ID: 1141392252

View in Genome Browser
Species Human (GRCh38)
Location 16:83674663-83674685
Sequence TTGGAGTCTCAGGATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 371}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141392247_1141392252 14 Left 1141392247 16:83674626-83674648 CCTAACCAGTTAGCAATCCAACA 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 371
1141392248_1141392252 9 Left 1141392248 16:83674631-83674653 CCAGTTAGCAATCCAACATACAG 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 371
1141392246_1141392252 15 Left 1141392246 16:83674625-83674647 CCCTAACCAGTTAGCAATCCAAC No data
Right 1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 371
1141392249_1141392252 -3 Left 1141392249 16:83674643-83674665 CCAACATACAGAAGAACTATTTG 0: 1
1: 0
2: 2
3: 27
4: 278
Right 1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG 0: 1
1: 0
2: 1
3: 18
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141392252 Original CRISPR TTGGAGTCTCAGGATGCTGC TGG Intronic
900380931 1:2383427-2383449 TCTGAGTCTCAGGAGGGTGCTGG + Intronic
900511146 1:3061789-3061811 TTGGACTCCCAGGAAGCTGGAGG + Intergenic
900774459 1:4571809-4571831 TGAGATGCTCAGGATGCTGCAGG + Intergenic
900802444 1:4745740-4745762 GTGGAGTCAAAGGAGGCTGCTGG + Intronic
901781616 1:11598209-11598231 ATGGAGTCTCAGGAGGATTCTGG + Intergenic
902073414 1:13762450-13762472 TTGGAGACACAGGAACCTGCTGG + Intronic
902080494 1:13817453-13817475 TTGGAGTACCTGGATTCTGCTGG + Intronic
902731579 1:18373406-18373428 TCGGAGTGTCAGGAGGCTGAGGG + Intronic
903569813 1:24295903-24295925 TTCATCTCTCAGGATGCTGCGGG + Intergenic
905137572 1:35811348-35811370 CTGTAGTCTGAGGCTGCTGCAGG + Intronic
906558224 1:46732175-46732197 TTTGGGTATCAGGATGATGCTGG - Intergenic
907612992 1:55891447-55891469 TTTTGGTCTCAGGATGATGCTGG + Intergenic
908584279 1:65551202-65551224 TTTTAGTATCAGGATGATGCGGG + Intronic
908870918 1:68610699-68610721 TTTTAGTATCAGGATGTTGCTGG + Intergenic
909872202 1:80755732-80755754 TTGGAGACTCAGGAGGTTGGGGG - Intergenic
909992132 1:82236616-82236638 TTTTAGTATCAGGATGATGCTGG + Intergenic
912035562 1:105307735-105307757 TTTCAGTATCAGGATGATGCTGG + Intergenic
913164886 1:116175961-116175983 TTGGAGTCACAGCATGCAGGCGG + Intergenic
914454063 1:147819131-147819153 TTAGAGTCTCAGGATTCTCCAGG + Intergenic
915649448 1:157297885-157297907 TTTTAGTATCAGGATGATGCTGG - Intergenic
916944577 1:169713127-169713149 TTTTAGTATCAGGATGATGCTGG - Intronic
917305625 1:173621311-173621333 TTTGGGTATCAGGATGATGCTGG - Intronic
917969041 1:180195632-180195654 TGGAAGAGTCAGGATGCTGCTGG - Intronic
918827104 1:189338143-189338165 TTTTAGTATCAGGATGATGCTGG - Intergenic
919271758 1:195357694-195357716 TTTCAGTATCAGGATGATGCTGG - Intergenic
920122761 1:203671119-203671141 TTGGAATATAAAGATGCTGCAGG - Intronic
921365774 1:214372329-214372351 TGGGAGTCTCAGGCTGCTCTGGG - Intronic
922062288 1:222104177-222104199 TTGGGGTCCCAGCATCCTGCAGG + Intergenic
922376649 1:224975212-224975234 TTTTAGTATCAGGATGTTGCTGG + Intronic
923061479 1:230479066-230479088 TTGGGGTCTCAGGGTTATGCAGG + Intergenic
924682374 1:246250877-246250899 TTTGAGTCTCAAAATGTTGCTGG - Intronic
1065059650 10:21886484-21886506 TTTTAGTATCAGGATGATGCTGG - Intronic
1066042583 10:31565271-31565293 TTGTGGTATCAGGATGATGCTGG + Intergenic
1066160008 10:32718037-32718059 TTTTGGTATCAGGATGCTGCTGG - Intronic
1066271598 10:33829458-33829480 TTGGAGTCTCAAGTTGCCTCAGG - Intergenic
1066374578 10:34846088-34846110 TTGTAGTCTCAGGATGGGGGTGG - Intergenic
1066816278 10:39419120-39419142 TAAGAGTCTCAGAATGCTTCCGG - Intergenic
1067213647 10:44282143-44282165 TTGGAGCCTCAGGATGGTTGGGG - Intergenic
1068833615 10:61526666-61526688 CTGGAGACTCAGGAGGGTGCAGG + Intergenic
1069415116 10:68192497-68192519 TTTGAGTATCAGGATAATGCTGG + Intronic
1069959453 10:72071042-72071064 TTGCAGTCTTAGAAGGCTGCAGG - Intronic
1070776570 10:79113297-79113319 CTGCAGGCCCAGGATGCTGCCGG - Intronic
1071059377 10:81551767-81551789 TTTGGGTATCAGGATGATGCTGG - Intergenic
1071667175 10:87570239-87570261 TTTGAGTGTCAGGATAATGCTGG - Intergenic
1072207798 10:93220551-93220573 GTGCAGTCTCAGGACCCTGCAGG + Intergenic
1072509743 10:96108189-96108211 TTTTAGTATCAGGATGATGCTGG + Intergenic
1075696211 10:124437498-124437520 TTGGAGTCTCAGGATCGGGGAGG - Intergenic
1076491801 10:130866809-130866831 CTGAAGGCTCAGGATGGTGCTGG - Intergenic
1076705528 10:132299318-132299340 TTGGGGTCTCAGTTTGCTGTTGG - Intronic
1077420686 11:2448542-2448564 TTGGAGTCTGAAGCAGCTGCTGG + Intronic
1077598591 11:3556408-3556430 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1078429435 11:11276997-11277019 TTTTGGTATCAGGATGCTGCTGG + Intronic
1079257193 11:18841502-18841524 TTTGAGTGTCAGGATGATGCTGG - Intergenic
1080092505 11:28365164-28365186 TTGTGGTATCAGGATGATGCTGG + Intergenic
1081094619 11:38917834-38917856 TTTGAGTATCAGGATGATGCTGG + Intergenic
1081316361 11:41635930-41635952 TTTTAGTATCAGGATGATGCTGG + Intergenic
1082994265 11:59237225-59237247 TTTTAGTATCAGGATGATGCTGG - Intergenic
1084254673 11:67932280-67932302 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1084818200 11:71663607-71663629 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1084964446 11:72737173-72737195 ATGGACTCTCAGGATACTCCAGG - Intronic
1085241807 11:75062721-75062743 TTGGCTTCTCGGGAGGCTGCAGG - Intergenic
1089456362 11:118628134-118628156 GGGGACTCTCAGGAGGCTGCAGG - Exonic
1090321537 11:125848543-125848565 TTTCAGTATCAGGATGGTGCTGG - Intergenic
1090573946 11:128079867-128079889 TTTTAGTATCAGGATGATGCTGG - Intergenic
1090855071 11:130603691-130603713 GTGGAGACTCAGGATGATGGTGG + Intergenic
1091775890 12:3184656-3184678 TTAGAGCCACGGGATGCTGCCGG + Intronic
1092424739 12:8365759-8365781 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1092639245 12:10485325-10485347 TTTGAGTGTCAGGATGATGCTGG - Intergenic
1093510258 12:19918381-19918403 TTTTAGTATCAGGATGATGCTGG - Intergenic
1095356738 12:41283516-41283538 TTGGGATATCAGGATGATGCTGG - Intronic
1096180444 12:49547781-49547803 TTGGGGTCACAGGATGCAGTTGG - Intronic
1096940279 12:55336585-55336607 TTTTAGTATCAGGATGATGCTGG + Intergenic
1097737651 12:63199864-63199886 TTTTAGTATCAGGATGATGCTGG - Intergenic
1099183715 12:79495826-79495848 TTTTGGTGTCAGGATGCTGCTGG + Intergenic
1099201333 12:79680922-79680944 ATGGGGTCTCAGTATGTTGCTGG - Intronic
1099431237 12:82588831-82588853 TTTTAGTATCAGGATGATGCTGG - Intergenic
1099634918 12:85201277-85201299 TTTTAGTATCAGGATGATGCTGG + Intronic
1100921428 12:99492554-99492576 TTTTAGTATCAGGATGATGCTGG - Intronic
1101226274 12:102691028-102691050 CTGGACTCTCAGGATCCTGTGGG - Intergenic
1103954772 12:124569775-124569797 TTGGAATCACGGGCTGCTGCTGG - Intergenic
1104401796 12:128482461-128482483 TTTGGGTATCAGGATGATGCTGG + Intronic
1105513350 13:21069649-21069671 TTGGAGTCTCTGGAGGTGGCTGG - Intergenic
1105776227 13:23663502-23663524 TTTGGGTGTCAGGATGATGCTGG + Intronic
1108238001 13:48428957-48428979 TTGGTCTCTCAGGATGCTCCTGG + Intronic
1108673689 13:52717828-52717850 TTTTAGTATCAGGATGATGCTGG + Intronic
1109209151 13:59514532-59514554 ATGGAGACTCTGGATGGTGCTGG + Intergenic
1109426910 13:62176948-62176970 TTTGGGTATCAGGATGATGCTGG - Intergenic
1109531529 13:63654920-63654942 TTTTAGTATCAGGATGATGCTGG + Intergenic
1110148372 13:72221422-72221444 TTGGGCTCTCAGAATGGTGCTGG + Intergenic
1110337627 13:74350216-74350238 TTTTAGTATCAGGATGCTGCTGG - Intergenic
1111526121 13:89473209-89473231 TTTTAGTATCAGGATGATGCTGG + Intergenic
1111620514 13:90718965-90718987 TTGGAGACTTAGAATACTGCTGG + Intergenic
1112446082 13:99465522-99465544 TTGGAGGCCCAGAATGTTGCTGG - Intergenic
1112867644 13:103926151-103926173 TTGAAGTGTCAGAATGCTGGGGG - Intergenic
1113253488 13:108480714-108480736 TTGGAGCCACAGGATGCTTCTGG + Intergenic
1113483257 13:110637003-110637025 GTGGAGCCTCAGGCTGCTCCTGG + Intronic
1116073578 14:40081841-40081863 TTTTAGTATCAGGATGATGCTGG - Intergenic
1116317687 14:43418077-43418099 TTGGATTCTCCAAATGCTGCAGG + Intergenic
1116318217 14:43425517-43425539 TTTTGGTATCAGGATGCTGCTGG - Intergenic
1116511491 14:45752510-45752532 TTTTAGTGTCAGGATGATGCTGG + Intergenic
1116690523 14:48100422-48100444 TTTTAGTATCAGGATGATGCTGG - Intergenic
1117641374 14:57802948-57802970 TTGTGGTATCAGGATGATGCTGG - Intronic
1117944152 14:60999784-60999806 TTGCAGTCTCTGGTAGCTGCTGG - Intronic
1118113108 14:62745095-62745117 GTGCAGTGTCAGGATCCTGCAGG - Intronic
1118306604 14:64660306-64660328 TTGAAGTCTTTGGATGCTGCTGG + Intergenic
1122638342 14:103141198-103141220 CTGGCATCTCAGGAGGCTGCGGG - Intergenic
1122928371 14:104921252-104921274 TTTGAGTATCAGGATAATGCTGG + Intergenic
1124657292 15:31518613-31518635 TGGGTGTCTCAGGATGCATCAGG - Intronic
1124700917 15:31911093-31911115 TAGAAGGCTGAGGATGCTGCTGG + Intergenic
1125221167 15:37336871-37336893 TTGCAGTCTCAAGATGATGAAGG + Intergenic
1128694844 15:69753745-69753767 TCCTTGTCTCAGGATGCTGCTGG + Intergenic
1128857161 15:71028431-71028453 TTTCAGTATCAGGATGATGCTGG + Intronic
1131052981 15:89360279-89360301 GTGGAGTCACAGAACGCTGCGGG - Intergenic
1131080837 15:89533476-89533498 ATGGAGACTCAGAATGCTGAGGG - Intergenic
1131281031 15:91021676-91021698 TTGGAGACTAAGCATGCTCCAGG - Intronic
1133460153 16:5980421-5980443 AGGGTGTCTCAGGATCCTGCAGG + Intergenic
1134629279 16:15745304-15745326 GTGCAGGTTCAGGATGCTGCAGG - Intronic
1138883540 16:61047045-61047067 TTTGGGTATCAGGATGATGCTGG + Intergenic
1138976178 16:62210944-62210966 TTTTAGTATCAGGATGATGCTGG + Intergenic
1140610360 16:76591562-76591584 TTGGAGTGTCTGGACTCTGCTGG + Intronic
1141392252 16:83674663-83674685 TTGGAGTCTCAGGATGCTGCTGG + Intronic
1142251505 16:88993949-88993971 TTGGAGTCTGAGGTTGGGGCTGG + Intergenic
1142916101 17:3139816-3139838 TTTTAGTATCAGGATGATGCTGG + Intergenic
1143239545 17:5432177-5432199 TTGGAGTCTCATCTTCCTGCTGG + Intronic
1146439547 17:32881981-32882003 TTGGACTTTCAGGATGGTTCAGG - Intergenic
1147400827 17:40178999-40179021 TTGGACACCCTGGATGCTGCAGG - Intronic
1147976996 17:44253513-44253535 TTGGATTCTCAAGATGGGGCGGG - Intronic
1148044961 17:44737927-44737949 CTGGAGCCTCAGGATACTGAGGG - Intronic
1148984372 17:51609061-51609083 TCTGAGTCTCAGAATCCTGCTGG + Intergenic
1149340187 17:55677662-55677684 TTGGAGTCTCTTACTGCTGCAGG + Intergenic
1149395475 17:56237245-56237267 TTTTAGTATCAGGATGATGCTGG + Intronic
1149840228 17:59957247-59957269 ATGGAGTCTTGGGATACTGCTGG - Exonic
1151081204 17:71331460-71331482 TTGGATTCTCAGGATGATATCGG - Intergenic
1151422315 17:74006493-74006515 AGGATGTCTCAGGATGCTGCCGG + Intergenic
1153522737 18:5967730-5967752 ATGGAGCCCCAGGCTGCTGCTGG + Intronic
1153974428 18:10255146-10255168 TTTCAGTATCAGGATGATGCTGG + Intergenic
1156458592 18:37308499-37308521 TTGGATGCTCAGCATGCTGCCGG + Intronic
1156654142 18:39263454-39263476 TTTTAGTATCAGGATGATGCTGG - Intergenic
1157444817 18:47736776-47736798 GTGCAGGCTGAGGATGCTGCAGG + Intergenic
1157519624 18:48336692-48336714 TTGTAGTCTCAGGAGGCTAACGG - Intronic
1160234107 18:77072117-77072139 TTGAAGGCTCAGGATCCTGCCGG + Intronic
1160560923 18:79755311-79755333 CTGCAGTCTGAGGAGGCTGCAGG + Exonic
1161558060 19:4955523-4955545 GTGACGTCTCAGGATGGTGCAGG + Intronic
1162143121 19:8596442-8596464 TGGGAGGCTCAGGACGGTGCTGG + Intronic
1162152785 19:8657431-8657453 TTGGGGACTCTGGCTGCTGCAGG + Intergenic
1162337519 19:10071014-10071036 TCGGGTTCACAGGATGCTGCAGG + Intergenic
1165723557 19:38096676-38096698 TTGTAGCCACAGCATGCTGCTGG - Intronic
1166133866 19:40763580-40763602 GTGGATTCTCAGAAAGCTGCGGG - Exonic
1166654442 19:44599885-44599907 TTTGTGTCTCTGGATGCGGCTGG + Intergenic
1167046268 19:47050946-47050968 TTTGCTTCTCAGAATGCTGCAGG - Intergenic
1167099811 19:47397625-47397647 TTCGCTTCTCAGAATGCTGCAGG + Intergenic
1167168902 19:47818045-47818067 TTTGAATCTCTGGATGCTTCAGG - Intronic
925241943 2:2339064-2339086 TTGGAGGCTCAGGCTACTGTGGG + Intergenic
926401229 2:12499164-12499186 TTGGTTTGTCAGGATGCTCCTGG - Intergenic
926650936 2:15344667-15344689 TTTTAGTATCAGGATGCTGCTGG - Intronic
928534801 2:32229529-32229551 TTGTAGTCTCAGATTGCTGATGG + Intronic
929280137 2:40069136-40069158 TTTTAGTATCAGGATGATGCTGG + Intergenic
930175678 2:48299175-48299197 TTTCAGTATCAGGATGATGCTGG + Intergenic
933603507 2:84357468-84357490 TTTGGGTATCAGGATGATGCTGG - Intergenic
934775054 2:96932122-96932144 TTGGGGTCTGAGGCTGCTGGCGG - Intronic
934852720 2:97711730-97711752 CTGGAGTTTCAAGATGCCGCTGG + Intergenic
936139942 2:109930680-109930702 TTTGGGTATCAGGATGATGCTGG + Intergenic
936176631 2:110228625-110228647 TTTGGGTATCAGGATGATGCTGG + Intergenic
936204754 2:110440806-110440828 TTTGGGTATCAGGATGATGCTGG - Intronic
936821236 2:116524070-116524092 CTTGAGTATCAGGATGATGCTGG - Intergenic
937121878 2:119446208-119446230 GTGGGGTGTCAGGAGGCTGCTGG - Intronic
937610845 2:123859070-123859092 TTTTAGTATCAGGATGATGCTGG - Intergenic
937791921 2:125971171-125971193 TGGGAGCCTCAGGAAGCTCCTGG + Intergenic
937853821 2:126658256-126658278 TGGGAGTCACATGATGCTGGTGG + Intronic
937978329 2:127594959-127594981 TTTTGGTATCAGGATGCTGCTGG + Intronic
938632752 2:133186441-133186463 TTTTAGTATCAGGATGATGCTGG + Intronic
939192561 2:138932983-138933005 TTTGGGTATCAGGATGATGCTGG - Intergenic
939848976 2:147281245-147281267 TTGTGGTATCAGGATGATGCTGG - Intergenic
940081576 2:149809049-149809071 TTTCACTCTCAGGATGCTGATGG + Intergenic
942085551 2:172440037-172440059 GTGGAGTCTCAGAATTCTTCAGG + Intronic
943548968 2:189315084-189315106 TTTGGGTATCAGGATGATGCTGG - Intergenic
943918879 2:193676612-193676634 TTGTGGTCTCTGGATGCTGTTGG + Intergenic
944163422 2:196691193-196691215 TTTTGGTATCAGGATGCTGCTGG + Intronic
945207575 2:207348106-207348128 TTTCAGTATCAGGATGATGCTGG - Intergenic
947102389 2:226635437-226635459 GTGGAGTCTGAGGCTGCTGTGGG + Intergenic
947752953 2:232542200-232542222 TTGAAGGCCCAGGAGGCTGCAGG - Intronic
1168732300 20:95566-95588 TTTTGGTCTCAGGATGATGCTGG + Intronic
1170092018 20:12599739-12599761 TTGGAGACTCAGAAAGCTGGAGG + Intergenic
1170726992 20:18938340-18938362 TTTTAGTGTCAGGATGATGCTGG + Intergenic
1171936678 20:31280803-31280825 TTTTAGTATCAGGATGATGCTGG - Intergenic
1173445713 20:43116210-43116232 TTTGAGACTCATGATTCTGCAGG - Intronic
1173750812 20:45474661-45474683 TTTTAGTATCAGGATGATGCTGG + Intronic
1175712022 20:61228914-61228936 TTGCAGTCTCTGGACGATGCTGG + Intergenic
1176987291 21:15452318-15452340 TTGTGGTATCAGGATGATGCTGG + Intergenic
1177028412 21:15951668-15951690 TTTGGGTATCAGGATGATGCTGG + Intergenic
1179300655 21:40106456-40106478 TTTGGGTATCAGGATGATGCTGG + Intronic
1179719440 21:43306910-43306932 AGGGGGTCTCAGGATACTGCTGG - Intergenic
1181361326 22:22339503-22339525 TTGGATTGTTAGGATGCTGCAGG - Intergenic
1181374579 22:22446625-22446647 TTGGCCTCTTAGGAAGCTGCAGG - Intergenic
1181630794 22:24150245-24150267 TGTGAGTCTCAGGGCGCTGCAGG + Intronic
1181940412 22:26471440-26471462 TGGAAGTCTGAGGAGGCTGCTGG - Intronic
1182591614 22:31385319-31385341 TTTTAGTGTCAGGATGATGCCGG + Intergenic
1182952302 22:34388840-34388862 TTTGGGTATCAGGATGATGCTGG + Intergenic
1184074501 22:42167606-42167628 TTGGGGTCTCTAGAAGCTGCAGG - Intronic
1184450850 22:44582002-44582024 ATGGAGTCTCAGGAGGAGGCTGG - Intergenic
1184801478 22:46762953-46762975 TTGGACTCTGAGGAGACTGCTGG + Intronic
1185300822 22:50079726-50079748 TTGAAGTCTCGTGATTCTGCGGG - Intronic
949608185 3:5676965-5676987 TTGGCTTCTGAGGAGGCTGCAGG - Intergenic
949955394 3:9263875-9263897 TTTTAGTATCAGGATGATGCTGG - Intronic
950561643 3:13732881-13732903 TTTGGGTATCAGGATGATGCTGG + Intergenic
950751858 3:15135441-15135463 TTGGGATGTTAGGATGCTGCAGG + Intergenic
950947887 3:16969228-16969250 TTGTGGTATCAGGATGATGCTGG + Intronic
951346885 3:21557647-21557669 TTTTAGTATCAGGATGATGCTGG + Intronic
951859299 3:27233774-27233796 TTTTAGTATCAGGATGTTGCTGG - Intronic
953543904 3:43847194-43847216 TTTTAGTATCAGGATGATGCTGG - Intergenic
954528917 3:51300889-51300911 TTTTAGTATCAGGATGATGCTGG + Intronic
954698663 3:52440615-52440637 TCGGAGTCTCTGCTTGCTGCAGG - Intronic
955515923 3:59726292-59726314 TTGGAGGCTGTGGAGGCTGCAGG - Intergenic
955645773 3:61135983-61136005 TTGGAGGCTCATGATCATGCTGG + Intronic
957068755 3:75548863-75548885 TTGGGATGTGAGGATGCTGCAGG - Intergenic
957811296 3:85226103-85226125 TTTTAGTATCAGGATGATGCTGG + Intronic
957908209 3:86584638-86584660 TTTGGGTATCAGGATGATGCTGG - Intergenic
958065537 3:88540823-88540845 GAGGAGGCTCAGGATGGTGCAGG + Intergenic
958440528 3:94150917-94150939 TTGGAGTATAAGGCTGCTTCTGG + Intergenic
958694236 3:97507647-97507669 TTTGGGTATCAGGATGATGCTGG + Intronic
959710396 3:109380142-109380164 TTGGAGTCCCAAGAAGATGCTGG - Intergenic
961088548 3:124090639-124090661 TTGGACTCTCAGGGTGTTGGGGG + Intronic
961347792 3:126275358-126275380 TTGCAGTCTCAAGGTGGTGCTGG - Intergenic
962464375 3:135643005-135643027 TTGGAGTCTCACAATGAGGCGGG + Intergenic
962639813 3:137373788-137373810 TTTCAGTATCAGGATGATGCTGG + Intergenic
964202619 3:154135067-154135089 TTTTAGTATCAGGATGATGCTGG + Intronic
964339210 3:155690620-155690642 TCTGAGTATCAGGATACTGCTGG + Intronic
965017042 3:163171305-163171327 TTTGAGTATCACGATGATGCTGG + Intergenic
965097927 3:164258038-164258060 TTTTAGTATCAGGATGATGCTGG - Intergenic
965440347 3:168705109-168705131 TTGGAGTTCCAGGACACTGCTGG - Intergenic
965765851 3:172129159-172129181 ATGGAGTCTCACTATGTTGCTGG + Intronic
965817858 3:172655439-172655461 ATGGAGTATCAGTATGCTACTGG + Intronic
966543410 3:181117149-181117171 GTTGAGTCTCAGGATGTTGCAGG + Intergenic
968436804 4:596248-596270 TTTGGGTATCAGGATGATGCTGG + Intergenic
969013083 4:4083400-4083422 TTGGGATGTGAGGATGCTGCAGG - Intergenic
969188595 4:5498939-5498961 TTGCAGGCTCAGGAGGCAGCAGG + Exonic
969499785 4:7545668-7545690 TTGGAGTCTGCTGATGCAGCGGG - Intronic
969740760 4:9024390-9024412 TTGGGATGTGAGGATGCTGCAGG + Intergenic
969800099 4:9557222-9557244 TTGGGATGTGAGGATGCTGCAGG + Intergenic
970092669 4:12427705-12427727 TGGGATTCTCAGGCTGGTGCTGG + Intergenic
970101503 4:12527804-12527826 TTTTAGTATCAGGATGATGCTGG - Intergenic
971193300 4:24447849-24447871 ATGAAGTCTCTAGATGCTGCAGG - Intergenic
971557390 4:28031276-28031298 TTTTAGTATCAGAATGCTGCTGG + Intergenic
971734217 4:30425358-30425380 TTTTGGTCTCAGGATGATGCTGG - Intergenic
973714888 4:53666295-53666317 TTTTAGTATCAGGATGATGCTGG + Intronic
973781778 4:54294716-54294738 TTGGATGCTCAGGAGGCTTCCGG + Intronic
973798130 4:54449594-54449616 TTGGAGTCCCAGATTGTTGCGGG + Intergenic
974912918 4:68145385-68145407 TTTCAGTATCAGGATGATGCTGG + Intergenic
975380611 4:73696499-73696521 TTGTACTCTCAGAATCCTGCAGG + Intergenic
978023754 4:103847158-103847180 TTGTAGAATCAGGATGATGCTGG - Intergenic
978657180 4:111078209-111078231 TTTGGGTATCAGGATGATGCTGG - Intergenic
979583553 4:122388353-122388375 TTTTAGTATCAGGATGATGCTGG + Intronic
980769648 4:137354517-137354539 TTTCAGTATCAGGATGATGCTGG - Intergenic
981388630 4:144161284-144161306 TTTTAGTATCAGGATGATGCTGG + Intergenic
981627327 4:146773724-146773746 TTATAGTATCAGGATGATGCTGG + Intronic
982647391 4:158041205-158041227 TTTGAGTATCAGGATAATGCTGG - Intergenic
983972047 4:173887575-173887597 TTTGGGTATCAGGATGATGCTGG + Intergenic
985108440 4:186521544-186521566 TAGGCGTCTCATGATTCTGCAGG - Intronic
985686607 5:1284762-1284784 GTGGGGTGTCCGGATGCTGCAGG - Intronic
985867335 5:2524320-2524342 GAGGAGTCTCAGGAGGATGCGGG - Intergenic
986286905 5:6365808-6365830 TGTGAGTCACAGGATGCTGCTGG + Intergenic
987665327 5:20931094-20931116 TTGGATTCTCCGAATGCTGAGGG - Intergenic
987669493 5:20988935-20988957 TTGTGGTATCAGGTTGCTGCTGG - Intergenic
989324803 5:40179612-40179634 TTTTAGTATCAGGATGATGCTGG - Intergenic
992164402 5:74034872-74034894 TTGGAGTGCAATGATGCTGCAGG + Intergenic
992254463 5:74907725-74907747 TTTCAGTATCAGGATGATGCTGG + Intergenic
992792960 5:80230103-80230125 TTGGAGGCTCAGCCTGCTCCAGG + Intronic
993911890 5:93693712-93693734 GTTGTGTCTCAGGATGATGCTGG - Intronic
994055002 5:95405145-95405167 TTGGAGCCTAAGAATACTGCTGG + Intronic
994470246 5:100194608-100194630 TTTCAGTGTCAGGATGATGCTGG - Intergenic
994917712 5:106001530-106001552 TTGTGGTATCAGGATGATGCTGG + Intergenic
995109152 5:108409066-108409088 TGGGGGTCTCAGTATGTTGCAGG - Intergenic
995400718 5:111738215-111738237 TTAGAGTCTCAAAATACTGCAGG - Intronic
996622578 5:125526266-125526288 ATTGAGTCTCATGATGTTGCAGG + Intergenic
996641161 5:125755398-125755420 TTGGATTCTTAGGCTGCTGGGGG + Intergenic
998831693 5:146166512-146166534 ATGGAGTCTCACTATGTTGCTGG - Intronic
998873020 5:146571519-146571541 TTTGAATATCAGGATGATGCAGG + Intergenic
999231977 5:150066950-150066972 TTGGAGGATGAGGATGCAGCAGG - Intronic
1000582440 5:163050495-163050517 TTTTAGTATCAGGATGATGCTGG - Intergenic
1001872664 5:175170374-175170396 TTGGAGTATCAGGATGCTGTGGG + Intergenic
1002612705 5:180431970-180431992 TTGGTGTCTCCTGAAGCTGCTGG + Intergenic
1005283037 6:24294972-24294994 TTTGGGTATCAGGATGATGCTGG - Intronic
1005795096 6:29351694-29351716 TTTTAGTATCAGGATGATGCTGG + Intergenic
1007216066 6:40239207-40239229 TTTTAGTATCAGGATGATGCTGG - Intergenic
1007339148 6:41179424-41179446 CTGGAGTCCCAGGAGGCTTCAGG - Intergenic
1008332119 6:50257976-50257998 TTTTAGTATCAGGATGATGCTGG + Intergenic
1011339890 6:86302535-86302557 TTTGGGTATCAGGATGATGCTGG + Intergenic
1011393758 6:86883411-86883433 TTTGGGTATCAGGATGATGCTGG + Intergenic
1012267050 6:97157805-97157827 TTTTAGTATCAGGATGATGCTGG + Intronic
1012817346 6:104040751-104040773 TTTGAGTATCAGGGTGATGCTGG - Intergenic
1013423497 6:109988527-109988549 TTTGGGTATCAGGATGATGCTGG + Intergenic
1013525694 6:110971781-110971803 TTGAAGTCCAAGAATGCTGCTGG - Intergenic
1013930056 6:115519749-115519771 TTTCAGTATCAGGATGATGCTGG - Intergenic
1013957507 6:115857626-115857648 TTTTGGTCTCAGGATGATGCTGG - Intergenic
1015715427 6:136187570-136187592 TGGGAATCCCAGGATGCGGCGGG - Intronic
1015902222 6:138079601-138079623 TTTTAGTATCAGGATGATGCTGG - Intergenic
1016847625 6:148584406-148584428 TTTTGGTATCAGGATGCTGCTGG + Intergenic
1017615009 6:156237239-156237261 TTTGGGTATCAGGATGATGCTGG + Intergenic
1017649760 6:156570185-156570207 TCGGAGTCTCTGGTTGCTTCTGG - Intergenic
1017968340 6:159286992-159287014 TTGTGGTATCAGGATGATGCTGG + Intergenic
1020110630 7:5446059-5446081 CTGGAGCCTCGGGAAGCTGCAGG + Intronic
1021202054 7:17738343-17738365 CTGCAGTATCAGGATGATGCTGG - Intergenic
1021520311 7:21533265-21533287 TTTTAGTATCAGGATGATGCTGG + Intergenic
1022885231 7:34636528-34636550 TTTTAGTATCAGGATGATGCTGG - Intergenic
1023363227 7:39437107-39437129 TTGTGGTATCAGGATGGTGCTGG + Intronic
1023740504 7:43277024-43277046 TTGGATTTTCAGGATGCTCAGGG + Intronic
1023761009 7:43465325-43465347 GTGGTTCCTCAGGATGCTGCTGG + Intronic
1024417316 7:49121835-49121857 TTGGGGTCACAGGATGCTTTTGG - Intergenic
1024445760 7:49476603-49476625 TTTTAGTGTCAGGATGATGCTGG + Intergenic
1024590306 7:50876034-50876056 TTTTAGTATCAGGATGATGCTGG - Intergenic
1024789023 7:52941200-52941222 TTGGAGTCACCTGATGCTCCTGG - Intergenic
1027357038 7:77367687-77367709 TTTCAGTATCAGGATGATGCTGG + Intronic
1028345966 7:89783001-89783023 TTTTAGTCACAGGATGATGCTGG + Intergenic
1029071736 7:97905037-97905059 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1032003220 7:128280040-128280062 TTTTAGTATCAGGATGATGCTGG + Intergenic
1032659396 7:133966812-133966834 TTTGTGTATCAGGATGATGCTGG + Intronic
1034365827 7:150546302-150546324 TTTTAGTATCAGGATGATGCTGG - Intergenic
1034636459 7:152571224-152571246 TGGGAGTCTCAGGCAGCAGCTGG + Intergenic
1035103310 7:156419215-156419237 TTGGAGTCTCTGAAAGCTTCTGG + Intergenic
1035130414 7:156647352-156647374 TTGGAGACTCAGGAGGCGGAGGG - Intronic
1035696173 8:1598350-1598372 TTGTGGTATCAGGATGATGCTGG + Intronic
1036245965 8:7116957-7116979 TTGGGATGTGAGGATGCTGCAGG + Intergenic
1036888305 8:12577070-12577092 TTGGGATGTGAGGATGCTGCAGG - Intergenic
1037174130 8:15927263-15927285 TTGTAGTGTCAGAATGATGCAGG + Intergenic
1039303586 8:36236771-36236793 TTGAAGTGTAAGGATGCTGAAGG + Intergenic
1039886952 8:41660272-41660294 TTGGTGGCTCAGGAGGCAGCGGG + Intronic
1039948981 8:42153170-42153192 GCGGGGTCTCAGGATGCAGCCGG + Intronic
1040760469 8:50835890-50835912 TTTGGGTATCAGGATGATGCTGG - Intergenic
1040776069 8:51044617-51044639 TTGGAGTCTCTGAGTGCTCCTGG - Intergenic
1042761132 8:72272518-72272540 TCTTAGTCTCAGGATTCTGCTGG - Intergenic
1043552495 8:81390534-81390556 TAGAAGTCACATGATGCTGCTGG + Intergenic
1043748579 8:83906963-83906985 TTTTTGTATCAGGATGCTGCTGG + Intergenic
1043846700 8:85171794-85171816 TGAGGGTCTCAGGAGGCTGCTGG + Intergenic
1044862539 8:96536846-96536868 TTGGAGACTCAGTCTGCTGTTGG + Intronic
1045200012 8:99970884-99970906 TTGTGGTATCAGGATGATGCTGG - Intronic
1045212439 8:100112249-100112271 TTGTGGTATCAGGATGATGCTGG - Intronic
1045212861 8:100116917-100116939 TTTTAGTATCAGGATGATGCTGG - Intronic
1049360322 8:142209688-142209710 GTGGAGGCTCAGGCTGCTGTGGG - Intergenic
1049439674 8:142603546-142603568 TTGGAGGCTGAGGCTGATGCCGG - Intergenic
1049987651 9:967067-967089 TTTCAGCCTCAGGATTCTGCCGG - Intronic
1051089586 9:13390614-13390636 TTTTGGTCTCAGGATGCTGCTGG - Intergenic
1051523763 9:18019749-18019771 TTGGAATCTCAGAATTCTACTGG + Intergenic
1053930900 9:43112901-43112923 TTGGAAAATCAGGAGGCTGCTGG - Intergenic
1054811889 9:69441676-69441698 TTGGAGTCCCTGGTTGCTGTGGG - Intronic
1058092905 9:100825928-100825950 TTTTAGTATCAGGATGATGCTGG + Intergenic
1058112823 9:101050097-101050119 TTGGAGTCTCACTCTGTTGCAGG - Intronic
1058375161 9:104314470-104314492 TTGAAGTCTTAGGATGTGGCTGG - Intergenic
1058517123 9:105787557-105787579 TTGGTGTATCAGGATGATGCTGG + Intergenic
1059060108 9:111027013-111027035 TTTTAGTATCAGGATGATGCTGG + Intronic
1060777731 9:126388645-126388667 TTGGAATCTAAGGACACTGCTGG - Intronic
1062094996 9:134698562-134698584 TGGAAGCCTCAGGATGCTGTGGG + Intronic
1062669102 9:137695842-137695864 GTGGAGTCTCAGAGTACTGCTGG + Intronic
1186037238 X:5437813-5437835 TTGGCTACTCAGGATGCTGATGG - Intergenic
1186390677 X:9155662-9155684 CTGGAGTCTCAGGATACTTCTGG - Intronic
1186679132 X:11853886-11853908 TTTGGGTATCAGGATGATGCTGG - Intergenic
1188628092 X:32313093-32313115 TTTTGGTATCAGGATGCTGCTGG - Intronic
1188725203 X:33574402-33574424 TTTTAGTATCAGGATGATGCTGG + Intergenic
1189041000 X:37542368-37542390 CTGGAGTCTTGGGAGGCTGCAGG + Intronic
1189300477 X:39948716-39948738 TGGGAGTCTCCGGGAGCTGCCGG + Intergenic
1189895760 X:45654500-45654522 TTTGGGTATCAGGATGATGCTGG + Intergenic
1189939123 X:46103091-46103113 TTTTGGTATCAGGATGCTGCTGG + Intergenic
1191061771 X:56305656-56305678 TTTTAGTATCAGGATGATGCTGG + Intergenic
1191132972 X:57034541-57034563 TTTGGGTATCAGGATGATGCTGG + Intergenic
1191651457 X:63542588-63542610 TTTTAGTATCAGGATGATGCTGG - Intergenic
1192330758 X:70173449-70173471 TAGGAGTCTCAGGTTGGTGGAGG - Intergenic
1192433004 X:71125321-71125343 CTGGAGTCTGATGGTGCTGCTGG + Intronic
1193035712 X:76948880-76948902 TTTTAGTATCAGGATGATGCTGG + Intergenic
1193780494 X:85695669-85695691 TTTGGGTATCAGGATGATGCTGG + Intergenic
1193879019 X:86898939-86898961 TTTGGGTATCAGGATGATGCTGG + Intergenic
1193899083 X:87153270-87153292 TTTCGGTATCAGGATGCTGCTGG + Intergenic
1194021675 X:88699060-88699082 TGTGAGTATCAGGATGATGCTGG + Intergenic
1194228848 X:91296999-91297021 TTTTAGTATCAGGATGATGCTGG + Intergenic
1194418786 X:93646910-93646932 TTTGGGTATCAGGATGATGCTGG + Intergenic
1194462719 X:94192464-94192486 TTGGAGTCTAAGGGTGCTTTTGG - Intergenic
1194540233 X:95160844-95160866 TTTTAGTATCAGGATGATGCTGG - Intergenic
1195213870 X:102677231-102677253 TTTGGGTATCAGGATGATGCTGG + Intergenic
1195685940 X:107585928-107585950 TTTGAGTATCAGGATGATGCTGG + Intronic
1196391956 X:115217056-115217078 TCTGAGTCTCAGGGTTCTGCAGG - Intronic
1196516137 X:116614444-116614466 TTTGGGTATCAGGATGATGCTGG - Intergenic
1197191428 X:123651954-123651976 TTTTAGTATCAGGATGATGCTGG - Intronic
1197243682 X:124146580-124146602 TTTAGGTGTCAGGATGCTGCTGG + Intronic
1197368072 X:125591253-125591275 TTGAAGTCTGAGGATGCCGTGGG - Intergenic
1198789958 X:140334227-140334249 TTTTAGTATCAGGATGATGCTGG - Intergenic
1199007630 X:142720913-142720935 TTTTGGTATCAGGATGCTGCTGG - Intergenic
1199477211 X:148259009-148259031 TTGTGGTATCAGGATGATGCTGG + Intergenic
1200813834 Y:7511422-7511444 TTTTAGTATCAGGATGATGCTGG + Intergenic
1201520420 Y:14867258-14867280 TTTTAGTATCAGGATGATGCTGG - Intergenic
1202335326 Y:23802842-23802864 TTTTAGTATCAGGATGATGCTGG - Intergenic
1202357001 Y:24062285-24062307 TTTCAGTATCAGGATGATGCTGG - Intergenic
1202513776 Y:25607829-25607851 TTTCAGTATCAGGATGATGCTGG + Intergenic
1202535441 Y:25867217-25867239 TTTTAGTATCAGGATGATGCTGG + Intergenic