ID: 1141384841

View in Genome Browser
Species Human (GRCh38)
Location 16:83611327-83611349
Sequence TGAAATTAAACCTTTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 257}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141384841 Original CRISPR TGAAATTAAACCTTTGGGGT AGG (reversed) Intronic
901081238 1:6585451-6585473 TGAACTGAAACCTGTGGGGGAGG + Intronic
902856157 1:19207331-19207353 ATAAATAAAACCTTTGGGCTGGG + Intronic
903428882 1:23276231-23276253 TGAAATTAAAAGTTTCTGGTTGG - Intergenic
903839565 1:26228694-26228716 TGAAATTCTACCTTATGGGTAGG - Intergenic
904540582 1:31230221-31230243 TGAAATAAAACGTGTGGAGTGGG - Intronic
906056291 1:42920368-42920390 TGAAATTAAACTGTTGTTGTTGG + Intergenic
906906922 1:49904884-49904906 TGAAATTACAGCTGTGGGGTTGG + Intronic
907488557 1:54794024-54794046 TGAATCTAAAACTCTGGGGTGGG + Intronic
907877196 1:58502837-58502859 TGAATTTAATCACTTGGGGTGGG + Intronic
908534170 1:65063506-65063528 TGAAATTAATCCATGGGGCTAGG + Intergenic
908807408 1:67945596-67945618 TGAAATGAAATCTTTAGGGTGGG + Intergenic
908911431 1:69075848-69075870 GGAGATTATACCTTTGGGCTTGG - Intergenic
909637053 1:77828324-77828346 TGAAATTGAAACTTTGGGGTTGG + Intronic
910095321 1:83515129-83515151 TAAAATGAAGCCATTGGGGTGGG - Intergenic
910453639 1:87372485-87372507 TGAAGTTAAAGATTGGGGGTGGG - Intergenic
910961068 1:92763634-92763656 TTAATTTAAACATTTGGGGCTGG + Intronic
911068890 1:93816376-93816398 AGAAATTAAAACTCTGGGCTGGG + Intronic
912635420 1:111287584-111287606 TGATATTAAAAATTTGGGGCTGG - Intergenic
912778030 1:112518669-112518691 TGAAAATACACCTTTAGGGAAGG + Intronic
914353360 1:146859852-146859874 TGAAAATAGACCTTTGGTATTGG - Intergenic
916344420 1:163771747-163771769 TGAAGTGAAAACTTAGGGGTGGG + Intergenic
916458341 1:164994241-164994263 TGAAATCAATCCATTTGGGTTGG + Intergenic
916881826 1:169026341-169026363 TCCAATTAAACATTTGGGGCAGG - Intergenic
917170025 1:172161925-172161947 TGAGATTTATCCGTTGGGGTTGG + Intronic
918618429 1:186575006-186575028 TAATATGAAACCTTTGGGCTGGG - Intergenic
918703056 1:187629821-187629843 TGGAAATAAGGCTTTGGGGTGGG + Intergenic
919089617 1:192962164-192962186 TGAAATCATAGCATTGGGGTGGG - Intergenic
920718728 1:208367215-208367237 TGAAATTAAACCTGGGGAGTAGG + Intergenic
923185018 1:231563421-231563443 TTAAAATAAACCTCTGAGGTAGG + Intronic
924235512 1:241996624-241996646 TGAAATTAAAGCTATTGGGCTGG + Intronic
1064141370 10:12793361-12793383 TGAAGTTACAGCCTTGGGGTGGG + Intronic
1066789924 10:39050893-39050915 TGAAAGGACACCTTTTGGGTAGG + Intergenic
1067722490 10:48739564-48739586 TGAAATTAAGCCTTTGTAATTGG + Intronic
1068372304 10:56132441-56132463 TGGAATTCAATCTGTGGGGTGGG + Intergenic
1070029955 10:72667267-72667289 TGAAATTTAATCTTTGGGCCAGG - Intergenic
1070206079 10:74263132-74263154 GGAAATCAAATATTTGGGGTGGG - Intronic
1073896789 10:108170321-108170343 TGAAATAAATGCTTTGGTGTTGG - Intergenic
1073921078 10:108460461-108460483 TGAAATTTAAAATTTGGGGTGGG - Intergenic
1074521813 10:114232413-114232435 AAAAATTCAAACTTTGGGGTTGG - Intergenic
1076273400 10:129175964-129175986 AGAAATTGAACATTTTGGGTGGG + Intergenic
1076511382 10:131016341-131016363 TGAACTTAAACTTTTGGTGATGG + Intergenic
1077727981 11:4695653-4695675 TGAGATTAAACTTTTGGACTTGG - Intronic
1078828325 11:14953093-14953115 TAAAATTAGACTATTGGGGTAGG - Intronic
1079303476 11:19300751-19300773 TGAAAATAAGGCCTTGGGGTAGG - Intergenic
1079328504 11:19514590-19514612 TGACATTTAACCTTAGGGGATGG + Intronic
1081500498 11:43662037-43662059 TGAAATTAAAATTTTAGGCTCGG + Intronic
1082761109 11:57127717-57127739 TGATATCAACCCTTTGAGGTAGG - Intergenic
1083367336 11:62149249-62149271 TGAAAAAAAACCATGGGGGTTGG - Intronic
1089670191 11:120051294-120051316 AAAAATTAAACCTTTTTGGTTGG - Intergenic
1090061254 11:123465978-123466000 TGAAAATAAAGATTTGGGCTGGG + Intergenic
1092998339 12:13972164-13972186 TCAATTTAACTCTTTGGGGTAGG + Intronic
1093676556 12:21946758-21946780 GGAAATTATAGCTTTGGGGAAGG - Intergenic
1093914515 12:24786509-24786531 TGAACTGAAATATTTGGGGTTGG - Intergenic
1100841650 12:98618987-98619009 TGAAATTAAACATTTATGATGGG - Intronic
1100968250 12:100037594-100037616 TGAAATTATAGCTCTGGAGTAGG - Exonic
1101538610 12:105643507-105643529 TGAAACTGAACCTATGGGGTGGG - Intergenic
1101951017 12:109175232-109175254 TAAAATTCAACTTTTGGGGGGGG - Intronic
1102810813 12:115822843-115822865 TGAACTTAAACCTGTGCAGTAGG + Intergenic
1102827307 12:115960099-115960121 TGAAGTTGAGCCTTTGTGGTGGG - Exonic
1103157930 12:118702910-118702932 TGAAAATAAATCTTTTGGTTGGG + Intergenic
1103826215 12:123741133-123741155 TGAAATTAGACTTTTGAGGCTGG + Intronic
1104829311 12:131738111-131738133 TGAAATTAAACCATTGCGCATGG + Intronic
1105523357 13:21151853-21151875 TGTAATTAACTCTTTGAGGTAGG - Intergenic
1105829789 13:24153832-24153854 TGGAATTCATCCCTTGGGGTTGG + Intronic
1106324839 13:28678983-28679005 TGGAGTTACAACTTTGGGGTTGG + Intergenic
1106519222 13:30482495-30482517 TCACATCAAGCCTTTGGGGTGGG + Intronic
1109207946 13:59502269-59502291 TAAAATGAAACCTATGGTGTTGG - Intergenic
1109402452 13:61852992-61853014 TGAAATAAAGCCATTAGGGTAGG + Intergenic
1109698755 13:65996895-65996917 TGAAATTAAAACTTCTAGGTGGG - Intergenic
1110356446 13:74573068-74573090 TCAAATTTTACCTTTGGGCTGGG + Intergenic
1110674556 13:78225314-78225336 TGAAATCAAACCATTTTGGTAGG - Intergenic
1110767593 13:79298744-79298766 TGAGATTGAACATGTGGGGTTGG - Intergenic
1110781687 13:79473403-79473425 TAAAATTAAGCTGTTGGGGTGGG + Intergenic
1110863786 13:80372514-80372536 TTAAATTAAACCATTGAAGTCGG + Intergenic
1112009866 13:95284845-95284867 TAATAACAAACCTTTGGGGTGGG - Intronic
1112423523 13:99275645-99275667 AGAAATAAAACCTGGGGGGTGGG - Intronic
1114613907 14:24058416-24058438 TGCCCTTAAAGCTTTGGGGTGGG + Intronic
1115660060 14:35485240-35485262 TAAAATTAAAACTTTGTAGTAGG - Intergenic
1116842409 14:49832664-49832686 AGAAAGTAAACCTTTGGATTAGG - Intronic
1118160544 14:63285342-63285364 TGAAAAGAAACCTTTAGGTTTGG + Intronic
1119259539 14:73229368-73229390 TGAAATAAAACTTTTGGTTTTGG - Intergenic
1119956544 14:78804246-78804268 GGAAATTAAACTTTGTGGGTAGG + Intronic
1124531613 15:30513131-30513153 TGATGTTAAATTTTTGGGGTGGG - Intergenic
1124767045 15:32494563-32494585 TGATGTTAAATTTTTGGGGTGGG + Intergenic
1124858947 15:33419064-33419086 TGCATTTAAGCCTTTGGGCTGGG + Intronic
1125066499 15:35492547-35492569 TGAAAATAATCCTTTGGGAAAGG - Intronic
1125174108 15:36800993-36801015 TGAAATAAAAAATTTGGGCTAGG + Intronic
1126508489 15:49437803-49437825 TGAAATTGACTCTTTGGTGTTGG - Intronic
1127002701 15:54528633-54528655 TCAAATTAGAGCATTGGGGTGGG - Intronic
1127122976 15:55786989-55787011 TGAAAGTTCACCTTTGGGGCTGG + Intergenic
1131630878 15:94175758-94175780 TAAAATGAGGCCTTTGGGGTAGG + Intergenic
1132712492 16:1275777-1275799 AGAAAATGAGCCTTTGGGGTGGG - Intergenic
1134769481 16:16794601-16794623 TGAAATGACACCTTCTGGGTTGG + Intergenic
1134839482 16:17390331-17390353 TGAAATTAATACTTCGGGGTGGG + Intronic
1134887862 16:17810038-17810060 TGAAATTACACTTCTGAGGTGGG + Intergenic
1135798194 16:25466323-25466345 TGATATAAAGCCTTTGGGGGTGG + Intergenic
1138808616 16:60122095-60122117 TGAGATAAAAACTTTGGGCTGGG + Intergenic
1139980663 16:70855666-70855688 TGAAAATAGACCTTTGGTATTGG + Intronic
1141384841 16:83611327-83611349 TGAAATTAAACCTTTGGGGTAGG - Intronic
1143134170 17:4701806-4701828 TTGAATGAAACCTTTGGGGAAGG + Intronic
1146403301 17:32517400-32517422 TGAAATGGAATCTTTGGGTTTGG + Intronic
1146708174 17:35017388-35017410 CGAAATTATATTTTTGGGGTAGG - Intronic
1147357043 17:39906304-39906326 AGAAATAAAACCTTTTGGGCTGG - Intronic
1148110384 17:45141390-45141412 TCACATTAAACATTTGGGCTGGG + Intronic
1151355277 17:73554393-73554415 TTAAATGAAGCCATTGGGGTGGG + Intronic
1155692049 18:28636447-28636469 TGAAAATAAACACCTGGGGTGGG + Intergenic
1158300409 18:56045943-56045965 TAAAATAAAAGCTTTGGGGCAGG + Intergenic
1158707566 18:59806744-59806766 TGAAATTAGTCCTTTGCTGTTGG + Intergenic
1158908266 18:62035011-62035033 GGTAATTAAACCATGGGGGTGGG + Intergenic
1159644172 18:70898002-70898024 TTAAATTAAACGTAGGGGGTGGG - Intergenic
1159984645 18:74827863-74827885 TAAAATTAACCCTGTGAGGTCGG - Intronic
1161371359 19:3913707-3913729 TGAAATGCAACCCATGGGGTGGG - Intronic
1161556312 19:4944630-4944652 TGCAATGAATCCTTGGGGGTGGG + Intronic
1162864273 19:13532340-13532362 TGAAAATAAACTTATGGAGTGGG + Intronic
1163576590 19:18114487-18114509 GGAAATTAAATCTCTGGGGTTGG - Intronic
1164658966 19:29946069-29946091 TTAAATAAAACCTTTGGGGGGGG - Intronic
1165296718 19:34933158-34933180 TAAAATAAAACCTTTCGGCTGGG + Intronic
1166967220 19:46536365-46536387 TGAAAATAAACCTTTAGGCTTGG - Intronic
926502596 2:13674344-13674366 GGTAATTAAATCTTGGGGGTGGG - Intergenic
927388812 2:22569195-22569217 TGAAATAAAGCTTTTGGGGTGGG + Intergenic
927996578 2:27491289-27491311 TGAAAATAAAACTGAGGGGTTGG - Intergenic
928219927 2:29395213-29395235 TGAAATGGAGCCTTTGGGCTTGG - Intronic
928258809 2:29748623-29748645 TGAATCAAAACCTTTGAGGTTGG - Intronic
928828379 2:35447774-35447796 TGAAATTAATACTTTGGGGAAGG + Intergenic
929639806 2:43566467-43566489 TGAAAATTATACTTTGGGGTTGG + Intronic
931934265 2:67178466-67178488 TGAAATTAACCAAATGGGGTAGG + Intergenic
932118532 2:69076978-69077000 TTAAATTCAAGCTTTGGTGTTGG - Intronic
934091781 2:88556823-88556845 TGAAATCAATCCATTTGGGTTGG - Exonic
934147518 2:89110166-89110188 TGAAGTCAAACCCTTGGGGTTGG - Intergenic
934221752 2:90090425-90090447 TGAAGTCAAACCCTTGGGGTTGG + Intergenic
934232274 2:90194806-90194828 TGAAGTCAAACCCTTGGGGTTGG + Intergenic
934575904 2:95401518-95401540 TGAAATGGAACCTATGGGGGTGG - Intergenic
935457968 2:103292728-103292750 TGAAATTGATTCTTGGGGGTGGG - Intergenic
935672697 2:105569644-105569666 TGAAATAGAATCTTTGGGGTGGG - Intergenic
936124930 2:109780876-109780898 TCACATTAATCCTTTGAGGTAGG - Intergenic
936219763 2:110590592-110590614 TCACATTAATCCTTTGAGGTAGG + Intergenic
939402163 2:141708739-141708761 TCAAATGAAGCCTTTAGGGTGGG + Intronic
940894291 2:159065280-159065302 GGAAGTTATAACTTTGGGGTGGG - Intronic
941539310 2:166762263-166762285 GAAAATTAAACATTTGGGATTGG - Intergenic
943175278 2:184465337-184465359 TGAAATTAAACCTTAGTGTTGGG - Intergenic
943280205 2:185922293-185922315 TGAAATTTATACTTTGGGGAGGG - Intergenic
946669297 2:222085213-222085235 GGTAATTAAATCATTGGGGTGGG + Intergenic
947780657 2:232758614-232758636 TGATACTAAAACTTTAGGGTGGG - Intronic
948334733 2:237199116-237199138 TCAAACTAAACCTTTGGTTTTGG + Intergenic
949080265 2:242091076-242091098 TGAAAATAAGCCTTTGGGCATGG + Intergenic
1169963770 20:11192388-11192410 TGATATTAAACCTAAGGGATTGG + Intergenic
1170923424 20:20700879-20700901 TGAAAACAAGCCTTTGGGGCAGG + Intronic
1172147155 20:32764660-32764682 TGCAATTACACCTTTGCAGTAGG - Intronic
1172254033 20:33501140-33501162 TGAATTTATAGCTTTGGAGTTGG + Intronic
1173426314 20:42946451-42946473 ACAATTTAAACTTTTGGGGTTGG - Intronic
1173494086 20:43506652-43506674 TTAAATTAAATCATTGGTGTGGG + Intergenic
1175427733 20:58879990-58880012 TGAAATAAAAGGTTTGGGTTGGG - Intronic
1176333977 21:5578374-5578396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176393780 21:6242578-6242600 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1176467639 21:7073596-7073618 TGTAATTAAACCCTTAGGGTGGG + Intronic
1176491200 21:7455374-7455396 TGTAATTAAACCCTTAGGGTGGG + Intergenic
1176509442 21:7683009-7683031 TGTAATTAAACCCTTAGGGTGGG - Intergenic
1177791082 21:25722515-25722537 TAAAATGAGACCTTTAGGGTAGG - Intronic
1178137585 21:29645159-29645181 TGAAATTAAACTTTTGAAATAGG + Intronic
1178242952 21:30923530-30923552 TAAAATGAGACCTTTAGGGTGGG - Intergenic
1184564277 22:45282712-45282734 TCAAGTTAAACCTTTTGGGCAGG - Intergenic
1184564295 22:45282890-45282912 TCAAGTTAAACCTTTTGGGCGGG + Intergenic
949184953 3:1179272-1179294 TGAAATATAACCTTTAGTGTTGG - Intronic
950218282 3:11175213-11175235 TGCCATTAAACCTTTGAAGTAGG + Intronic
950986276 3:17371753-17371775 TGAAATTGAAACTTTAGGCTGGG + Intronic
951162403 3:19440830-19440852 TTAAAGCAAATCTTTGGGGTTGG + Intronic
951562047 3:23977774-23977796 AGAAATTAATCCTTTGTGGTAGG + Exonic
952812442 3:37416412-37416434 TTATATTAAGTCTTTGGGGTAGG - Intronic
953577782 3:44127136-44127158 TCAAATTAAACTCTTAGGGTAGG - Intergenic
954859832 3:53678245-53678267 TGAATTCAAACCTTTGGTTTTGG + Intronic
957714840 3:83913871-83913893 GTATTTTAAACCTTTGGGGTGGG + Intergenic
958598158 3:96257511-96257533 TGAAATTTAATCTTTGAGTTAGG + Intergenic
961319306 3:126061872-126061894 CGAAAATAACCCTTTAGGGTGGG - Intronic
963352445 3:144168350-144168372 TCAAATTAAAACCTAGGGGTGGG - Intergenic
964312514 3:155409976-155409998 TGAAATGAAACCTATGATGTTGG + Intronic
964368448 3:155973629-155973651 TAAAATTAGATCATTGGGGTGGG - Intergenic
964431257 3:156608616-156608638 TAAAATGAAGCCATTGGGGTGGG + Intergenic
965186035 3:165465613-165465635 ACAAATAAAACCTTTGTGGTAGG + Intergenic
965649632 3:170919905-170919927 TGTAATTAAATCATGGGGGTAGG + Intergenic
965840111 3:172895049-172895071 TTAAATTAAACTTTTGTGTTGGG + Intronic
966446250 3:180004700-180004722 TGAAGTTAAACCTCTGGGAGGGG + Intronic
967242338 3:187452571-187452593 TGAATTTATACCTATGAGGTGGG - Intergenic
968798811 4:2728368-2728390 GGAAGGTAAACCTGTGGGGTTGG - Intronic
972124659 4:35748218-35748240 TGAAATGAAACCATTAAGGTGGG - Intergenic
973115898 4:46458859-46458881 TCAAATTAAAGCTTAGGGGCTGG + Intronic
974639445 4:64609672-64609694 AGAAATTAAACGTGTGGAGTGGG + Intergenic
974889960 4:67869846-67869868 TAAAATTAAACCTTTGACCTTGG - Intronic
975558931 4:75691502-75691524 TGAAAATGTACCTTTGGGATGGG - Intronic
976395396 4:84550081-84550103 TGAAAAAAAGCTTTTGGGGTTGG + Intergenic
976572639 4:86631106-86631128 TAAAATTTAACCTTTGTGATAGG + Intronic
976702144 4:87982257-87982279 TGTAATGAAACCTATGAGGTAGG - Intronic
978755361 4:112295809-112295831 TGAAATTAAACCTTTCTGGCTGG + Intronic
979616523 4:122748725-122748747 TAAAATGAGACCATTGGGGTGGG - Intergenic
979929473 4:126612502-126612524 AGAAAATAAACTTTTGGGCTGGG - Intergenic
980313326 4:131163616-131163638 TGAAATGAGACCATTAGGGTGGG + Intergenic
981246427 4:142545331-142545353 TGCAATTAACCCTATGAGGTAGG + Intronic
982806090 4:159765271-159765293 TGAAATAAAATTTTAGGGGTTGG + Intergenic
983398052 4:167227831-167227853 TGACAGTAAGACTTTGGGGTTGG - Intronic
984220677 4:176970902-176970924 TGAAATTCACAATTTGGGGTGGG + Intergenic
984223656 4:177007994-177008016 TGAAATTGTACCTTTGGTTTTGG + Intergenic
984449523 4:179881779-179881801 TAAAATGAAGCCTTTAGGGTGGG + Intergenic
984539476 4:181019790-181019812 TCAAATTAAACTGTTGGGGGGGG + Intergenic
984788585 4:183592618-183592640 TAAAATTAAACATTTTGGCTGGG - Intergenic
985422266 4:189795983-189796005 TGAAATTAGACCTGGTGGGTGGG - Intergenic
987886688 5:23822571-23822593 TTAAATGAAATCTTTGGGGTAGG + Intergenic
988927547 5:36004793-36004815 TGAAATTAGACCTCTGAGGAGGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
993285787 5:85993861-85993883 TGAACTTAAAAATTAGGGGTGGG + Intergenic
993643827 5:90438083-90438105 TGAATTTGAATCTTTGGGATTGG - Intergenic
994105976 5:95949230-95949252 TGACATGATTCCTTTGGGGTGGG + Intronic
995676223 5:114665337-114665359 TGGATTTAAACATTTTGGGTGGG + Intergenic
996322809 5:122238297-122238319 ATTAATTAAACATTTGGGGTGGG + Intergenic
997468259 5:134102340-134102362 GGAAATAAAAGCTTTGGGGTGGG - Intergenic
999335891 5:150716197-150716219 AGAAATTAAACATTAGGGCTAGG - Intronic
999525448 5:152401194-152401216 TAAAATAAAAGTTTTGGGGTGGG - Intronic
999531995 5:152473966-152473988 TGAAATCAAAACTCTGGGGTTGG - Intergenic
1003897609 6:10622497-10622519 TAAAATGAGACCTTTAGGGTGGG - Intronic
1004304759 6:14489721-14489743 TCCAGTTAAATCTTTGGGGTTGG + Intergenic
1005385098 6:25278525-25278547 TGAAGTTGAACCTCTGGGGATGG + Intergenic
1007895738 6:45355889-45355911 GGAAATTAAATTTTTGGGGTTGG - Intronic
1008097787 6:47357677-47357699 TGGTAATAAACCTTTGAGGTAGG + Intergenic
1011013297 6:82726367-82726389 TCAAATCAAATCTTTGGGTTTGG - Intergenic
1011913131 6:92467090-92467112 TGTAATTAAATCATTGGGTTAGG - Intergenic
1012152556 6:95772955-95772977 AGAAATTAAATCATTTGGGTGGG - Intergenic
1013532737 6:111034974-111034996 TAAAAATAAAACTATGGGGTTGG + Intergenic
1014652175 6:124053239-124053261 TAAAATTTAACATCTGGGGTGGG + Intronic
1015056767 6:128911657-128911679 AGAAATTATACCTTTAGGGGAGG - Intronic
1015581527 6:134730390-134730412 TGTAATTACACATGTGGGGTTGG - Intergenic
1016211694 6:141543449-141543471 TACAATTAAACCTTTGGGAGTGG + Intergenic
1016296230 6:142576020-142576042 TGAAAATATACTTTTGGGGATGG + Intergenic
1016301339 6:142635218-142635240 TGAATTTAGACTTTTAGGGTTGG - Intergenic
1016843334 6:148545777-148545799 TCAAATTCAAACTTTTGGGTTGG + Intronic
1017229756 6:152061198-152061220 TGACATTATGCCTTTGGAGTGGG - Intronic
1017970837 6:159311348-159311370 TGAAATTAAATGTGTAGGGTAGG - Intergenic
1018498642 6:164378609-164378631 GTAAATTAAACCTTTGTAGTTGG + Intergenic
1018688277 6:166320810-166320832 AAAAATTAAATCTTTGGGCTGGG - Intronic
1019189482 6:170243181-170243203 AAAAATAAAACCTGTGGGGTCGG - Intergenic
1020392193 7:7670178-7670200 ACAACTTAAACTTTTGGGGTTGG + Intronic
1020963100 7:14830532-14830554 GAAAATGAAAGCTTTGGGGTAGG - Intronic
1021289710 7:18828194-18828216 TGAAAAAAAGTCTTTGGGGTAGG + Intronic
1021506430 7:21390522-21390544 GGAAATTAAACACTTAGGGTGGG - Intergenic
1022584269 7:31590846-31590868 TTAAAATAAACCTTTAAGGTAGG + Intronic
1024536135 7:50435940-50435962 TGAAGTGAAGCCTGTGGGGTGGG - Intergenic
1024687045 7:51757427-51757449 TGAATTGAGACCTCTGGGGTGGG - Intergenic
1028110464 7:86934673-86934695 GGCAATTAAAGCCTTGGGGTTGG - Intronic
1028258363 7:88629836-88629858 TGAAATAAAAACATTAGGGTTGG - Intergenic
1028323908 7:89498005-89498027 TAAAATGAGACCATTGGGGTGGG + Intergenic
1028476442 7:91258339-91258361 TAAAATAACATCTTTGGGGTGGG - Intergenic
1029428487 7:100513284-100513306 TGAAAGTAAAGTTTTGGGCTGGG + Intergenic
1029648421 7:101873340-101873362 TAAAATAAAACATATGGGGTGGG - Intronic
1030037131 7:105417518-105417540 TAAAATTAAACCTTTAGGCCAGG + Intergenic
1032547796 7:132758073-132758095 TGAATTGAATCCTTTGGGGATGG + Intergenic
1033121251 7:138668678-138668700 TGAATTTTAATCTTTGGGGGTGG - Intronic
1033850928 7:145493724-145493746 TGAAATAAAATCTTTAGAGTGGG + Intergenic
1035538310 8:409341-409363 TGAAAATAAGCCTTTGGGCATGG + Intronic
1035787544 8:2273615-2273637 TGACATTTAACATTTGGTGTGGG + Intergenic
1035805266 8:2448101-2448123 TGACATTTAACATTTGGTGTGGG - Intergenic
1037816105 8:22112928-22112950 TGAATTTTACCCATTGGGGTGGG - Intergenic
1038165556 8:25082036-25082058 TGAAAATAAGCACTTGGGGTAGG - Intergenic
1039381510 8:37090063-37090085 TCAAATTAACCCTGTGGGGTAGG + Intergenic
1039700286 8:39955020-39955042 TGAAATGAGGCCTTTAGGGTGGG - Intronic
1040418157 8:47214705-47214727 AGAAAATATACCTTTGGGGATGG - Intergenic
1040888362 8:52289656-52289678 GGAAAATAAGCCATTGGGGTGGG + Intronic
1041739720 8:61145375-61145397 TGAAATAAAAACGTTGGGGTTGG + Intronic
1041783599 8:61606544-61606566 TTATCTGAAACCTTTGGGGTGGG - Intronic
1043978092 8:86606124-86606146 TTAAATTAAAATTTTGGGGTTGG + Intronic
1044557676 8:93581806-93581828 TCAAATTGAAACTTTGGGTTTGG - Intergenic
1046339411 8:112832689-112832711 TGAAATCAAAGCTTTGGTCTGGG - Intronic
1047777110 8:128081531-128081553 TCAGAATAAACCTTTGGGTTGGG + Intergenic
1048433657 8:134395026-134395048 AGAAATTAAACATTTGGGCCAGG - Intergenic
1048775935 8:137946579-137946601 TGAAAAAAAACCTTTGAGCTGGG + Intergenic
1051521127 9:17990063-17990085 TTAAATAAAACCTTTGTGGTAGG + Intergenic
1055086513 9:72319726-72319748 TAAAATGAAATCATTGGGGTGGG - Intergenic
1055662128 9:78514960-78514982 TGAAACTAAACATTTAGAGTGGG - Intergenic
1056019753 9:82429634-82429656 TCAAATTAGACCTTTAGGGTAGG - Intergenic
1057072083 9:92107395-92107417 TCAAATTAGATCTTTAGGGTAGG + Intronic
1057474678 9:95388450-95388472 TGAATCCAAACCTTTGGGGGTGG - Intergenic
1057500262 9:95591643-95591665 TGAAAATTAAGCTTTGGTGTTGG + Intergenic
1058921969 9:109625406-109625428 TAGAATGAAACCTGTGGGGTTGG - Intergenic
1059374792 9:113873657-113873679 TGAATTCAAAACTCTGGGGTGGG + Intergenic
1059847910 9:118302212-118302234 TGAATTAGAACCTTTGTGGTGGG - Intergenic
1060021838 9:120138366-120138388 TCAAATCAATCCTTTGAGGTTGG + Intergenic
1060308366 9:122436499-122436521 TAAAATTAAACCATTCAGGTAGG + Intergenic
1188458309 X:30393041-30393063 AGAAATTAAAACATTGGTGTAGG - Intergenic
1189101882 X:38199104-38199126 TGAATTTAAAACTTTAGTGTGGG + Intronic
1191641943 X:63435630-63435652 TGAAATAAAACCTCTCGGATTGG + Intergenic
1194145180 X:90254041-90254063 GGTAATTGAACCATTGGGGTGGG - Intergenic
1194703236 X:97141548-97141570 TGTTTTTAAAACTTTGGGGTAGG - Intronic
1195720747 X:107865561-107865583 TGAAAAGAACCCTTTGGGGTGGG - Intronic
1196259738 X:113564248-113564270 TAAAATTATAGCTTTGGGGATGG + Intergenic
1198620241 X:138499784-138499806 TATAATTAAATCATTGGGGTGGG + Intergenic
1200490940 Y:3823334-3823356 GGTAATTGAACCATTGGGGTGGG - Intergenic