ID: 1141383415

View in Genome Browser
Species Human (GRCh38)
Location 16:83596692-83596714
Sequence GTAGGTCAGAGGCAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 283}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141383415 Original CRISPR GTAGGTCAGAGGCAAGTGGA AGG Intronic
900379195 1:2375448-2375470 GCAGATCAGGGACAAGTGGATGG + Intronic
901324369 1:8358152-8358174 GTGGGACAGAGGCACGGGGAGGG - Intronic
901490966 1:9596013-9596035 GTGGGTCACAGGCAGGCGGACGG + Intronic
902391606 1:16110349-16110371 GGAGCTCAGAGCCAAGTGGAGGG + Intergenic
902454590 1:16523352-16523374 GCAGGTCAGAGGGAAGGGGAGGG + Intergenic
902497867 1:16887001-16887023 GCAGGTCAGAGGGAAGGGGAGGG - Intronic
902500537 1:16908179-16908201 GCAGGTCACAGGGAAGGGGAGGG - Intronic
902664417 1:17927541-17927563 GTAGGGCAGAGGCCAGGGGTTGG + Intergenic
903369647 1:22826956-22826978 GGAGGTCAAAGGCAGGGGGAGGG - Intronic
904389476 1:30172499-30172521 CTAGATCAGAGGAAAGTGGATGG + Intergenic
904581433 1:31546987-31547009 GTGAGTCAGAGGGAAGTGTAAGG + Intergenic
906537220 1:46558115-46558137 GGAGGACAGAGGAAGGTGGAAGG + Exonic
907326910 1:53644208-53644230 CTGGGGCAGAGCCAAGTGGAGGG - Intronic
907461507 1:54608248-54608270 GTAAGTCAGAGGCCACTGCATGG + Intronic
907937537 1:59056257-59056279 GTAAGTGAGAGGCAAGTACAGGG + Intergenic
908735976 1:67277430-67277452 GGGGGTCAGGGGCAAGGGGAGGG + Intergenic
910855876 1:91694737-91694759 ATCCGTCAGAGGCAAGTGGCAGG - Intronic
911179687 1:94849406-94849428 GTCGGCCACAGGCAGGTGGAAGG - Intronic
912129823 1:106587400-106587422 GTAGGGAAGAGGTATGTGGATGG - Intergenic
914006739 1:143738684-143738706 GCAGGTCACAGGGAAGGGGAGGG + Intergenic
914095751 1:144543261-144543283 GCAGGTCACAGGGAAGGGGAGGG + Intergenic
914302769 1:146390708-146390730 GCAGGTCACAGGGAAGGGGAGGG - Intergenic
914517044 1:148382976-148382998 GCAGGTCACAGGGAAGGGGAGGG + Intergenic
914645563 1:149649169-149649191 GCAGGTCACAGGGAAGGGGAGGG + Intergenic
914705079 1:150163572-150163594 CTAGGTCAGAGGCAACGGGTTGG - Intronic
915170461 1:153973713-153973735 GGAGGTGAGAGGCAAGGGCAGGG + Exonic
915513583 1:156400366-156400388 GCAGGGCAGAGGCAGGAGGAGGG + Intergenic
915524698 1:156468426-156468448 GTTGGGGAGAGGCAATTGGATGG + Intronic
915734906 1:158078523-158078545 GCAGCTGAGAGGAAAGTGGAAGG - Intronic
915776561 1:158494940-158494962 GTAGAACAGAGGCAAATGTAAGG + Intergenic
916027763 1:160849442-160849464 GTGGGTGAGGGGCAAGGGGAGGG - Intronic
917242278 1:172961373-172961395 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
919268150 1:195300951-195300973 GTAGATCAGAGGAAAGTTCAAGG + Intergenic
922569490 1:226625588-226625610 GTAGGCCAGAAGCATGGGGATGG - Intergenic
922990805 1:229909545-229909567 GCAAGACAGAGGCCAGTGGAGGG + Intergenic
923047395 1:230365561-230365583 GTAGGTCATCTGCAGGTGGAAGG - Intronic
924306147 1:242691083-242691105 GAAGATAAGAGCCAAGTGGAGGG - Intergenic
1063011032 10:2021640-2021662 GTAGGTCTGAGGCTGGTGGTTGG - Intergenic
1064218188 10:13417816-13417838 GTCGGACAGAGGCCTGTGGATGG + Intergenic
1064264018 10:13809856-13809878 CTTGGTGAGATGCAAGTGGAAGG - Intronic
1066246300 10:33586308-33586330 GCAGGTCAGAAGCACGTGTATGG - Intergenic
1066707143 10:38192812-38192834 GGGGGTCAGAGGCAAGGGGAGGG + Intergenic
1067457786 10:46434595-46434617 GTAGGTCAAAAGTAAGAGGATGG - Intergenic
1067629413 10:47950032-47950054 GTAGGTCAAAAGTAAGAGGATGG + Intergenic
1068173010 10:53421046-53421068 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
1068195973 10:53716686-53716708 TTAGGTCAGAGCCAAGAGCATGG - Intergenic
1068447288 10:57139252-57139274 GTGGGGAAGAGGCATGTGGATGG + Intergenic
1072119051 10:92390152-92390174 GTAGCTCAAAGTCAAGAGGAGGG + Intergenic
1072672908 10:97444421-97444443 GTAGGTAAGAGTCAGGTGGGTGG - Intronic
1072901133 10:99407952-99407974 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1073794899 10:106976685-106976707 GGGGGTGAGAGGCAAGGGGAAGG - Intronic
1074551327 10:114445069-114445091 GGAGGTCAGAGGGGTGTGGAAGG - Intronic
1076481195 10:130786389-130786411 GCAGGTGGGAAGCAAGTGGATGG - Intergenic
1076581797 10:131516995-131517017 GCAGGTCAGTGGCAATGGGAAGG - Intergenic
1076990071 11:268161-268183 GAAGGGCTGAGGCAAGAGGAGGG - Intergenic
1077126862 11:943601-943623 GTAGGTTGGAGGTGAGTGGAAGG + Intronic
1078056116 11:8010271-8010293 ATAGGGGAGATGCAAGTGGATGG - Intergenic
1078401246 11:11029268-11029290 GTGACTCAGAGGAAAGTGGAGGG + Intergenic
1078466324 11:11553155-11553177 GTAGGTCGGAGTCACCTGGAGGG - Intronic
1078568717 11:12439354-12439376 GAAGGTCAGTGGCAAATGAAGGG - Intronic
1079129997 11:17741713-17741735 TCAGGTCAGAGGAAACTGGAGGG - Intronic
1079905007 11:26233942-26233964 GTAGGTAGGGGGCAAGGGGAGGG + Intergenic
1080183483 11:29451493-29451515 GAAGGTGAGAGGCAAGTGAAGGG + Intergenic
1080472456 11:32559408-32559430 GAAGGTCAAAGGCAATTGCAGGG + Intergenic
1080958012 11:37124054-37124076 TGAGGTGAGAGGCAAGTGGGTGG + Intergenic
1081977677 11:47246037-47246059 GAAGGCCAGAGGCCAGAGGAGGG - Intronic
1082100616 11:48170020-48170042 GTTGGTCAGAGGCAAGAGGAGGG + Intronic
1082774940 11:57237505-57237527 GGTGGCCAGAGGAAAGTGGAGGG - Intergenic
1083848183 11:65348822-65348844 GTAGGCAAGAGGGAAGAGGATGG - Intronic
1084570579 11:69957198-69957220 GTTTGTCAGAGGCAGGGGGAGGG - Intergenic
1087211006 11:95446536-95446558 GAAGTTCACAGACAAGTGGAGGG + Intergenic
1087679229 11:101200557-101200579 GTACGTCAGAGTCACCTGGAAGG - Intergenic
1090092676 11:123712616-123712638 GGGGGTCGGGGGCAAGTGGAGGG - Intergenic
1090362694 11:126184561-126184583 GCAGGGCAGAGGCACCTGGATGG - Intergenic
1092286779 12:7133177-7133199 GTAGGACAGAGAAAAGTGGGTGG + Intronic
1093839347 12:23876993-23877015 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
1096446881 12:51701315-51701337 ATAGGTCAGATGCAATTGTAAGG - Intronic
1097169102 12:57102566-57102588 GTAGGCCACAGGCAGGTGGGAGG - Intronic
1098241528 12:68472329-68472351 GTAGGGGACAGACAAGTGGATGG + Intergenic
1099954947 12:89344683-89344705 GTGGGTCAGGGGAAAGGGGAAGG - Intergenic
1101516365 12:105439317-105439339 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
1101587478 12:106097757-106097779 GTACATCAGAGACACGTGGAGGG + Intronic
1102179480 12:110901575-110901597 GAAGGTCAGTGGCAGGTGGGAGG - Intronic
1102671140 12:114620096-114620118 GGAGGTCGGGGGCAAGGGGAGGG - Intergenic
1107749301 13:43547117-43547139 CCAGTTCAGAGGCAAGAGGATGG - Intronic
1109438636 13:62340002-62340024 GTAAGTTTGAGGAAAGTGGAAGG - Intergenic
1109438643 13:62340040-62340062 GTAGGTCAGAGGCAACATAAGGG - Intergenic
1111378837 13:87419050-87419072 ATAGGTCAGAGATAAGTGGATGG - Intergenic
1111893728 13:94115324-94115346 TTATGTCAGAGGCAAGGGGTTGG + Intronic
1112356462 13:98678022-98678044 ACAGGACACAGGCAAGTGGAAGG + Intergenic
1112363429 13:98737806-98737828 ATAGGTCAGAAGAATGTGGAGGG + Intronic
1113916208 13:113875523-113875545 GTTGGTCGGAAGCAACTGGAAGG + Intergenic
1115356907 14:32457856-32457878 GGAGGTCTCAGGCAAGTGAATGG - Intronic
1115358435 14:32474427-32474449 GTGGGTCAAAGGCAATTGAATGG + Intronic
1120835449 14:89035137-89035159 TGAGGTCAGAGGAAGGTGGAGGG - Intergenic
1122009435 14:98733720-98733742 GAAGGTCAGAGGGTAGGGGAAGG - Intergenic
1123229207 15:17083182-17083204 GTAGATCAGAGTGCAGTGGAAGG + Intergenic
1123799889 15:23808721-23808743 GCCGGTAGGAGGCAAGTGGAGGG + Intergenic
1127751946 15:62054571-62054593 GGAGGTGGGAGGCAAGGGGAGGG + Intronic
1129552279 15:76465892-76465914 GTAGGCCAGAAGGGAGTGGAGGG - Intronic
1130868348 15:87951070-87951092 GTTGCTCAGAGGACAGTGGATGG - Intronic
1132902297 16:2263814-2263836 GGAGGGCTGAGGCAAGAGGATGG - Intronic
1134277648 16:12791206-12791228 GGAGGTCGGGGGCAAGGGGAGGG - Intronic
1135304867 16:21359587-21359609 CTCGGTCAGAGGCTTGTGGATGG - Intergenic
1135578301 16:23603548-23603570 GTTGGTCAGAGACAGGTGGGAGG + Exonic
1136301616 16:29338779-29338801 CTCGGTCAGAGGCTTGTGGATGG - Intergenic
1138113933 16:54345373-54345395 TCAGGGCAGAGGAAAGTGGAAGG + Intergenic
1140232016 16:73125035-73125057 GTAGATCTGGGGCAAATGGAAGG + Intergenic
1141326430 16:83063918-83063940 GTTGGGGAGAGGCAAGTGGAAGG + Intronic
1141357793 16:83364912-83364934 GTAGGTAAGCGGCAAAAGGAGGG + Intronic
1141383415 16:83596692-83596714 GTAGGTCAGAGGCAAGTGGAAGG + Intronic
1141646401 16:85370256-85370278 GTTGCTCAGAGGCTAGGGGAGGG - Intergenic
1142063305 16:88045338-88045360 CTCGGTCAGAGGCTTGTGGATGG - Intronic
1142080108 16:88144394-88144416 GTAGGGCAGAGATAAGGGGATGG + Intergenic
1142415575 16:89939275-89939297 GTGGGTCTGGGGCCAGTGGAAGG + Intergenic
1142887337 17:2920935-2920957 GGACTTCAGAGGCCAGTGGATGG + Intronic
1144584039 17:16477326-16477348 CTAGGTCAGAGGCAAGGCCAAGG + Intronic
1145011779 17:19372409-19372431 GAAGGCCAGAGGGAAGTGGCAGG - Intronic
1146624814 17:34427140-34427162 GTAGGTCATTGGCAGGTGGGTGG + Intergenic
1147662308 17:42123225-42123247 GTGGGTCAGAGGCCAGTGTGTGG + Exonic
1151462740 17:74264360-74264382 GGAGGTCAGAGGCATGGAGATGG + Intergenic
1152167947 17:78723194-78723216 GTGGGTAAGAGGCTGGTGGATGG - Intronic
1152305424 17:79517664-79517686 GTGGGTGAGAGGCCAGTGGTGGG - Intergenic
1152366721 17:79860654-79860676 GGAGGTCAGAGCCAACAGGACGG - Intergenic
1152475258 17:80513752-80513774 GGAGGCCTGGGGCAAGTGGACGG + Intergenic
1152535100 17:80946025-80946047 GCAGGTCAGAGGGGAGTGGCAGG + Intronic
1153239231 18:3015522-3015544 GTGGGTCAGAGGCCAGTTGAAGG - Intergenic
1153284525 18:3445904-3445926 GAAGGTCAGATGGATGTGGAGGG - Intronic
1153489623 18:5633457-5633479 GGAGGTCAGAGGCAATTTGGAGG - Intergenic
1155071680 18:22322219-22322241 TCAGGTCAGAGGGAAGGGGAGGG + Intergenic
1157829055 18:50839971-50839993 GCAGGTCAGAGGCGAGTGTTAGG - Intergenic
1159435073 18:68405888-68405910 CTAGGTCAGACCAAAGTGGAAGG - Intergenic
1162032748 19:7924586-7924608 GGGGGTCAGGGGCAAGTGGCAGG + Exonic
1162487288 19:10968970-10968992 GAAGGGCAGAGTCAAGAGGAAGG - Intronic
1164048629 19:21564698-21564720 GGAGGGCAATGGCAAGTGGAGGG - Intergenic
1165052933 19:33154365-33154387 GGGGGTGGGAGGCAAGTGGAGGG - Intronic
1167640285 19:50678003-50678025 GTAGAGAAGTGGCAAGTGGAAGG + Intronic
928239981 2:29577907-29577929 TTAGGTCAGGGGAAAGTTGAGGG + Intronic
928460301 2:31466175-31466197 GTAGGTCAGAGGTAAGTTTTTGG + Intergenic
929470237 2:42184503-42184525 GTAGGTGAGAGCCAGGTGGCAGG - Intronic
929784557 2:44979930-44979952 GTAGCTGAGAGGCAGGGGGATGG - Intergenic
930600114 2:53432945-53432967 GTAGGACGGAAGGAAGTGGAAGG - Intergenic
931255993 2:60573446-60573468 GTGGGTCAGAGTCCAGGGGAGGG + Intergenic
932176470 2:69607355-69607377 GTAAGGCAGAGGTAAGAGGAGGG + Intronic
932626419 2:73299828-73299850 GAGGGTCAGAGGTAGGTGGACGG + Intergenic
932986828 2:76736379-76736401 GCAGGTCTGGGGCCAGTGGATGG - Intergenic
933221400 2:79693701-79693723 AAAGGTCAGGGGCAAGTGGTGGG + Intronic
933781407 2:85804440-85804462 GGAGGTCAGTGGCAAGTGGGAGG + Intergenic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934674104 2:96237415-96237437 CTGGGACAGAGGCATGTGGATGG + Intergenic
934856073 2:97731225-97731247 GGAAGTCAGAGGCAGGTGGCAGG - Intronic
935678337 2:105615500-105615522 CAAGGTCAGACGGAAGTGGAAGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937059706 2:118971857-118971879 GTAGGTAAGAGTCACCTGGAAGG - Intronic
938189744 2:129265728-129265750 ATAGTTCAGAGGCAACTGGATGG + Intergenic
938954321 2:136284149-136284171 GCAGCTCAGAGGAAAGTGGGTGG - Intergenic
940442062 2:153727886-153727908 GTGGGTAAGGGGAAAGTGGAGGG - Intergenic
940551853 2:155169208-155169230 AGAGGTCAGAGGCATGGGGATGG - Intergenic
943147142 2:184060268-184060290 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
943501831 2:188699532-188699554 GGAGGTCAGGGGCTAGGGGAGGG + Intergenic
944656985 2:201885385-201885407 GTAGCACAGAGTCAAGAGGATGG - Intronic
945445283 2:209930676-209930698 GTAGGTCACAGGCAAGTCACAGG - Intronic
946129381 2:217594012-217594034 AGAGGTCTGAGGGAAGTGGAGGG + Intronic
947143029 2:227037226-227037248 GTGGGTGAGAGGCTAGGGGAGGG - Intronic
947273643 2:228367662-228367684 GTAGATCAGAGGCAAGGGGCAGG + Intergenic
947341621 2:229146327-229146349 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
947810198 2:232999360-232999382 CTGGGTCAGAGACAAGGGGAGGG - Intronic
948455668 2:238103585-238103607 GTGGGTCGGGGGCAACTGGAGGG - Intronic
948741449 2:240049133-240049155 GAAGGGCAGAGGCAACTGGCTGG + Intergenic
1170134182 20:13055010-13055032 CTAGGAAAGAGGCAGGTGGAAGG + Intronic
1171054571 20:21893854-21893876 GTGGGGGAGAGGAAAGTGGAAGG - Intergenic
1171176362 20:23052935-23052957 GAAAGTCAAAGGCAAGTGCATGG - Intergenic
1172047664 20:32092078-32092100 CAAGGTCTGAGGCAAGTGGGTGG - Intronic
1172588728 20:36102874-36102896 GTGGGTCAGTGCCAAGGGGAGGG + Intronic
1175639796 20:60619494-60619516 GTAGATCAGAAGCCACTGGAAGG + Intergenic
1176187170 20:63787070-63787092 GTGGGGTAGAGGCAAGAGGAAGG + Intronic
1178491352 21:33054348-33054370 GTAGGACAGAGGAAAATAGATGG + Intergenic
1178816549 21:35935256-35935278 GTAGTTCATAGTCCAGTGGAGGG - Intronic
1179921946 21:44512258-44512280 GGAGGTCAGATGTATGTGGACGG + Intronic
1180839487 22:18952493-18952515 GAAGCCCAGAGGCAGGTGGATGG + Intergenic
1181062415 22:20287986-20288008 GAAGCCCAGAGGCAGGTGGACGG - Intergenic
1181431585 22:22884857-22884879 GCAGGGCAGAAGCAACTGGATGG + Intronic
1182774223 22:32819038-32819060 GTGAGCCAGAGGAAAGTGGAGGG + Intronic
1182920057 22:34071020-34071042 GTAGGGCAAAGGGAAGAGGAAGG - Intergenic
1183759935 22:39806867-39806889 GGAGGACGGAGGCAAGGGGAGGG + Intronic
1185417109 22:50716280-50716302 GTAGGGGAGAGGCAAGTTCAGGG - Intergenic
949142767 3:654757-654779 GTAGGTGAGGGGCTAGGGGAGGG + Intergenic
951233066 3:20201822-20201844 GGAGGTCATTGGCAAGTGTAAGG + Intergenic
952355301 3:32578516-32578538 CTAGGTGAGAAGCAAGAGGAAGG - Intergenic
953150618 3:40320903-40320925 GTAAGGCAGAGGCAAGAAGATGG + Intergenic
955153667 3:56393989-56394011 CCAGGTCAGAGGCCACTGGATGG - Intronic
955389164 3:58507291-58507313 GTTGTTCACAGTCAAGTGGAAGG + Intronic
956570666 3:70690888-70690910 GTGGGTGAGGGGCAAGGGGAGGG - Intergenic
958516170 3:95118865-95118887 GTAGGTTAGAAGTAAATGGATGG - Intergenic
958559919 3:95734464-95734486 GTAGGGGAGATGCAAGAGGATGG - Intergenic
960997310 3:123348654-123348676 GTGGGAGAGAAGCAAGTGGAGGG + Intronic
964990307 3:162802601-162802623 ATAGAGAAGAGGCAAGTGGATGG + Intergenic
965443395 3:168744952-168744974 GAAGGTAGGAGCCAAGTGGAGGG + Intergenic
967408275 3:189141325-189141347 GGAGGTCAGGGGAAAATGGAGGG + Intronic
968057750 3:195705643-195705665 GAAGGTCAAAGTCAAGTAGACGG + Intergenic
968161238 3:196428930-196428952 GGAGGGCTGAGGCAAGAGGATGG + Intronic
968754017 4:2405592-2405614 CTAGGTCAGAGGGAAGGGGCCGG + Intronic
969071461 4:4542416-4542438 GCAGGATAGAGGCACGTGGACGG + Intergenic
969273844 4:6121417-6121439 GAAGGTGAGAGGGAAGTTGAAGG - Intronic
969510753 4:7616465-7616487 GTAGCTCAGGGGCTAGAGGATGG - Intronic
971417949 4:26450806-26450828 GAGGGTCAGAGGCAAGGGGAGGG + Intergenic
971438821 4:26657226-26657248 GGGGGTCAGAGGCAAGGGGAGGG - Intronic
972099889 4:35401653-35401675 GGAAGTCAGGGGCAAGGGGAAGG + Intergenic
972761850 4:42114186-42114208 GTAGGTCAGGAGCCTGTGGAGGG - Exonic
972895574 4:43615893-43615915 GCAGGGCAGTGGCAAGTCGATGG - Intergenic
973701571 4:53542587-53542609 AGAGGACAGAGGCAAGAGGAGGG + Intronic
974533504 4:63144530-63144552 GAGGGTGAGAGGCAAGAGGAGGG - Intergenic
975983963 4:80186333-80186355 GTAGGTAAGTGGAAAGAGGAAGG - Intronic
976497753 4:85750026-85750048 GTACGTGAGGGGCAGGTGGATGG - Intronic
979921204 4:126498718-126498740 GTGGGTCAGGGGGAAGGGGAGGG + Intergenic
981672475 4:147302576-147302598 GTAGGCTAGAGTCAAATGGAAGG + Intergenic
981752675 4:148107846-148107868 GGAGGTCAGGGACAAGGGGAGGG + Intronic
983991680 4:174127655-174127677 GTGGGTTACAGGAAAGTGGAAGG - Intergenic
985472155 5:53234-53256 CGAGGTCTGAGGCAGGTGGACGG - Intergenic
986613395 5:9592142-9592164 GCAGGTGGGAGGCAAGGGGAGGG + Intergenic
986811002 5:11359788-11359810 GTAGGTCTGGGGCAGGAGGATGG + Intronic
987080610 5:14422039-14422061 GACGGGCAGAGGCATGTGGATGG - Intronic
987092615 5:14521679-14521701 GTAGGGGAGAGGCAAGACGATGG - Intronic
987553677 5:19416842-19416864 GTGGGTGAGAGGCTAGGGGAGGG + Intergenic
990630545 5:57664120-57664142 GGGGGTGAGAGGCAAGGGGAGGG - Intergenic
992001379 5:72439626-72439648 GGATGTCACAGGCAAGTGGGAGG - Intergenic
992266211 5:75020607-75020629 TGAGGTCTGAGGCAAGTGGGTGG - Intergenic
992641266 5:78770347-78770369 GCAGGTCAAAGGCAAGGGAAGGG + Intergenic
992799507 5:80282798-80282820 ACAGGTAAGAGGGAAGTGGATGG - Intergenic
994595709 5:101831850-101831872 GTGGGTGGGAGGCAAGGGGAGGG - Intergenic
999185433 5:149703861-149703883 GGAGCTCAGAGGAAAGTTGAGGG - Intergenic
999286949 5:150399832-150399854 GGAGGTCAGAGGCATGGGGATGG - Exonic
999576029 5:152978407-152978429 TTAGATCAAAGGCAAGTGGCTGG - Intergenic
1000809981 5:165849251-165849273 GTAGGACAATGGCAAGTGGGCGG - Intergenic
1001240867 5:170069013-170069035 TGAGGTCACAGGCATGTGGATGG - Intronic
1001253255 5:170164956-170164978 GTAGGTAAGAGTCAAGGGGCTGG - Intergenic
1001576255 5:172765891-172765913 TTAGGACAGAGACAAGGGGATGG + Intergenic
1003036651 6:2645720-2645742 GCAAATCAGAGGCAAGAGGAGGG + Intergenic
1004054043 6:12116518-12116540 GGAGGGGAGAGGCTAGTGGAGGG - Intronic
1005560586 6:27036286-27036308 GGGGGTCAGGGGCAAGGGGAGGG - Intergenic
1005817765 6:29570118-29570140 CAAGGAAAGAGGCAAGTGGAAGG + Intronic
1008617391 6:53239835-53239857 GTAGGTCAGGGCCAGTTGGAGGG - Intergenic
1012092321 6:94914652-94914674 GAGGGTCAGAGGAAAGTAGACGG - Intergenic
1012127762 6:95452917-95452939 GAGGGTGAGAGGCAAGGGGAGGG - Intergenic
1012969415 6:105711665-105711687 TTAGGTGAGACGCTAGTGGAGGG - Intergenic
1016784135 6:147991339-147991361 GGAGGTTGGAGGCAAGGGGAGGG + Intergenic
1017191709 6:151661339-151661361 CCAGATGAGAGGCAAGTGGAGGG + Intronic
1018177153 6:161186914-161186936 GGAGGTGAGGGGCAAGTGGGTGG - Intronic
1019685088 7:2377406-2377428 TTAGGTCAGAGCAAAGAGGAGGG + Intronic
1023099656 7:36703535-36703557 GTGGGTGGGAGGCAAGGGGAGGG - Intronic
1023294721 7:38702687-38702709 GCAGGAAAGAGGCAAGTAGAGGG - Intergenic
1023835828 7:44066593-44066615 GTAGGTGAGAGGCCAGCAGAGGG + Intronic
1023932109 7:44712374-44712396 GTAGGTCAGAGGGGTGTGTAGGG + Intergenic
1025115941 7:56258130-56258152 GTAGGTAAGAGACAAATGGTTGG + Intergenic
1026047551 7:66917662-66917684 GTGGGTAAGAGGCAATTGGGAGG - Intergenic
1026542781 7:71295343-71295365 TTAGGTAAGAGGCAAGCTGAGGG - Intronic
1027595546 7:80169218-80169240 AGAGAGCAGAGGCAAGTGGATGG - Intronic
1031390089 7:121203268-121203290 ATAGGTCTGAGGAAAGTGGAGGG - Intronic
1032768421 7:135023409-135023431 CTAGGGAAGAGGCAAGTGAAGGG + Intronic
1033416073 7:141162253-141162275 CAAGGTGAGAGGCAAGTGGCTGG - Intronic
1034431483 7:151043399-151043421 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431558 7:151043710-151043732 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431570 7:151043748-151043770 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1034431595 7:151043825-151043847 GGGGGTCAGAGGCAGGAGGAGGG + Intronic
1035287751 7:157816977-157816999 GGAGGCCAGAGGCATGTGGTCGG - Intronic
1036080368 8:5548830-5548852 AAAGGTCAGAGGCAGCTGGAAGG - Intergenic
1036755627 8:11468931-11468953 GTGGGCCAGAGGAAAGAGGAAGG + Intronic
1037110336 8:15158024-15158046 GGTGGTGAGAGGCAAGTGCATGG - Intronic
1039442291 8:37603394-37603416 GTCGTCCAGAGCCAAGTGGATGG + Intergenic
1041500170 8:58531684-58531706 GTGGGTGAGGGGCAAGGGGAGGG + Intergenic
1041955730 8:63556572-63556594 GTAGGACAGGGGCATGTGGAAGG + Intergenic
1043543221 8:81286627-81286649 GGAAGTAAGAGGCCAGTGGAGGG - Intergenic
1047105086 8:121723415-121723437 GTTGGTCAGAAGCAAGTTGCAGG + Intergenic
1047224772 8:122947014-122947036 GGGAGACAGAGGCAAGTGGATGG + Intronic
1047312937 8:123707695-123707717 GGGGGTCAGGGGCAAGGGGAGGG + Intronic
1047733629 8:127747005-127747027 GGAGGTCAGAGGATACTGGAAGG - Intergenic
1048650208 8:136467708-136467730 CTGGGGCAGAGGCAAGAGGAAGG + Intergenic
1049042058 8:140119893-140119915 GTAGGTTAGAGGGAGATGGAGGG - Intronic
1049103483 8:140596797-140596819 GCAGGGGAGAGGCAAGTGGCCGG + Intronic
1050351081 9:4741477-4741499 GTAGATCTGAGCCGAGTGGAGGG - Intronic
1053860926 9:42385707-42385729 CGAGGTGAGAGGCCAGTGGAGGG - Intergenic
1054745687 9:68852062-68852084 GCAGGTGAGGGGCAAGGGGAGGG + Intronic
1054990535 9:71320452-71320474 GTTGGTCAGAGACAAGAGAAGGG + Intronic
1056846162 9:90039944-90039966 GTAGGACAGGGGTCAGTGGATGG + Intergenic
1056870473 9:90272788-90272810 GGATGTGAGAGGAAAGTGGAGGG + Intergenic
1058132110 9:101264924-101264946 GTAGGACAGAGGCAAGAGTTTGG - Intronic
1059737529 9:117117248-117117270 CTAGCTCAGATCCAAGTGGAAGG + Intronic
1062550687 9:137085008-137085030 GTGGGTCACAGGCATGTGGTGGG + Intergenic
1192711105 X:73589925-73589947 GAAGGTCAGAGGCAGTGGGATGG - Intronic
1192933147 X:75829903-75829925 GGGGGTCAGGGGCAAGGGGAGGG - Intergenic
1195195817 X:102497217-102497239 GTAGGTGAGAGACAAATGGTTGG - Intergenic
1196402917 X:115334567-115334589 GTGGGGCCGAGGCAGGTGGATGG + Intergenic
1197865434 X:131011704-131011726 ATAGGTCATAGTCAAGTAGATGG - Intergenic
1199545411 X:149003328-149003350 GTACCTCAGAGGCAAGGGGTAGG - Intergenic
1199680165 X:150218729-150218751 GTAGGTGAGAGGGAAATGAAAGG + Intergenic
1200175495 X:154112663-154112685 GTAGATTAAAGGTAAGTGGATGG - Intergenic