ID: 1141386539

View in Genome Browser
Species Human (GRCh38)
Location 16:83626838-83626860
Sequence CTCCCTAGGACGCCTCGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141386530_1141386539 9 Left 1141386530 16:83626806-83626828 CCTGAATCCCACACAGACTCCCT 0: 1
1: 0
2: 3
3: 19
4: 217
Right 1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG 0: 1
1: 0
2: 0
3: 1
4: 52
1141386532_1141386539 1 Left 1141386532 16:83626814-83626836 CCACACAGACTCCCTGTACCCGC 0: 1
1: 0
2: 1
3: 9
4: 176
Right 1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG 0: 1
1: 0
2: 0
3: 1
4: 52
1141386531_1141386539 2 Left 1141386531 16:83626813-83626835 CCCACACAGACTCCCTGTACCCG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG 0: 1
1: 0
2: 0
3: 1
4: 52
1141386534_1141386539 -10 Left 1141386534 16:83626825-83626847 CCCTGTACCCGCTCTCCCTAGGA 0: 1
1: 0
2: 0
3: 11
4: 75
Right 1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG 0: 1
1: 0
2: 0
3: 1
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141386539 Original CRISPR CTCCCTAGGACGCCTCGGAA TGG Intronic
901204160 1:7484288-7484310 CTCCCCAGGAGGCCTGGAAAGGG + Intronic
1063373013 10:5533842-5533864 CTCATTAGGAAGCCTGGGAATGG + Intergenic
1065024314 10:21526351-21526373 CTCCCCGCGACGCCGCGGAAGGG - Intergenic
1070340432 10:75493522-75493544 CTCCCTAGCACTCTTCAGAAGGG - Intronic
1070754816 10:78985474-78985496 CCCCCTAGGACGCCGAGGATAGG + Intergenic
1076664916 10:132081752-132081774 CCCCCCAAGACTCCTCGGAAAGG - Intergenic
1084110422 11:67010669-67010691 GTCCCTAGGCAGCCTGGGAAAGG + Intronic
1088222709 11:107586824-107586846 CTCCCTTGGACTTCTCTGAAAGG + Intergenic
1091609838 12:1996542-1996564 CTTCCTGGGACACCTTGGAAAGG + Intronic
1091634881 12:2189445-2189467 CTCCCCAGGACGTGTCAGAAGGG + Intronic
1100689810 12:97027840-97027862 CTTCCTAGGAAGCCCAGGAAAGG + Intergenic
1106079143 13:26486079-26486101 GTCCCTAGCAGGCCTCGGCAGGG - Intergenic
1113255077 13:108496631-108496653 GTCCCTAGTACGCCCCCGAAAGG + Intergenic
1113733524 13:112658995-112659017 CTGCCTAAGAGGCCTGGGAAGGG - Intronic
1118730961 14:68665997-68666019 TTCCCTAGGACTTCTGGGAAGGG + Intronic
1118899060 14:69971438-69971460 CTTCCTAGGATGCTTCGGAGTGG + Intronic
1126419429 15:48455652-48455674 CTTCTTAGGAAGGCTCGGAAGGG + Intronic
1129174437 15:73829869-73829891 GTCCCTAGGACTCCTGGGGAGGG + Intergenic
1131113023 15:89776999-89777021 ATCCCCAGGACGCCTCGGCGAGG - Exonic
1133394602 16:5436196-5436218 CTGCCTAGGAGGCCTCAAAAGGG + Intergenic
1141386539 16:83626838-83626860 CTCCCTAGGACGCCTCGGAATGG + Intronic
1141879342 16:86847493-86847515 CTTCCTTGGAAGACTCGGAAAGG - Intergenic
1145304826 17:21668044-21668066 CACCCTGGGCCGCCTGGGAATGG + Intergenic
1146378966 17:32314582-32314604 CTCCCTGGGAGCCCTGGGAAGGG - Intronic
1148050806 17:44769223-44769245 CTACATAGGAGGCCTCGGACAGG - Intronic
1152732282 17:81978090-81978112 CTCCGGGGGACGCCCCGGAATGG - Intronic
1161455102 19:4366060-4366082 CTCCATAGGAGGCCACGGACAGG - Intronic
1167449851 19:49560678-49560700 CTCCCTAGGATGACGCGGCATGG - Exonic
937524705 2:122754297-122754319 CTCCCTTGGACACCCCTGAAAGG - Intergenic
942004912 2:171688058-171688080 CTCCCCAGGCCGCCTCTGGAGGG - Intronic
1172839960 20:37896986-37897008 CTCCCTAGGACTTCTGGCAAAGG + Intergenic
1173431913 20:42995613-42995635 CTTCCTGGGAAGACTCGGAAAGG - Intronic
1175152279 20:56944534-56944556 CTCCCTAGGACACTCTGGAAAGG - Intergenic
1181237629 22:21457205-21457227 CTCCTTAGGAGCTCTCGGAATGG + Intergenic
1181539382 22:23565384-23565406 CTCCATAGGAGGCCTGGGGAGGG + Intergenic
1183421756 22:37715826-37715848 ATCCCGAGGAGGCCTCGGGAGGG + Exonic
1184312684 22:43658321-43658343 ATCCCTAGGTCGCCTCTGAAAGG - Intronic
1185408948 22:50672851-50672873 CTCCCCAGGACGCCACTGACCGG - Intergenic
950559441 3:13713331-13713353 CTCCCTAGGTGGCCTCCCAATGG - Intergenic
959111205 3:102124516-102124538 CTCCCTAGGAACCCTGGGGAGGG + Intronic
966784799 3:183613528-183613550 CTCACTAAGACTCCTAGGAATGG + Intergenic
969432330 4:7162695-7162717 CTCCCTAAGAGGCCTCAGCATGG - Intergenic
1001382890 5:171315584-171315606 CTCCCTAGGAGGCCGCGCAGCGG + Intergenic
1001527736 5:172440681-172440703 TTCTCTAGGACGCCTCGGCCCGG - Intronic
1002861147 6:1080548-1080570 CTGCCTGGCACGCCTGGGAAAGG + Intergenic
1007431450 6:41779706-41779728 CTCCCTAGGAAGCCCCGGGCGGG - Intronic
1027137840 7:75637867-75637889 CTCCCTTGGTTGCCTCGAAAGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1049289025 8:141791810-141791832 CTCCCTGGACAGCCTCGGAAGGG + Intergenic
1060524167 9:124311210-124311232 CTCCTAAAGACGCCTCGGTACGG + Intronic
1060994660 9:127869157-127869179 ATCCATGGGACGCCTTGGAAAGG + Intronic
1062496514 9:136833976-136833998 CTCCCTGGGAGGCTTTGGAAGGG - Intronic
1189986400 X:46557403-46557425 CTCCTTAGGACACCTCATAAGGG - Intergenic
1191158868 X:57305643-57305665 CTCCCTAGAACGCCATGTAAGGG + Intronic