ID: 1141394737

View in Genome Browser
Species Human (GRCh38)
Location 16:83694645-83694667
Sequence GGTGACATGGGCCAGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141394731_1141394737 15 Left 1141394731 16:83694607-83694629 CCCACACTAAAGAGTGTCTCTGT 0: 1
1: 0
2: 1
3: 14
4: 149
Right 1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 175
1141394732_1141394737 14 Left 1141394732 16:83694608-83694630 CCACACTAAAGAGTGTCTCTGTC No data
Right 1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG 0: 1
1: 0
2: 1
3: 13
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141394737 Original CRISPR GGTGACATGGGCCAGCAACC AGG Intronic
901049152 1:6417716-6417738 GGTGGCATGTGCCAGCTACTCGG - Exonic
902648242 1:17819076-17819098 GGTCACTTGGGCCACCAACCTGG + Intronic
902822597 1:18952317-18952339 GGTGACTGGGGCCAGGACCCAGG + Intronic
903671307 1:25037370-25037392 GGTGAGATCGGCCATCAGCCAGG + Intergenic
905796787 1:40820323-40820345 GGGGACATGGGTCAGCACACAGG - Intronic
905927335 1:41760811-41760833 AGTGACAAGGCCCAGCCACCTGG + Intronic
905953859 1:41975766-41975788 GGTGATATGGACCAGAATCCTGG + Intronic
915467910 1:156108164-156108186 GCTGCCATGTGCCAGCAACCAGG - Intronic
919854601 1:201696552-201696574 GGAGTCATGGGCCACCAGCCAGG - Intronic
920218822 1:204380481-204380503 GGTGACAGGGGACTGCAGCCTGG - Intergenic
920416106 1:205800257-205800279 GGTGGCATGGGCCAGAAGTCGGG + Intronic
920653011 1:207852743-207852765 GGGGAGCTGGGCCAGCAACTTGG - Intergenic
920932004 1:210397795-210397817 GGTGACATGGCCCAGCAGGGTGG - Intronic
922783741 1:228272947-228272969 GGAGAGATGGACCAGCAACCTGG - Intronic
1063447309 10:6127531-6127553 GGTCACAAGGGCCAGCCTCCAGG + Intergenic
1064266830 10:13832137-13832159 GGTGAGCTGGGCCGGCAACTCGG - Intronic
1067420900 10:46146325-46146347 GGGGACATGTGCCATCTACCTGG + Intergenic
1067506239 10:46852790-46852812 GGGGACATGTGCCATCTACCTGG + Intergenic
1070680873 10:78448206-78448228 GCTCACATGGGTCAGGAACCTGG + Intergenic
1070858723 10:79630559-79630581 GGGGACATGTGCCATCTACCTGG + Intergenic
1072613674 10:97035495-97035517 GGTGACCAGGGCCACCAGCCAGG - Intronic
1074547421 10:114412185-114412207 CGTGACATGGGCAAGCACACTGG - Intergenic
1075960564 10:126564115-126564137 GGAGACATGGACCAGGAACAGGG + Intronic
1076930155 10:133527129-133527151 AGTGACAGGTGCTAGCAACCAGG + Intronic
1077137004 11:1005225-1005247 AGTGACACGGGCCAGACACCTGG + Intronic
1079100195 11:17536530-17536552 GCTGACAAGGGCCAGGAGCCCGG - Intronic
1080824749 11:35838301-35838323 GCTGAATTGGGCCAGCAACCGGG + Intergenic
1081656436 11:44860749-44860771 AGGGGCATGGGCCAGCAACCTGG - Intronic
1083811419 11:65108799-65108821 GGCCACATTGGCCAGCAACTCGG - Exonic
1084160799 11:67348896-67348918 GGTGAGGAGGGCCAGGAACCAGG - Intronic
1084552319 11:69852140-69852162 AGGGACATGGGGCAGCATCCTGG + Intergenic
1085031489 11:73273602-73273624 GGGGCCATGGTCCAGAAACCTGG + Intronic
1086391734 11:86371882-86371904 GTAGGCATGGGCCAGCAGCCTGG - Intergenic
1088738658 11:112749092-112749114 TGTGACATGGGCCAGGAGGCAGG - Intergenic
1090457734 11:126864437-126864459 GGTGACATGTGACAGCCACATGG + Intronic
1093096369 12:14976284-14976306 GGTGAGATTGGCCAGGACCCTGG - Intronic
1095840035 12:46682945-46682967 GGTGACATCATCCAGCACCCAGG - Intergenic
1102936100 12:116898383-116898405 GGAGAAATGGGCCAGACACCCGG - Intergenic
1103097626 12:118144725-118144747 GGTAACACGTGCCAGCCACCGGG - Exonic
1104419173 12:128621112-128621134 GTTCACATGGGCCAGCCCCCAGG - Intronic
1104896588 12:132167862-132167884 GGTCACGTGGGCCAGAACCCAGG + Intergenic
1107015498 13:35705469-35705491 GCTGACATGGGCCAGGACCTAGG + Intergenic
1107792966 13:44020629-44020651 GGTGAGATGGGCCAGAAATGTGG - Intergenic
1110060320 13:71031877-71031899 TGTAATATGGGCCAGAAACCTGG + Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1113636796 13:111925034-111925056 GGGGAAATGGCCCAGCAATCTGG - Intergenic
1118527522 14:66662258-66662280 GGTTGTTTGGGCCAGCAACCAGG + Intronic
1119294311 14:73520795-73520817 GGGGACATGGGCCAGGAAGGTGG - Intronic
1119911002 14:78349271-78349293 GGTAACATTGGCCGGCAACTTGG - Intronic
1120709870 14:87781822-87781844 GACAACATGGGCCACCAACCTGG - Intergenic
1122022268 14:98848033-98848055 GGTCACATGTTCCAGAAACCTGG - Intergenic
1123939165 15:25208469-25208491 GGTGTCATGGGCCATGAGCCAGG + Intergenic
1123947492 15:25245867-25245889 GGGGTCATGGGCCATCAGCCAGG + Intergenic
1125185261 15:36922744-36922766 GGTGGCATGCGCCAGCTACTCGG - Intronic
1131806445 15:96127107-96127129 GGTGAAATGGGCCACCATCTGGG - Intergenic
1133046749 16:3092378-3092400 GGGGACATGGGACAGAAACGAGG + Intronic
1133548161 16:6828108-6828130 GGTGGCATGGGACAGCAGTCAGG + Intronic
1136380714 16:29893766-29893788 GGGGAAATGGGCCAGAGACCAGG - Intronic
1136514544 16:30760262-30760284 GGTGAGAGGGGGCAGCTACCAGG - Exonic
1138495174 16:57404444-57404466 GGTTACTAGGGCCAGAAACCTGG - Intergenic
1138569252 16:57857950-57857972 GGTGGCATGTGCCAGCTACTCGG - Intronic
1140250758 16:73292379-73292401 GCTGCCATGGGCCATCACCCTGG - Intergenic
1141394737 16:83694645-83694667 GGTGACATGGGCCAGCAACCAGG + Intronic
1141506566 16:84482113-84482135 GGTGACATGGCACAGGAAGCAGG - Intronic
1143341371 17:6213977-6213999 GGGGACATGGCCCATCAGCCTGG - Intergenic
1143870960 17:9957019-9957041 AGTGTCCTGGGCCAGCAGCCAGG + Intronic
1144804923 17:17958705-17958727 GGTGAGGTGTGCCAGGAACCTGG - Intronic
1147634477 17:41955022-41955044 GGTGACATAGCCCAGGAACACGG + Intronic
1148731399 17:49838944-49838966 GGTGACATGGACTAGGAAGCAGG + Intronic
1150430544 17:65112268-65112290 GGAGCCATGTGCCAGGAACCAGG + Intergenic
1152406789 17:80102327-80102349 GGTGCTATGTGCCAGCAACCAGG - Intergenic
1153653337 18:7260882-7260904 GGTGTCATGGGCTATGAACCTGG - Intergenic
1156466911 18:37353539-37353561 GGGGACTTGGGTCAGCAAGCAGG + Intronic
1160376801 18:78419978-78420000 GGTGACATTTGCCAGAAACCGGG + Intergenic
1161486450 19:4538420-4538442 GGTGAAGTTGGCCAGCAGCCCGG + Exonic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1161686339 19:5704472-5704494 GGGGTCCTGGGCCAGCAGCCAGG + Intronic
1162038958 19:7957897-7957919 GCTAACATGGGCCCGCAGCCCGG - Intergenic
1164386357 19:27773852-27773874 AGTGACAAGGGACAGCCACCTGG - Intergenic
1164452110 19:28375339-28375361 GGTGAAATGGGCCAGCAGGTGGG - Intergenic
1165099262 19:33428745-33428767 GGTGACATGGGCCTGCCTCTAGG - Intronic
1165904504 19:39185440-39185462 GATGAGATGGGGCAGCAAGCAGG + Intergenic
1166140353 19:40802111-40802133 AGAAACATGGGCCAGCAAACAGG - Intronic
1166177138 19:41082121-41082143 GGTTCCTTGGGCCTGCAACCAGG + Intergenic
1166194771 19:41198480-41198502 GGTGGCCTGGGCCAGCAGCAGGG - Exonic
1167818260 19:51903472-51903494 GGAGACATGTGCCAGGAAACAGG + Intronic
1168108769 19:54180554-54180576 GGTGACAAGCGCTAGCAACAAGG + Intronic
925019125 2:554629-554651 GGTGACATGGGCCTGCTCCGCGG + Intergenic
926223784 2:10953349-10953371 TGTGACAGGGGCCAGCAGCAGGG + Intergenic
927210394 2:20635651-20635673 GGCGACATGGAGCAGCAATCGGG + Intronic
927413156 2:22849518-22849540 GGTGACATGGCCCAGAGCCCAGG + Intergenic
928428740 2:31200534-31200556 GGTGACAATGACCATCAACCTGG - Exonic
929278244 2:40048789-40048811 GGTGACTTGGGCCAGGGACCTGG + Intergenic
932013382 2:68000265-68000287 GGAGATAGGGCCCAGCAACCTGG - Intergenic
933712981 2:85341331-85341353 GGTAACACGTGCCAGCCACCGGG + Intergenic
935351357 2:102154223-102154245 GGTGACCTGGGAAAGCAAACAGG - Intronic
939643120 2:144664345-144664367 GTTAGCATGGGCCAGCAAGCTGG + Intergenic
941330524 2:164173582-164173604 GGTGAGATCCGCCAGCTACCTGG - Intergenic
944662663 2:201934221-201934243 GCTGTCATGGGCCTGCATCCTGG + Intergenic
944868167 2:203882491-203882513 GGGGGCATGCGCCAGCAACTCGG + Intergenic
948479199 2:238239793-238239815 GGGGCCATGGGCGAGCAAGCGGG - Intronic
1169474147 20:5915846-5915868 GGTGGCACGCGCCAGCTACCTGG - Intronic
1172686008 20:36755038-36755060 GGTTACATGGGTCAGCCTCCTGG - Intronic
1173132538 20:40408231-40408253 GGTGACATGTCCCAGAAATCAGG + Intergenic
1174323727 20:49762477-49762499 GATGACATGGGCGCACAACCAGG - Intergenic
1177417104 21:20808041-20808063 GGTGACACAAGCAAGCAACCTGG + Intergenic
1179241590 21:39597745-39597767 GATGAGATGGGCCATGAACCAGG + Exonic
1179391854 21:41000800-41000822 GATGACATAGGTCAGAAACCAGG - Intergenic
1179623201 21:42632391-42632413 TGAGACATGGGGCAGCCACCGGG - Intergenic
1179713009 21:43273826-43273848 GGTGAGAGGGGCCAGAAACCAGG - Intergenic
1179995512 21:44972255-44972277 GTTCACATGGGACAGCGACCTGG - Intronic
1181111488 22:20605445-20605467 GGTGCCATGGGCCCGCAGCTTGG + Intergenic
1181171453 22:21012436-21012458 GGTGACATGGCCCAGCTTTCAGG + Intronic
1182042405 22:27248705-27248727 GGGGACATGGGTCAGAACCCAGG - Intergenic
1185273326 22:49938460-49938482 GGGGCCACGGGCCAGGAACCGGG + Intergenic
954428924 3:50458913-50458935 GGTGGGCTGGGCCAGAAACCCGG - Intronic
954610837 3:51943794-51943816 GGGGACATGGGCAAGCGCCCAGG - Intronic
956694458 3:71906761-71906783 GGTGGCATGCACCAGCAGCCTGG - Intergenic
962347549 3:134629495-134629517 AGTGACATGGGCCTGCAAACTGG - Intronic
965603904 3:170481148-170481170 GCTGACGTGAGCCAGGAACCTGG + Exonic
965739985 3:171864189-171864211 GGTGACACAGTCCAGCAGCCGGG - Intronic
966444915 3:179991186-179991208 GGTCAAATGGGCAAGCATCCGGG - Intronic
966931579 3:184678942-184678964 GGTCACACGGTCCAGCAAGCTGG - Intronic
967558988 3:190895991-190896013 GGTTTCATGGGCCAGGACCCTGG + Intergenic
968003119 3:195221326-195221348 GGTGGCATGGTCCAGCAATGAGG - Intronic
969197797 4:5576935-5576957 AGTGACAGGTGCCAGCCACCAGG - Intronic
969330231 4:6470613-6470635 CGAGGCACGGGCCAGCAACCCGG + Intronic
974039769 4:56847371-56847393 GGTGACTTGGGCTAACAGCCAGG - Intergenic
976896266 4:90115812-90115834 GGGGAGATCGGCCAGCTACCAGG + Intergenic
977529286 4:98181248-98181270 GGTGGCATGTGCCAGCTACTAGG - Intergenic
978422430 4:108546900-108546922 GATGCCATGGGCCAGTCACCAGG - Intergenic
979077777 4:116296743-116296765 AGTGTCATGGGCCTGGAACCAGG - Intergenic
985018317 4:185660760-185660782 GGCCACAGGGGCCAGCAACAGGG - Intronic
985646769 5:1088661-1088683 GGTGTCATGGGGCGGCACCCGGG - Intronic
991563023 5:67974292-67974314 AGTAACATGTGCCAGAAACCTGG + Intergenic
992846531 5:80754999-80755021 TGTTCCATGAGCCAGCAACCGGG + Intronic
998561078 5:143172210-143172232 GGTGACATGTGCCAGGTATCTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
999261279 5:150240397-150240419 GGTGGAATAGGCCAGCCACCAGG - Intronic
1000046214 5:157524005-157524027 CGTGACATGGGCAAATAACCAGG - Intronic
1000209282 5:159096029-159096051 GGGGCCATGGGCCTGCAGCCTGG + Intronic
1001470253 5:172006741-172006763 GCTGCCAAGAGCCAGCAACCTGG - Intronic
1001697592 5:173683578-173683600 GGTGACTGGGCCCAGCAAGCTGG + Intergenic
1002644841 5:180648058-180648080 GGAGACATGGGACAGGCACCTGG - Intronic
1006137022 6:31901642-31901664 GGTGAGAAGAGCCTGCAACCGGG - Intronic
1008434307 6:51457068-51457090 GGTGACTTGAGCCATCAACCAGG - Intergenic
1011391206 6:86855272-86855294 GGTGTTATGGGCCAGGAACTGGG + Intergenic
1011869515 6:91875136-91875158 GATGACAAGCGCCAGCAACGTGG - Intergenic
1012519676 6:100106149-100106171 GGCCACATGGGGAAGCAACCAGG + Intergenic
1017000706 6:149995513-149995535 GGTGACCTGGGCCAGTGACTGGG - Intergenic
1017002652 6:150006561-150006583 GGTGACCTGGGCCAGTGACTGGG + Intergenic
1017005883 6:150027769-150027791 GGTGACCTGGGCCAGTGACCGGG + Intergenic
1017012256 6:150070562-150070584 GGTGACCTGGGCCAGTGACTGGG + Intergenic
1017648684 6:156562231-156562253 GGTGGCATGGGACAGCTGCCTGG + Intergenic
1018939707 6:168301123-168301145 TGTGACAGCGGCCAGCGACCGGG + Intronic
1019155315 6:170034542-170034564 GGTGATCTGTGCCAGCAGCCAGG - Intergenic
1020093563 7:5355084-5355106 ACTGACATGGGCCAGAACCCAGG + Intronic
1024783786 7:52882871-52882893 GTTGACATGAGCCAGCAACCAGG + Intergenic
1026723864 7:72855606-72855628 CGTGACATGGGCCTGCAGCTGGG - Intergenic
1028263039 7:88687040-88687062 GTAGTCAGGGGCCAGCAACCCGG + Intergenic
1031186083 7:118481672-118481694 GGTTTCATGGGCCAGCCACAGGG - Intergenic
1032110903 7:129074401-129074423 GGTTACCTGGGCCAGCCAGCTGG - Intergenic
1032584528 7:133134240-133134262 GATGAAATGGGACAGCCACCCGG - Intergenic
1034213509 7:149385127-149385149 GGTGACATGGGGCCGCCACCTGG - Intergenic
1034302994 7:150032453-150032475 GGTCACATGGCCCAGCCACTTGG - Intergenic
1034803053 7:154064815-154064837 GGTCACATGGCCCAGCCACTTGG + Intronic
1035292027 7:157845405-157845427 GGTGAGTTAGGCCAGTAACCTGG - Intronic
1035565491 8:638081-638103 GGTGACCTGGGGCAGCAGTCAGG + Intronic
1035758447 8:2051511-2051533 GGTGACATGAGGCAGGCACCTGG - Intronic
1039474427 8:37832185-37832207 GGTGGCACAGGCCAGCTACCGGG - Intronic
1039800075 8:40946452-40946474 GCAGACATGGGCCAGCTGCCAGG + Intergenic
1040310111 8:46232458-46232480 GGTGACGTGGGCAAGCCACAGGG + Intergenic
1042873610 8:73420180-73420202 GATGACGTTGGCCAGGAACCCGG + Intergenic
1047686325 8:127308240-127308262 GCGGCCATGGGCCAGCAGCCTGG + Intergenic
1053194356 9:36104469-36104491 GGTGGCATGTGCCAGCTACTCGG - Intronic
1058617770 9:106851872-106851894 GGTTACAGGCGCCTGCAACCAGG - Intergenic
1059755711 9:117291395-117291417 GGTGGCTTGGGCCAGCTGCCCGG + Exonic
1061146652 9:128803487-128803509 CCTGACACGGGCCAGCAACGAGG - Intronic
1185525560 X:775698-775720 GATGACAGGGGCAAGCCACCGGG - Intergenic
1186453472 X:9692290-9692312 GGTAAAATCGGCCAGCCACCAGG + Intronic
1188597720 X:31921966-31921988 GGTGTTATGAGCCAGGAACCTGG - Intronic
1190140144 X:47835958-47835980 GGTGATATGGAGCAGCAAACTGG + Intergenic
1192528696 X:71868912-71868934 GGTCATCTGGGCCAGAAACCGGG - Intergenic
1193595475 X:83439597-83439619 GGTGACATGGGCCCACAAGTGGG + Intergenic
1196277236 X:113780893-113780915 GATGACATGGGCCAGCTGCTTGG + Intergenic
1197655990 X:129116336-129116358 GGTGATCTGGGCCTGCAAACAGG + Intergenic
1199218284 X:145286481-145286503 GGTGATATGTGCCAGCTACTTGG + Intergenic
1199842608 X:151665462-151665484 GGTGCCATGTATCAGCAACCTGG + Intronic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1201618225 Y:15925491-15925513 GAAGACATGTGACAGCAACCAGG - Intergenic