ID: 1141388636

View in Genome Browser
Species Human (GRCh38)
Location 16:83646097-83646119
Sequence TTCACGTATGGTCCCACACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141388636_1141388644 25 Left 1141388636 16:83646097-83646119 CCTAGTGTGGGACCATACGTGAA 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1141388644 16:83646145-83646167 ACTCTAGACTCAGACCAACCGGG 0: 1
1: 1
2: 2
3: 17
4: 187
1141388636_1141388645 26 Left 1141388636 16:83646097-83646119 CCTAGTGTGGGACCATACGTGAA 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1141388645 16:83646146-83646168 CTCTAGACTCAGACCAACCGGGG 0: 1
1: 0
2: 0
3: 8
4: 69
1141388636_1141388639 -9 Left 1141388636 16:83646097-83646119 CCTAGTGTGGGACCATACGTGAA 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1141388639 16:83646111-83646133 ATACGTGAAAGCCACCAGGTAGG 0: 1
1: 0
2: 0
3: 5
4: 70
1141388636_1141388643 24 Left 1141388636 16:83646097-83646119 CCTAGTGTGGGACCATACGTGAA 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1141388643 16:83646144-83646166 GACTCTAGACTCAGACCAACCGG 0: 1
1: 0
2: 1
3: 18
4: 172
1141388636_1141388640 -8 Left 1141388636 16:83646097-83646119 CCTAGTGTGGGACCATACGTGAA 0: 1
1: 0
2: 1
3: 4
4: 53
Right 1141388640 16:83646112-83646134 TACGTGAAAGCCACCAGGTAGGG 0: 1
1: 0
2: 0
3: 7
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141388636 Original CRISPR TTCACGTATGGTCCCACACT AGG (reversed) Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
902386982 1:16081755-16081777 TTCACCTTTGGTCCCCCACCAGG + Intergenic
908769607 1:67583983-67584005 ATCACCTAAGGTCCCACTCTAGG - Intergenic
911906432 1:103574326-103574348 TTCAAGTATGGTGCAAAACTCGG + Exonic
911909937 1:103620617-103620639 TTCAAGTATGGTGCAAAACTCGG + Exonic
911913036 1:103659476-103659498 TTCAAGTATGGTGCAAAACTCGG + Exonic
911915419 1:103692472-103692494 TTCAAGTATGGTGCAAAACTCGG - Exonic
911917358 1:103714821-103714843 TTCAAGTATGGTGCAAAACTCGG + Intronic
911920448 1:103753615-103753637 TTCAAGTATGGTGCAAAACTCGG + Exonic
920742234 1:208591909-208591931 TTCAAATCTGGCCCCACACTTGG + Intergenic
1066676374 10:37891728-37891750 TTCTCCTATACTCCCACACTAGG + Intergenic
1069130278 10:64692434-64692456 TTCACTTCTACTCCCACACTAGG + Intergenic
1075599964 10:123760521-123760543 TTGAAGTATGTTCCCACCCTTGG - Intronic
1089248017 11:117136745-117136767 TTCACGGATGGGCACACTCTTGG - Intergenic
1089258697 11:117207816-117207838 TTCACGGATGGGCACACTCTTGG + Intronic
1091327088 11:134699615-134699637 TCCAGGAATGGTGCCACACTGGG - Intergenic
1100079059 12:90825343-90825365 TTTTCTTATGGTCCCTCACTAGG - Intergenic
1101905004 12:108817868-108817890 TTCACGAATGGTTCCCCACCAGG + Intronic
1104948422 12:132427695-132427717 ATCACAAAGGGTCCCACACTTGG + Intergenic
1115370029 14:32602906-32602928 CTAACGCCTGGTCCCACACTTGG - Intronic
1120838395 14:89061556-89061578 GTCAGGTGTTGTCCCACACTTGG + Intergenic
1125469890 15:39992584-39992606 GTCACGTATGGCCACACATTCGG - Intronic
1137445831 16:48531638-48531660 CTCACGTATGTTCGCGCACTTGG + Intergenic
1140465111 16:75175107-75175129 TTCAGGTCTGGTCCCACAGTCGG + Intergenic
1141388636 16:83646097-83646119 TTCACGTATGGTCCCACACTAGG - Intronic
1148935433 17:51161227-51161249 TCCACGGATGGTCCCAGGCTTGG - Exonic
1160282258 18:77502493-77502515 TTCATGCATGGTCCTTCACTTGG - Intergenic
1164522777 19:28991504-28991526 TACACGTATGATCCCACACTTGG + Intergenic
925437762 2:3855651-3855673 TTCACGTTTTGTACCACAATCGG - Intergenic
928902857 2:36339301-36339323 ATCACCTATGATCCCACTCTTGG - Intergenic
946328773 2:218998266-218998288 TTCATGTATGGCCAGACACTTGG + Intergenic
1168942199 20:1722119-1722141 TTGACTTATTGTCACACACTGGG + Intergenic
1182733490 22:32513758-32513780 TTCACTTGGGGTCCCACGCTGGG + Exonic
960477978 3:118154069-118154091 TTCAAGTGAGGTCCCACAATAGG + Intergenic
972974007 4:44611127-44611149 ATCATGTATGGTCTCACATTTGG + Intergenic
977648924 4:99446772-99446794 TTCATGTCTGGCCCCCCACTTGG - Intergenic
980608714 4:135127527-135127549 TGCACCTGTGGTCCCAGACTTGG - Intergenic
981070682 4:140534113-140534135 ATAAAGTATGGTCCCAAACTGGG + Intronic
984751679 4:183283442-183283464 TTCATGGATGCTCACACACTGGG + Intronic
994044344 5:95291271-95291293 ATCACGCCTGGTCCCTCACTGGG - Intergenic
999499788 5:152135392-152135414 TTAACATATAGTCCCACACAAGG - Intergenic
1008239225 6:49088282-49088304 TGCACCTATAGTCCCATACTTGG - Intergenic
1008485328 6:52029092-52029114 TTCACGTATGTTATCCCACTTGG + Intronic
1012360459 6:98371484-98371506 TTCATGTATGTTCACACTCTTGG + Intergenic
1014547158 6:122747285-122747307 TCCACGTCTGGTCCCTCATTCGG + Intergenic
1034828615 7:154289598-154289620 ATCACATTTTGTCCCACACTGGG - Intronic
1034934193 7:155187931-155187953 CTCATGTGTGCTCCCACACTGGG + Intergenic
1042949042 8:74182092-74182114 ATCAAGTCTGGTCCCACATTTGG - Intergenic
1057735011 9:97649046-97649068 TTTAGGTATGGTCCCTCTCTAGG + Intronic
1058549478 9:106098501-106098523 TACAAGTATGGTTCCACAGTGGG - Intergenic
1060868309 9:127017880-127017902 TTCAGGGATGGTCACACACATGG + Intronic
1189041563 X:37545714-37545736 TTCACCTATGATCCAACACTTGG + Intronic
1189051892 X:37654121-37654143 TTCCAGTAAGGTCCCACACTAGG - Intronic
1189615523 X:42779155-42779177 TTCATGAATGCTCCCACAATGGG - Intergenic
1190324358 X:49197697-49197719 TTCAGGTGTGCTCCCACCCTGGG - Exonic
1197089375 X:122519269-122519291 TTCATGTCTGGTGCCAAACTGGG - Intergenic
1198568475 X:137930562-137930584 TTCATGTATGCTCCCAGACTCGG - Intergenic
1200699548 Y:6390520-6390542 CCCACTTATGGTCCCACAGTGGG - Intergenic
1201034563 Y:9774178-9774200 CCCACTTATGGTCCCACAGTGGG + Intergenic