ID: 1141382471

View in Genome Browser
Species Human (GRCh38)
Location 16:83588675-83588697
Sequence TTTACCACTTTGTAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141382469_1141382471 -10 Left 1141382469 16:83588662-83588684 CCGGTACTTGATATTTACCACTT 0: 1
1: 0
2: 1
3: 19
4: 204
Right 1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 157
1141382468_1141382471 6 Left 1141382468 16:83588646-83588668 CCAAAGGGAAGCTTCTCCGGTAC 0: 1
1: 0
2: 0
3: 23
4: 81
Right 1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 157
1141382466_1141382471 15 Left 1141382466 16:83588637-83588659 CCACAGGCACCAAAGGGAAGCTT 0: 1
1: 0
2: 1
3: 14
4: 196
Right 1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141382471 Original CRISPR TTTACCACTTTGTAGATGGC AGG Intronic
902067966 1:13705013-13705035 GTTACCACTTGTTAGAAGGCAGG + Exonic
903285932 1:22276774-22276796 TTTGCCACTTTGTCTATGGAAGG + Intergenic
905508489 1:38499825-38499847 TTTACAACTTTGAAAATGGGTGG + Intergenic
906275428 1:44511788-44511810 TTTACCATTTTTTAGAAGACAGG - Intronic
906870816 1:49478569-49478591 TTTAGCATTTTTTATATGGCAGG - Intronic
908472535 1:64458245-64458267 TTTACCACTTAGCACATGGCGGG - Intergenic
909656153 1:78034858-78034880 TTTAGCACTTAGTAAATGCCAGG + Intronic
912389221 1:109290346-109290368 TTTGCCATTGTGTACATGGCTGG + Intergenic
913103546 1:115592248-115592270 TTTACCAGTTTGTACAGGGATGG - Intergenic
913205947 1:116538903-116538925 TGTACCTCTTTGGAGATAGCGGG - Intronic
915450484 1:156001820-156001842 TTTAGCACTTTGTAAGTGTCAGG + Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916556480 1:165898227-165898249 TTTACCACTTACTAGATGTGTGG + Intronic
917617278 1:176758939-176758961 TTTACTAATTTGCAGATGGAAGG + Intronic
917755781 1:178095967-178095989 TGTACCACTTTGTATTTTGCTGG + Intronic
919844338 1:201631807-201631829 CATATCAATTTGTAGATGGCTGG + Intronic
921309417 1:213827927-213827949 TTCATCATTTTGTGGATGGCAGG - Intergenic
922556845 1:226539117-226539139 TTTGCCCCATTGTAGGTGGCGGG + Intergenic
922627410 1:227062797-227062819 TTTAGCACTTTTTACATGGGTGG - Intronic
923446336 1:234074875-234074897 TTTACCACATTTGAGATGTCTGG + Intronic
1062897523 10:1115799-1115821 GTCACCACCTGGTAGATGGCTGG - Intronic
1069219622 10:65867336-65867358 TTTATCACTCTGTAGAGGCCAGG + Intergenic
1071023550 10:81085810-81085832 TTTAGCATTTTGTGAATGGCTGG + Intergenic
1071288542 10:84171717-84171739 CTTACCAAGTTGTAGATGTCCGG + Intergenic
1072019559 10:91384434-91384456 TTTACTACTATGTATATGTCAGG + Intergenic
1073722852 10:106193795-106193817 TTTACCATTTTAGAGATGTCTGG + Intergenic
1073850767 10:107615139-107615161 ATTTCCACTTTCTAGATGGAGGG - Intergenic
1074503854 10:114049845-114049867 TTTACCCTTTTGTAGGTGGAGGG + Intergenic
1075884325 10:125884859-125884881 TTTAGCACTTGGTAGATATCTGG + Intronic
1080743867 11:35090187-35090209 TTTATCACTCTGTAGGTGGAAGG - Intergenic
1084448173 11:69216427-69216449 TCTACCACTTTGTAGAAGTGGGG + Intergenic
1086184211 11:83994309-83994331 GTTACCACTTTGAAGGTGGAGGG + Intronic
1087363564 11:97191371-97191393 TTTACCACTGTGTCAGTGGCCGG + Intergenic
1089971319 11:122695806-122695828 TTAACCACTTTGGGCATGGCTGG - Intronic
1091536432 12:1414303-1414325 CTTCCTACTTTGCAGATGGCTGG + Intronic
1093847181 12:23987327-23987349 TCTACCACTCTGTGTATGGCTGG - Intergenic
1095746033 12:45660107-45660129 TATACTACTTTCTAGAAGGCAGG + Intergenic
1098969133 12:76831204-76831226 TTTAGCACTTTTTACATGTCAGG - Intronic
1099441344 12:82703242-82703264 TTTTCCACTTTGGAGTTGGATGG + Intronic
1102105744 12:110321285-110321307 TTTGCCATTTTGTATATGACTGG + Intronic
1107012448 13:35681880-35681902 TTTTCCACTTTATGGATGTCTGG + Intergenic
1107749087 13:43545296-43545318 TTTATCACTTTGAAGATGGTAGG - Intronic
1108600749 13:51992486-51992508 TTTAGCACTTGGTATATGGTAGG - Intronic
1109415347 13:62032302-62032324 TTTTCCATTTTGTAAATGGTGGG + Intergenic
1110404830 13:75138444-75138466 TTTACCATTTTGCTGATGCCAGG - Intergenic
1114280285 14:21187862-21187884 TTTACCCTTTTATAGATTGCTGG - Intergenic
1120226480 14:81796138-81796160 TTTAGCAATTTGTTTATGGCAGG + Intergenic
1121753373 14:96378657-96378679 TTAAGCACTTTCTACATGGCAGG + Intronic
1124228716 15:27921580-27921602 TTTTCGACTTTGTAGGGGGCTGG - Intronic
1124408813 15:29418286-29418308 TTTACTACTTTCTAGATATCTGG - Intronic
1124829450 15:33133884-33133906 CTTATCATTTTATAGATGGCTGG - Intronic
1125320153 15:38477630-38477652 TTCAGCACTTTGTATATGTCAGG + Intronic
1131915000 15:97255309-97255331 TTTCCCAGTTTGTAGGTTGCAGG + Intergenic
1131974686 15:97933041-97933063 TTTACCAGCTTATAGATGGAAGG - Intergenic
1137702422 16:50506606-50506628 TTCCCCACTTTGTTGATGACTGG - Intergenic
1140715682 16:77723383-77723405 TTTGCCTCTTTCTAGGTGGCAGG - Intronic
1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG + Intronic
1141568217 16:84917836-84917858 TTTTCCTCTTAGTACATGGCAGG - Intronic
1150598588 17:66629553-66629575 CTTACCACTTTGTACAGGGCTGG + Intronic
1152366204 17:79857961-79857983 TTCCCCACCTTGCAGATGGCTGG - Intergenic
1153094159 18:1382484-1382506 TTTAACACTTTCTAGAATGCTGG - Intergenic
1155169699 18:23258222-23258244 TTCTCCACTGTGGAGATGGCTGG + Exonic
925036362 2:689907-689929 TTTTCCACTTTGTTGATCACTGG + Intergenic
926596691 2:14797489-14797511 TTCACCACACTGCAGATGGCAGG + Intergenic
926687101 2:15706542-15706564 TTGTCCAGTTTGCAGATGGCAGG - Intronic
927428403 2:23006202-23006224 TTTGCCACTTTGTCCATGGATGG + Intergenic
929425168 2:41837382-41837404 GGTACCACTTTGTTAATGGCTGG + Intergenic
929559803 2:42949156-42949178 TTTTCCACTTTCTAGGTTGCTGG + Intergenic
930272185 2:49269961-49269983 TTTAGCAGTTTGCATATGGCAGG + Intergenic
931914467 2:66938250-66938272 TTTGGCACTTTGTGGTTGGCTGG + Intergenic
933301976 2:80551306-80551328 TTTACCACTTTGAAAATCCCAGG - Intronic
933606308 2:84388054-84388076 ATTACCACTTTCCAGATGCCAGG + Intergenic
934742040 2:96731227-96731249 TTAACCACTTTCTAGGTGCCAGG - Intronic
935228315 2:101073589-101073611 TTTAAAACAATGTAGATGGCCGG - Intronic
937862954 2:126725890-126725912 TTTAGCATTTTTTGGATGGCAGG - Intergenic
942340244 2:174936275-174936297 TTTCCCACTGTGTGGATAGCAGG + Intronic
942794525 2:179801651-179801673 TTTACAAATTTTTATATGGCAGG - Intronic
946812742 2:223543408-223543430 GTTATCACTTTTTAGATTGCTGG + Intergenic
948411577 2:237766629-237766651 TTGATCACTTTGTACATGGAAGG + Intronic
948914784 2:241028997-241029019 TTTGCCTCTGTGTAGAAGGCAGG + Intronic
1174854030 20:54025737-54025759 AGTACCACATTGTACATGGCTGG - Intronic
1176373435 21:6075936-6075958 GTTCCCACTCTGCAGATGGCTGG + Intergenic
1177432621 21:21010246-21010268 TTTACCTCTGTGTGGATTGCAGG + Intronic
1179750042 21:43462307-43462329 GTTCCCACTCTGCAGATGGCTGG - Intergenic
1182646025 22:31810116-31810138 TTTTTCAATTTGCAGATGGCGGG - Intronic
1184911605 22:47539011-47539033 TTTCCCTCTCTGCAGATGGCAGG + Intergenic
949416210 3:3817051-3817073 TTTTCCAGCTTATAGATGGCAGG - Intronic
950216230 3:11161676-11161698 CTTACCACTTTCAAGATGCCTGG - Intronic
950385394 3:12655008-12655030 TTTACTATTTTAGAGATGGCGGG - Intronic
951868805 3:27337047-27337069 TGTACCTCTTTGCAGATGACAGG + Intronic
953572179 3:44079780-44079802 TTTACCACTTTTTAGCTGTGTGG - Intergenic
956393712 3:68801960-68801982 TGTACCACACTGTAGATTGCTGG - Intronic
956721039 3:72117729-72117751 TTTCCCACTTGGTCGTTGGCTGG + Intergenic
958000216 3:87740623-87740645 CTTACCACGTTTTAGATGTCCGG + Intergenic
958014585 3:87924262-87924284 TTTACCAATTTGTTGATGCACGG + Intergenic
960903072 3:122571431-122571453 ATTAATACTTTGTAGTTGGCAGG + Intronic
962787027 3:138778126-138778148 TTCACTACCTTGTAGAAGGCTGG + Intronic
963592423 3:147278767-147278789 TTTTCCACTTTATAGCTGGCAGG - Intergenic
965606194 3:170499750-170499772 TTTTCCACTCTATAGAGGGCAGG - Intronic
966459343 3:180158569-180158591 TTCTCCACTTTGCAGATGACAGG - Intergenic
966875432 3:184319187-184319209 TTTGCCCCTTTGTAAAGGGCTGG + Intronic
974477168 4:62398241-62398263 TTTACCTCTTTTTAGAGGGATGG + Intergenic
977799866 4:101214378-101214400 TTGACCACTTAGTACATGTCAGG - Intronic
977867495 4:102047069-102047091 TTTGCCATTGTGAAGATGGCTGG + Intronic
978003315 4:103584240-103584262 TTTAGCATTTTGTATAGGGCAGG + Intergenic
978955855 4:114612391-114612413 TGAACTACATTGTAGATGGCAGG + Intronic
980171935 4:129299916-129299938 TTTACCTCTGTGTGGAAGGCAGG - Intergenic
981185733 4:141800476-141800498 TTTACAACTTTGGAGATTACTGG - Intergenic
986089780 5:4492979-4493001 TTTATCATTTTGCAGATGACGGG + Intergenic
986248507 5:6032841-6032863 TTTACCACTTTCTAGCAAGCTGG + Intergenic
992009629 5:72513526-72513548 TGTTACACTTTGTAGATTGCTGG + Intergenic
992925885 5:81586742-81586764 TTTATCATTTTGTGAATGGCAGG - Intronic
993898451 5:93567944-93567966 TATAACACTTTGTAGTTGGATGG - Intergenic
994798857 5:104344075-104344097 TTTCTCACCTTGTAGATGTCAGG + Intergenic
994978675 5:106844002-106844024 TATACCACTCTGTAGAGAGCTGG + Intergenic
999430400 5:151520841-151520863 TTGACCACTTTCTATATGTCAGG + Intronic
999698730 5:154208590-154208612 TGTACCACTTTTTAAATGCCGGG - Intronic
1001086824 5:168706686-168706708 TTTAAGACTTTGGAGGTGGCTGG + Intronic
1003051088 6:2781994-2782016 TTTCCCACTTTGTCAATGCCAGG - Intronic
1005667219 6:28070236-28070258 TTAACAACTATGGAGATGGCAGG - Intergenic
1006873991 6:37279554-37279576 TTTATGACCTTGTAGTTGGCAGG - Exonic
1007642389 6:43352476-43352498 CTTACCACTTTGTATTTTGCAGG - Exonic
1007819011 6:44546456-44546478 TTTTCCATTTTGCAAATGGCAGG - Intergenic
1008706304 6:54164854-54164876 TTCACCAGTTAATAGATGGCTGG + Intronic
1011659830 6:89584871-89584893 CTTCCTAGTTTGTAGATGGCTGG + Intronic
1012799933 6:103813010-103813032 TTTACCACTTTGAAAATCCCAGG - Intergenic
1013125187 6:107176655-107176677 TTCAGCTCTTTGTGGATGGCAGG - Intronic
1014835809 6:126159196-126159218 TGTGCCACTTTGTGGATAGCTGG + Intergenic
1019115025 6:169752838-169752860 TTTGCTACTTTTTACATGGCAGG + Intronic
1022267832 7:28774923-28774945 TATACCACTTGGGAGATGGTGGG - Intronic
1023411697 7:39894547-39894569 TTGAACAGTCTGTAGATGGCTGG + Intergenic
1023589800 7:41769557-41769579 TTGACCACTTTTTAATTGGCTGG + Intergenic
1024097102 7:45990927-45990949 TCTACCACTTTGGAGAGGGGGGG + Intergenic
1024753561 7:52500534-52500556 TTAACCACTTTGAATATGCCAGG + Intergenic
1027772171 7:82420372-82420394 TTTTGCATTTTGTAGATGCCAGG - Intronic
1028106530 7:86885647-86885669 TTTACCACTCTGTTGGTTGCAGG + Intronic
1030696997 7:112596365-112596387 TTAACCACTTTTTAGTTGACAGG + Intergenic
1034543293 7:151773445-151773467 TTTACCACTTGGTAGCTGTGTGG + Intronic
1036487993 8:9196931-9196953 TTTAGAACTTTGAAGGTGGCAGG + Intergenic
1037921557 8:22809910-22809932 TTTCCCACTGGGTAGAAGGCTGG - Intronic
1041657788 8:60371106-60371128 TTTCCAACTTTGAAGATGGAAGG + Intergenic
1044546281 8:93463888-93463910 TTTACAACTTTACAAATGGCTGG + Intergenic
1045184343 8:99821371-99821393 CTTTCCACTTTGGAGATGTCAGG - Exonic
1048855938 8:138686596-138686618 TTTACCACTTTGCAGAGCCCTGG + Intronic
1050694079 9:8259977-8259999 TTTACAACTTTACAGCTGGCTGG + Intergenic
1050851719 9:10295876-10295898 TTTGCTACTTTGAAGATGGAAGG + Intronic
1053107424 9:35423493-35423515 TTTACCTCTTTTTTCATGGCTGG - Intergenic
1054707063 9:68473472-68473494 TTTACCACTTAGTAGCTGTGTGG + Intronic
1057504560 9:95622344-95622366 TTTACCATTTTGAAGATCCCAGG + Intergenic
1060319753 9:122546636-122546658 TTTACCACAATATAAATGGCAGG + Intergenic
1186127755 X:6432316-6432338 TTTACCATTGTGGAAATGGCCGG - Intergenic
1189276208 X:39787811-39787833 TTCACCACCATGTAGAAGGCTGG - Intergenic
1189330001 X:40138517-40138539 TTAAGCACTTTCTAGATGCCAGG + Intronic
1189577009 X:42364763-42364785 TTTACAAGTTTGTATTTGGCTGG - Intergenic
1189973486 X:46440388-46440410 TTCACCACCATGTAGAAGGCTGG - Intergenic
1191925143 X:66300904-66300926 TATACTAGTTTGTAGATGGATGG + Intergenic
1194694811 X:97033078-97033100 GCAACCTCTTTGTAGATGGCTGG - Intronic
1195444381 X:104934929-104934951 TTTACCACTTAGTAGTTGTGTGG + Intronic
1198414898 X:136410049-136410071 TTTAGCAATTAGTATATGGCAGG - Intronic
1199271359 X:145886472-145886494 TTTAGTACTTTCTACATGGCAGG + Intergenic
1199778386 X:151035780-151035802 TCTACTACTATGTAGAAGGCAGG + Intergenic
1199999149 X:153048263-153048285 TTTCACACTTTATAGATGTCAGG - Intergenic