGAGGAAAGGAGG - Intronic
1092932756 12:13332362-13332384 AAAGTGTAAGGGATGAAAGGTGG + Intergenic
1097036632 12:56128745-56128767 CAGATGGAAGGGGTGGAAGGGGG - Intronic
1097287922 12:57891957-57891979 CAGGGGTACCAGATGTAAGGGGG + Intergenic
1099585899 12:84513324-84513346 CAGGAGTACAGTATGGAAAGGGG - Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1106587447 13:31069727-31069749 CAAGTCTAGGGGATGGCAGGTGG - Intergenic
1107636213 13:42395100-42395122 CAGGTGGACGGGATGGGGAGAGG + Intergenic
1108477813 13:50838634-50838656 CAGGTGGCCATGATGGAAGGAGG + Intronic
1109501940 13:63249329-63249351 AAGGTGAAAGGAATGGAAGGAGG + Intergenic
1110404046 13:75128729-75128751 CAGGTCTAAGGGAGGGGAGGTGG + Intergenic
1112379521 13:98875507-98875529 CAGGTATACTGGAAGAAAGGAGG - Intronic
1113708312 13:112447977-112447999 CAGGGGTCCGGGATGGAGAGAGG - Intergenic
1118959457 14:70515569-70515591 CAGGGGGATGGGATGCAAGGGGG + Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1121800834 14:96772794-96772816 AAGGTGTAGGGGGTGGTAGGGGG + Intergenic
1124937549 15:34186807-34186829 CAAGAGTCCTGGATGGAAGGGGG + Intronic
1125400899 15:39301663-39301685 CAGGGGCAGGGGATGGGAGGAGG + Intergenic
1126207409 15:46060971-46060993 CAGGTGTAAGGCAAGGAAGGAGG - Intergenic
1129999115 15:80032109-80032131 CAGGTGCAGGAGATGCAAGGAGG + Intergenic
1131402200 15:92134145-92134167 CAGGTGTAAGGGATGGCCAGTGG - Intronic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132568629 16:634571-634593 CAGGTGTGCGGGGGTGAAGGAGG + Exonic
1132641292 16:979768-979790 CAGGGGCAGGGGGTGGAAGGTGG + Intronic
1134846681 16:17446655-17446677 CAGGTGATCAGGCTGGAAGGAGG + Intronic
1136235406 16:28910815-28910837 CAGTTGCACGTGGTGGAAGGGGG - Intronic
1136369215 16:29825554-29825576 CAGGTTTAGGGCATGGCAGGTGG + Intronic
1139478666 16:67216205-67216227 AAGGGGTGCGGGATGAAAGGAGG - Intronic
1139916699 16:70432803-70432825 CAGGTGTGTGGGACGGAAGCTGG + Intronic
1141382369 16:83588021-83588043 CAGGTGTACGGGATGGAAGGAGG - Intronic
1142427126 16:90007184-90007206 CAGGTGTCTGGGAGGGAATGGGG - Intronic
1142656427 17:1397644-1397666 CAGGTGTCGGGGGTGGAAGAAGG - Intronic
1143965735 17:10755538-10755560 CAGGGTTGCGGGATGGGAGGTGG - Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1147120369 17:38331968-38331990 CAGGTGTAAATGATGGAACGGGG + Intronic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148111704 17:45148271-45148293 GAGGTCTAAGCGATGGAAGGTGG + Intergenic
1150135111 17:62691156-62691178 CAGCGGCACGGGGTGGAAGGAGG - Intronic
1151283377 17:73092693-73092715 CACGTGTGCGGGAGGGAAGCAGG - Intronic
1151819547 17:76490247-76490269 CAGCACTTCGGGATGGAAGGAGG - Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1152743655 17:82029508-82029530 CAGGAGAACGGGCTGGCAGGTGG + Intronic
1153836620 18:8969751-8969773 AAGGTGGAAGGGAGGGAAGGGGG - Intergenic
1154152098 18:11914400-11914422 CAGATGTCAGGGATGGAAGTTGG - Intergenic
1155225272 18:23724482-23724504 CAGGGGGACGGGGTGGCAGGGGG - Intronic
1155437651 18:25829946-25829968 CAGGTGCTTGGGATGGAAAGAGG - Intergenic
1156114113 18:33766630-33766652 AAAGAGTACAGGATGGAAGGGGG - Intergenic
1157597244 18:48871266-48871288 CAGGTGCAATTGATGGAAGGAGG - Intergenic
1160907064 19:1456435-1456457 CAGCTGTCTGGGCTGGAAGGGGG + Intronic
1161921414 19:7268953-7268975 CAGGTGTAAGGGACACAAGGAGG - Intronic
1162008143 19:7793040-7793062 CAGGTGTATAGGATGGAACATGG + Intergenic
1162395737 19:10417278-10417300 CAGATGTGAGGGATGGGAGGGGG + Intronic
1165275283 19:34745713-34745735 CAGGTCTATGGGAAGGAAGGAGG + Intergenic
1167115020 19:47484060-47484082 AATGTGTACGGGCTGGCAGGCGG - Exonic
1167499603 19:49837660-49837682 CAGGCCTACGTGATGGTAGGTGG + Intronic
925105586 2:1287978-1288000 CAGGTGGTCAGGATGGAAGCTGG - Intronic
925665701 2:6252977-6252999 CAGGGAAACGGGATGGAGGGAGG - Intergenic
925924534 2:8660517-8660539 CAGGTATCTGGGATAGAAGGAGG + Intergenic
926163207 2:10502357-10502379 CAGGTGTTGGGGGTGGAGGGGGG - Intergenic
926701095 2:15804074-15804096 CGGGTGTGCGGGGTGGAATGAGG + Intergenic
927104403 2:19811136-19811158 CAGGACTAGGGTATGGAAGGTGG + Intergenic
930365435 2:50433731-50433753 AAGGTGGAAGGGAGGGAAGGAGG + Intronic
932177263 2:69614346-69614368 CAGGTGTAACAGCTGGAAGGAGG + Intronic
935347680 2:102123948-102123970 GAGGTGAAAGGGATGGAAAGGGG + Intronic
935833462 2:107024527-107024549 CAGGCAGATGGGATGGAAGGTGG + Intergenic
936376766 2:111947704-111947726 CAGGTAGACGGGAAGGCAGGTGG + Intronic
936451363 2:112636152-112636174 CAGGTGCAGGGGAAGGAAGGTGG + Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
940648701 2:156418736-156418758 CTGGTGTACGTTATGGGAGGGGG + Intergenic
943354814 2:186839895-186839917 CAGGAGTAGGAGATGGAAGGGGG - Intronic
944505051 2:200402474-200402496 CAGGGGAATGGGAGGGAAGGTGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947976011 2:234367043-234367065 CAGCTGTACTAGATGGAAGCAGG + Intergenic
1168910071 20:1440504-1440526 CAGGTCAAAGGGATGGAGGGTGG + Intergenic
1170329012 20:15187977-15187999 CGTGTGTAGGGGATGGATGGAGG - Intronic
1170948247 20:20911358-20911380 CAGGTCTTCGGGCTGGAGGGTGG - Intergenic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1175597127 20:60244200-60244222 CAGGTGCACTGGATGGAGGATGG + Intergenic
1176212623 20:63932443-63932465 CAGGTGTGCTGGAAGGAATGTGG - Exonic
1179164526 21:38925196-38925218 CAGCTGCAGGGGAAGGAAGGAGG + Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179714693 21:43280782-43280804 GAGGTGGAGGGGAGGGAAGGTGG + Intergenic
1180042508 21:45287606-45287628 CAGGCCCACGGGATGGAGGGTGG - Intronic
1180410333 22:12601535-12601557 CAAGGGTACGGGATGAAATGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183846189 22:40542199-40542221 CAGGGGTAGGGGGTGGGAGGAGG - Intronic
1184259522 22:43306668-43306690 AGGGTGTACGTGAAGGAAGGTGG - Intronic
1185199440 22:49492457-49492479 CAGCTGCCCGGGAAGGAAGGTGG + Intronic
1185272473 22:49935566-49935588 CAGGTGTTGGGGACGGAGGGTGG + Intergenic
952990210 3:38824871-38824893 CAGGGGTTTGGGATGGGAGGTGG - Intergenic
953154837 3:40360315-40360337 CAGATGTTGGGGATGGAAGAGGG + Intergenic
953598413 3:44338769-44338791 CTGGTGTACTGGGTGGGAGGTGG + Exonic
953823871 3:46233313-46233335 CTGGTGCCCGGGAAGGAAGGTGG + Intronic
954407192 3:50351771-50351793 GAGGTGTAAGGGAAGGAGGGAGG + Intronic
954630169 3:52043717-52043739 CTGGTGTCAGGGATGGGAGGGGG + Intergenic
956312191 3:67893668-67893690 AAGGTGTACAGTATGAAAGGAGG - Intergenic
959860282 3:111208210-111208232 CAGGTGTACGAGAAGTGAGGGGG - Intronic
959899949 3:111649729-111649751 CAAGTGTACTTGATGGGAGGTGG - Exonic
962297279 3:134202352-134202374 CATGTTTACTGGATGGATGGAGG + Intronic
965634735 3:170769552-170769574 CAGGTCTAGGGGAGGGCAGGAGG + Intronic
967355389 3:188564212-188564234 AAGGAGTATGGCATGGAAGGTGG - Intronic
968292162 3:197547279-197547301 CAGGCCTAAGGGAAGGAAGGCGG + Intronic
969196678 4:5568847-5568869 CAGTTGGACGGGATGGATGGAGG - Intronic
975849882 4:78561237-78561259 GAAGTGTTCGGGAGGGAAGGGGG - Intronic
978848277 4:113301637-113301659 CAGGTGTTGGAGAAGGAAGGGGG - Intronic
981509604 4:145541296-145541318 CAGTTGCAAGGGATGGGAGGAGG + Intronic
985903391 5:2814323-2814345 GAGGTGTTTGGGCTGGAAGGAGG + Intergenic
986618301 5:9643053-9643075 CTGGGGTATGGGAGGGAAGGAGG - Intronic
986719998 5:10554154-10554176 CAGGTGTGCTGGGTGGAGGGTGG + Intergenic
987999010 5:25326095-25326117 CAAGTCTACAGGATGGAAGATGG + Intergenic
991943980 5:71882297-71882319 CAGGTGTATGGGAGAGAGGGAGG - Intergenic
993503068 5:88683626-88683648 CAGGTGTAATGGATGGCAGGGGG + Intergenic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
998790781 5:145764357-145764379 CATGGGCACAGGATGGAAGGAGG - Intronic
999377848 5:151099289-151099311 CAGTTGTAGGGGCTGAAAGGTGG - Intergenic
1000522628 5:162317252-162317274 CAGTTGTAAGGTGTGGAAGGAGG + Intergenic
1001679179 5:173543817-173543839 CAGGTGTGGAGGCTGGAAGGGGG - Intergenic
1002860495 6:1075474-1075496 CAGGTGCAGGAGCTGGAAGGGGG - Intergenic
1007427047 6:41753941-41753963 GAGGTGTACTGGATGGATGAAGG + Intronic
1007880597 6:45161646-45161668 CAGCTTTACGGTATGGAGGGAGG - Intronic
1010488530 6:76446580-76446602 CAGGGGTAGGGAATGGAAGAGGG + Intergenic
1015882577 6:137883788-137883810 CATTTGTACTGGATGGGAGGTGG - Intergenic
1017286138 6:152678399-152678421 CAGGTGTTAGGAATGGAGGGTGG - Intergenic
1017452890 6:154570821-154570843 CAGCTGTATGGGATGGGAGAAGG + Intergenic
1018076687 6:160222634-160222656 GAGGGGTACGGGGTGGGAGGTGG + Intronic
1018974769 6:168556155-168556177 CGGCTGTGCGGGAGGGAAGGAGG + Intronic
1019304626 7:327431-327453 CAGGTGGACGGGAAGGACAGTGG - Intergenic
1019400953 7:853541-853563 CGGGTGGACCAGATGGAAGGCGG + Exonic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1020967239 7:14886712-14886734 CAGGTGGGCCAGATGGAAGGTGG - Intronic
1023356422 7:39371540-39371562 CAGGGGTAAAGGATGGAGGGAGG - Intronic
1025907465 7:65798921-65798943 CATGTGTTGGGGATGGAAGAAGG + Intergenic
1026029708 7:66779862-66779884 CAGGTGTTCGGTATGCAGGGAGG - Intronic
1027587967 7:80081593-80081615 CAGGGGTAGCGGATGGAAGCTGG + Intergenic
1028876394 7:95827912-95827934 GGGGTGGAGGGGATGGAAGGGGG + Intronic
1030681537 7:112439514-112439536 TAGGGGTAGGGGATGGTAGGTGG + Intronic
1032003123 7:128278787-128278809 CAGGTGTTAGGAATGGAAGGAGG + Intergenic
1033932091 7:146536513-146536535 CAGGTGGAAGGGAAGTAAGGAGG + Intronic
1034800035 7:154050930-154050952 CAGGTGGAAGGGACTGAAGGAGG + Intronic
1038485100 8:27929403-27929425 CATGTGTATGGGAGGGAAGAAGG + Intronic
1039156845 8:34569687-34569709 CAGGAGTTAGGGATGGCAGGGGG + Intergenic
1041325381 8:56658065-56658087 CAGTCATATGGGATGGAAGGTGG - Intergenic
1044896936 8:96902572-96902594 CAGATGGATGGGATGGAAGGAGG - Intronic
1045789441 8:105965091-105965113 AAGGTGCACGGGATGGAACAGGG - Intergenic
1048680135 8:136832062-136832084 TATGGGTACGGGATGGCAGGGGG + Intergenic
1048959361 8:139563138-139563160 CTGGTGTTAGGGATGGAGGGAGG - Intergenic
1049603126 8:143517289-143517311 CAGGTGCAGGGGAAGGGAGGGGG + Intronic
1052982176 9:34457842-34457864 CAGGGGTCTGGGATGGGAGGTGG - Intronic
1054906750 9:70419596-70419618 CGGGCGTGGGGGATGGAAGGTGG - Intergenic
1057090978 9:92257927-92257949 CAGTTGTGGGGCATGGAAGGTGG + Intronic
1058437040 9:104972357-104972379 GAGGAGAAAGGGATGGAAGGAGG + Intergenic
1059460346 9:114425562-114425584 CAGGTGAAAGGAAGGGAAGGGGG + Intronic
1060389539 9:123267429-123267451 GAGGAGTATGGGGTGGAAGGGGG - Intronic
1060670617 9:125466269-125466291 CAGGGGTACGGGGTGGGTGGTGG - Intronic
1061168626 9:128939161-128939183 CAGTTGCCCGGGAAGGAAGGAGG + Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1187257179 X:17654185-17654207 CAGGAGACCAGGATGGAAGGGGG - Intronic
1189033248 X:37470736-37470758 CACATTTACGGGATGGATGGAGG + Intronic
1190424188 X:50316619-50316641 CAGGAGTTAGGGGTGGAAGGTGG - Intronic
1192508802 X:71709385-71709407 CAGGGGTGCAGGATGGAGGGAGG + Intergenic
1192517895 X:71772168-71772190 CAGGGGTGCAGGATGGAGGGAGG - Intergenic
1200257769 X:154593850-154593872 CAGGTTTATGGGATGCAGGGTGG - Intergenic