ID: 1141397608

View in Genome Browser
Species Human (GRCh38)
Location 16:83718789-83718811
Sequence AATCATGTGAAACTACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 2, 1: 2, 2: 38, 3: 65, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141397604_1141397608 17 Left 1141397604 16:83718749-83718771 CCCCTAGCTTCTGCAGCTATTTC 0: 7
1: 13
2: 28
3: 44
4: 216
Right 1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG 0: 2
1: 2
2: 38
3: 65
4: 169
1141397605_1141397608 16 Left 1141397605 16:83718750-83718772 CCCTAGCTTCTGCAGCTATTTCA 0: 11
1: 18
2: 32
3: 60
4: 708
Right 1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG 0: 2
1: 2
2: 38
3: 65
4: 169
1141397606_1141397608 15 Left 1141397606 16:83718751-83718773 CCTAGCTTCTGCAGCTATTTCAA 0: 11
1: 12
2: 24
3: 47
4: 265
Right 1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG 0: 2
1: 2
2: 38
3: 65
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141397608 Original CRISPR AATCATGTGAAACTACTGCC TGG Intronic
901410881 1:9083362-9083384 AGTCATGCAAAACTGCTGCCTGG - Intronic
901766780 1:11505158-11505180 AATCACCTGAAAATACTGCCAGG - Intronic
901939752 1:12652939-12652961 AGTCATGTGAAACCGCTGCCTGG + Intronic
901940470 1:12657949-12657971 CATTGTGTGAAACTGCTGCCTGG + Intronic
902355770 1:15898701-15898723 AGGCATGTGCAACTACCGCCTGG + Intronic
903567534 1:24279304-24279326 AGGCATGTGCCACTACTGCCCGG - Intergenic
903955375 1:27021862-27021884 AGTCATGTGAAACTGCTGTCTGG - Intergenic
903956218 1:27027872-27027894 AGTCATGTGAAACTGCTGCCTGG - Intergenic
904111876 1:28132459-28132481 AGTCATGTGAAACTGCTGCCTGG + Intergenic
905492149 1:38353085-38353107 ACTCATGAGAAACCACCGCCAGG + Intergenic
907219189 1:52893009-52893031 ACTGATGTGCAATTACTGCCAGG - Exonic
907646983 1:56254158-56254180 AGTCATGTGAAACTGCTGCCTGG + Intergenic
908927797 1:69277402-69277424 AATCAAGTCAAACTGCAGCCTGG + Intergenic
909440475 1:75690521-75690543 AGTCATGTGAAACTCCTGCTTGG - Intergenic
910253625 1:85223791-85223813 AGTCATGTGAAACTGCTGCCTGG + Intergenic
910942490 1:92551896-92551918 AATCATGAGAAACCACTTCAAGG - Intronic
916461667 1:165031086-165031108 AATTATATCAAACTGCTGCCTGG - Intergenic
919640888 1:200042493-200042515 AATCAGAGGAAACTTCTGCCCGG + Intronic
921546958 1:216484465-216484487 AGTCATGTGCAACTGCTACCTGG - Intergenic
923206739 1:231766327-231766349 AATCAAGTGAAAATTCTGCCAGG + Intronic
924904492 1:248437408-248437430 CTTCATGTGAAAATACTGCTGGG + Intergenic
924923395 1:248654642-248654664 CTTCATGTGAAAATACTGCTGGG - Intergenic
1063982353 10:11464330-11464352 AATGATGTGACACTAATGGCTGG + Intronic
1065073250 10:22049695-22049717 TATCATCTGAAAATAGTGCCTGG - Intergenic
1065442073 10:25763060-25763082 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1068846553 10:61682864-61682886 ATTCATGTGAAACTAACTCCTGG - Intronic
1071218389 10:83433865-83433887 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1073206224 10:101770811-101770833 AACCATGTGTCACTGCTGCCTGG - Intronic
1073986485 10:109215514-109215536 AGTGATGTGGAACTGCTGCCTGG + Intergenic
1074164173 10:110860043-110860065 AGTCATGTGACACCATTGCCTGG - Intergenic
1075968500 10:126633131-126633153 AATCATGTGATAAAACTGCCTGG + Intronic
1079631405 11:22681528-22681550 AATCATGTTAAAGTCCTGACCGG - Intronic
1079914635 11:26353408-26353430 AGTCATGTGGAACTGCTGCCTGG + Intronic
1080722083 11:34859647-34859669 AATGTTGTGAAACTCCTGTCTGG + Intronic
1083746248 11:64738375-64738397 AACACTGTGTAACTACTGCCCGG - Intronic
1084304856 11:68275485-68275507 AGTTATGTAAAACTGCTGCCTGG - Intergenic
1085335430 11:75690184-75690206 AGTCATGTAAAACTGCTGCCTGG - Intergenic
1085495311 11:76963666-76963688 AGTCATGTGAAATTGCTGCCTGG + Intronic
1086009135 11:82077495-82077517 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1088396832 11:109378383-109378405 ATTTATGAAAAACTACTGCCTGG + Intergenic
1088967511 11:114738531-114738553 AATTATGTGAAACTCAGGCCTGG + Intergenic
1091272038 11:134322555-134322577 AATCAGGAGTAACTACTGACAGG - Intergenic
1091472080 12:737683-737705 ATTCATGTGCAAATACAGCCTGG + Intergenic
1093199136 12:16166007-16166029 ATACATGAGAAACTACTTCCTGG + Intergenic
1093745623 12:22737618-22737640 ATCCATGTGAAGCTACTCCCTGG - Intergenic
1094568217 12:31618903-31618925 AGGCATGTGAAACTGCTGCCTGG + Intergenic
1095460945 12:42443780-42443802 AATCTTGAGAAACTGCTGCGGGG - Intronic
1095746665 12:45666933-45666955 GCTCATGTGAAACTACTGCCTGG + Intergenic
1099946256 12:89248049-89248071 AATCATGTGATACTACTTCTTGG - Intergenic
1100363617 12:93899601-93899623 AGGCATGTGAAAATACTGCCTGG - Intergenic
1100758419 12:97777780-97777802 AGTCATGTGAAACTGCTGTCTGG + Intergenic
1101674416 12:106904565-106904587 GATCATGTGAACCTTTTGCCAGG - Intergenic
1102091841 12:110196920-110196942 AGTCATGAGCAACTGCTGCCTGG - Intronic
1102788831 12:115626565-115626587 AAACATATGAAACTAATTCCAGG - Intergenic
1103093817 12:118117195-118117217 AGTCATGTGAAACTGCCACCTGG - Intronic
1105585520 13:21739330-21739352 AATCATGGCAAACTGCTACCTGG + Intergenic
1106971239 13:35144548-35144570 AGTCATGCGAAACTGCTGCCTGG + Intronic
1107290354 13:38845445-38845467 AATCTTGTAAAACTAGAGCCAGG + Intronic
1108464402 13:50700439-50700461 AATCAAGTGAGACTACTGCCAGG + Intronic
1109063571 13:57653027-57653049 AACCTCTTGAAACTACTGCCAGG - Intronic
1109153547 13:58874690-58874712 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1109210824 13:59534149-59534171 TATCATGTCAGACTACTGCAAGG + Intergenic
1109897389 13:68711499-68711521 AATTATGAGAAATTACTCCCGGG - Intergenic
1111279983 13:86009945-86009967 AGTCATGTGAAACTACTGCCTGG - Intergenic
1111825582 13:93263298-93263320 AGTCATGTGAAATTGCTGCTTGG + Intronic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1112347666 13:98604186-98604208 AGGCATGTGACACTACTGCCTGG + Intergenic
1115273267 14:31577978-31578000 AATCATCTGCCACTATTGCCTGG + Intronic
1119394916 14:74319174-74319196 AGGCATGTGCCACTACTGCCTGG + Intronic
1120203085 14:81559715-81559737 AAACATGAGAAACCGCTGCCAGG + Intergenic
1121992523 14:98573599-98573621 CATAATGGGAAACTACTGCCTGG + Intergenic
1123694548 15:22868818-22868840 AATAATGTAAAATGACTGCCAGG + Exonic
1124180506 15:27468587-27468609 CATGATGTGAAACTACTGCCTGG + Intronic
1125972926 15:43926758-43926780 AGTCATGTGAAACTGCTGTCTGG - Intronic
1126844591 15:52746951-52746973 AGCCATGCGAAACTACTGCCTGG + Intergenic
1128902615 15:71438341-71438363 AAAAATGTGAAACTTCTGCATGG - Intronic
1129389406 15:75213159-75213181 AATCATTTGACACTACTACAGGG + Intergenic
1133361444 16:5177064-5177086 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1134219322 16:12341170-12341192 ACTCATTAGAAAGTACTGCCTGG + Intronic
1134324600 16:13195654-13195676 ATTGATGTTAAACTATTGCCTGG - Intronic
1134379581 16:13711501-13711523 AGACATGTGAAACTGCTGTCTGG + Intergenic
1134889860 16:17830853-17830875 AAGCATGTGAAACTAATTCTCGG - Intergenic
1134896792 16:17895352-17895374 AAAAATGCTAAACTACTGCCAGG - Intergenic
1135601574 16:23788265-23788287 AGCCATGTGAAAGTGCTGCCTGG + Intergenic
1135780441 16:25295235-25295257 AATCATGTCTCACTACAGCCTGG - Intergenic
1135889677 16:26345959-26345981 ACTCATGTGTGACTAGTGCCTGG + Intergenic
1136187804 16:28598255-28598277 GGTCATGTGAAACTGCTGCCTGG - Intergenic
1136190277 16:28611249-28611271 CCTCATGTGAAACTGCTGCCTGG - Intronic
1137035492 16:35566158-35566180 AGTAATGTGAAACTCCTTCCTGG - Intergenic
1141397608 16:83718789-83718811 AATCATGTGAAACTACTGCCTGG + Intronic
1143181016 17:4984243-4984265 AAGAATCTGAAACTCCTGCCAGG - Intronic
1143535116 17:7533856-7533878 AGTCATGTGAAAATGCTGCCTGG - Intergenic
1144793985 17:17878684-17878706 TATCATGAGAAACTCATGCCAGG + Intronic
1145853873 17:28133494-28133516 AATAATGTTAAAATAATGCCTGG + Intronic
1146651693 17:34611070-34611092 AGTCATGTGAAACTGCTGCCTGG + Intronic
1150610221 17:66727616-66727638 AGTCCCGTGAAACTGCTGCCTGG + Intronic
1203164385 17_GL000205v2_random:80390-80412 GATGATGTGAATCTTCTGCCTGG - Intergenic
1153060295 18:987849-987871 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1153439526 18:5101232-5101254 AGTCATATGAAACTACTGCCTGG + Intergenic
1155584492 18:27349321-27349343 AGTAATGTGAAAATGCTGCCTGG - Intergenic
1158746919 18:60211302-60211324 AATCCTGTAAAAATACTGCCTGG - Intergenic
1159276018 18:66222568-66222590 AGTCATGTGAAACTGCTGCTTGG - Intergenic
1164201635 19:23023998-23024020 AATGATGTGACTCTCCTGCCTGG - Intergenic
1164206932 19:23067012-23067034 GATGATGTGACACTGCTGCCTGG - Intergenic
1165143607 19:33717801-33717823 TGTCATATGAAACTACTGCCTGG + Intronic
1167334895 19:48878851-48878873 GGTCTTGTGAAACTGCTGCCTGG + Intergenic
1167585577 19:50373293-50373315 AGTCATGTGAAACTGCTGCCTGG + Intronic
1167870637 19:52367265-52367287 AGGCATGTGCCACTACTGCCCGG + Intronic
1168529753 19:57118447-57118469 AGTCATGTGAAACTGTTGCCTGG - Intergenic
926473712 2:13294490-13294512 AATAATGTTATACTACTTCCAGG - Intergenic
928939969 2:36717722-36717744 AGCATTGTGAAACTACTGCCAGG + Intronic
930258508 2:49118538-49118560 GGTCATTTGAAACTGCTGCCTGG - Intronic
930769619 2:55118480-55118502 TATCATGTGAAACTTCTTCCTGG - Intergenic
932076082 2:68664126-68664148 AGTCATGTGAAACTGCTGCCTGG + Intergenic
933521612 2:83381331-83381353 AATCCTGTGAAAGCACTGCAGGG + Intergenic
934519268 2:95009608-95009630 AATTATGTGAACACACTGCCAGG - Intergenic
937281771 2:120722296-120722318 AGTCAGGTGACACTCCTGCCTGG + Intergenic
937577677 2:123443877-123443899 AGTAATGTGAAACTACTGTCTGG + Intergenic
938801810 2:134770776-134770798 TGTCATGTGAAACTGCTGCCTGG - Intergenic
942773461 2:179551347-179551369 AAACATGTGAAACTGCTGTCTGG - Intronic
943620572 2:190143201-190143223 AGTCATGTGTAACTGCTGCCTGG + Intronic
943745240 2:191455365-191455387 AATCATGTGATACAATTACCAGG - Intergenic
944005641 2:194902036-194902058 AATCATGGATAACTAATGCCTGG - Intergenic
944512491 2:200478264-200478286 AATAATGAGTAAATACTGCCTGG - Exonic
945735800 2:213598782-213598804 TGTCATGTGAAACTGCTGCCTGG - Intronic
946536548 2:220636056-220636078 TACCATGTGACACTACTTCCAGG + Intergenic
946948779 2:224849900-224849922 AGGCATGTGAAACCTCTGCCTGG - Intronic
1169121046 20:3095743-3095765 AGGCATGTGCCACTACTGCCCGG + Intergenic
1170310839 20:14989867-14989889 AGTCATGTGAAACTGCTGCCTGG + Intronic
1170522940 20:17207075-17207097 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1171086886 20:22245803-22245825 AATCATGTGGAAATACTGGATGG + Intergenic
1171234342 20:23512237-23512259 ACTCAGGTGAAAATGCTGCCTGG + Intergenic
1171237206 20:23536657-23536679 AGTCATGCAAAACTGCTGCCTGG + Intergenic
1172200120 20:33119820-33119842 AGTCATGTGAAACTGCTGCCTGG + Intergenic
1172914126 20:38431098-38431120 AGTCATGTGACACTCCTGCAGGG + Intergenic
1173857190 20:46258067-46258089 AATCATGTGATCCTACTGATAGG + Intronic
1174114827 20:48219692-48219714 AATCATGTGATCCTCCTGCTCGG - Intergenic
1175490752 20:59379793-59379815 AATCATGGGAAACTATGTCCTGG - Intergenic
1175609671 20:60340179-60340201 AATCATGCGACACTGCTGCCTGG + Intergenic
1177449076 21:21241635-21241657 ATTCATGTGAAGGAACTGCCAGG + Intronic
1177929892 21:27267668-27267690 AGTCGTGTGAAATTGCTGCCTGG + Intergenic
1181912137 22:26247101-26247123 CATGATGTGAAATGACTGCCTGG + Intronic
1182385593 22:29937947-29937969 AGTCATGTAAAATTGCTGCCTGG - Intronic
1183172359 22:36197746-36197768 CATTATGTGAACCTGCTGCCTGG - Intronic
1183180904 22:36259015-36259037 TGTCATGTGAACCTGCTGCCTGG + Intronic
950244351 3:11402097-11402119 AGTCATGTGAAACTGCTGCCTGG - Intronic
950346640 3:12301055-12301077 AATGATATGAAACTAATGCCAGG + Intronic
952598549 3:35049450-35049472 AACCATTTGAAACTAATGACAGG + Intergenic
953474748 3:43195692-43195714 AATCATGTCAAACAATTCCCAGG + Intergenic
954777338 3:53031837-53031859 AAACCTGTGAACCTACTCCCAGG - Intronic
954893664 3:53956766-53956788 AACCATGTGCAAATGCTGCCTGG - Intergenic
956090280 3:65659277-65659299 AGTTATGTGAAATTACTCCCTGG - Intronic
957735733 3:84200093-84200115 AATCAAGTGAAATTAGTCCCAGG + Intergenic
958525927 3:95258932-95258954 AGTCATGTGAAATTGCTGCCTGG + Intergenic
958944501 3:100348488-100348510 AGTCATATGAAACTGCTGCCTGG + Intronic
959992636 3:112645653-112645675 AGTCATGTGAAACTGCTGCTTGG + Intronic
961243506 3:125432391-125432413 AGTCATGTGAAATTGCTGCCTGG - Intergenic
963385656 3:144589926-144589948 AATCATCTTAAAAAACTGCCAGG - Intergenic
963555608 3:146783442-146783464 AGTCATGTGAAACTGCTGCCTGG + Intergenic
964357456 3:155863693-155863715 AGTTACGTGAAACTGCTGCCTGG + Intergenic
965592410 3:170374513-170374535 AATTATGAGTATCTACTGCCTGG - Intronic
970468379 4:16350599-16350621 AATAATGTTAACATACTGCCTGG + Intergenic
970729442 4:19085886-19085908 AATTCTGTGAAAATGCTGCCTGG + Intergenic
971421401 4:26476988-26477010 AGTCATGGGAAACTGCTGCCTGG - Intergenic
972956192 4:44395288-44395310 AATCATGTGAAACTGCTTCCTGG - Intronic
975433583 4:74323788-74323810 AGTTATGTAAAACTGCTGCCTGG - Intergenic
975851166 4:78574001-78574023 AGTCATGTGAAACTGCTGCCTGG + Intronic
976928364 4:90530835-90530857 AGTCACATGAAACTGCTGCCTGG + Intronic
977357538 4:95966511-95966533 AGTCATGTGAAACTGCTCCCTGG - Intergenic
981912398 4:149996733-149996755 AGTCATGTGCCACTACCGCCTGG - Intergenic
982201961 4:152970366-152970388 AATCATGTAGAACTCCTGCCCGG + Intronic
982512190 4:156297078-156297100 AGTCATGTGAACCTGTTGCCTGG - Intergenic
982590768 4:157306865-157306887 AATCATGTGACACTAAAGCAAGG - Intronic
982665066 4:158251474-158251496 AGTCATGTGAAACTGCTGCCTGG - Intronic
983482695 4:168294642-168294664 AGGCATGTGCCACTACTGCCAGG + Intronic
983866130 4:172768853-172768875 AGACATGTGAAACTGCTGCTTGG + Intronic
984268201 4:177519686-177519708 AATCATATGAAACTGCTGCCTGG - Intergenic
984314428 4:178108935-178108957 AATCGTGTGTCACTGCTGCCAGG + Intergenic
984715464 4:182920460-182920482 TATCCTGTCAAACTACTTCCAGG + Intergenic
985413427 4:189711081-189711103 TATCTAGTGAAACTACTGCTAGG - Intergenic
988585388 5:32503500-32503522 AGTCCTGTGAAACTGCTGTCTGG - Intergenic
988803145 5:34715468-34715490 AGTCATGTGAAACTCCTGCCTGG + Intronic
988909311 5:35823780-35823802 AAGCATGCGCCACTACTGCCCGG - Intergenic
992744137 5:79802721-79802743 AACCATGTGAAAATAGTGCTGGG - Intergenic
994916675 5:105989700-105989722 AAGCATGTGAAACTATTGGTGGG + Intergenic
995048852 5:107679378-107679400 AATCATCTTAAAGTACTACCTGG + Intergenic
995130312 5:108623137-108623159 AGTCATGTGAAACTGCTGCCCGG + Intergenic
996280056 5:121719530-121719552 AATCATGTGAAACTACTGCCTGG - Intergenic
996502128 5:124229425-124229447 AGTCATATGAAATTTCTGCCTGG - Intergenic
998941388 5:147286540-147286562 AGTCATGTGAAACTGCTGTCTGG + Intronic
999808865 5:155109123-155109145 AATCATGGGAAAATAATTCCAGG - Intergenic
1000352388 5:160362126-160362148 AATCATGTCAAATTGCTGCCTGG - Intronic
1000871524 5:166583016-166583038 AGGCATGTGAAACTGCTGCCTGG + Intergenic
1005357553 6:24999134-24999156 AGTTATGTGAAACTGCTGCCTGG - Intronic
1005651403 6:27888532-27888554 AGTCATGTGAAACTACTGCATGG + Intergenic
1006962266 6:37945238-37945260 AGTCATGTGAAACTGCTGCCTGG + Intronic
1008458037 6:51734735-51734757 AATCAAGTGAAACTTCTGTTTGG - Intronic
1009331997 6:62434860-62434882 AATCTTGGGAAACTGCTTCCAGG - Intergenic
1009967248 6:70590649-70590671 AATCATGTAAAACTGCTGCCTGG + Intergenic
1010136542 6:72560968-72560990 AGTCATGTGCAATTGCTGCCTGG - Intergenic
1012147701 6:95707194-95707216 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1013144318 6:107372745-107372767 AATTATGTGATACTAGGGCCGGG - Intronic
1014382301 6:120757727-120757749 AATCAGATGAAACTACTGTCTGG - Intergenic
1014498923 6:122162643-122162665 AATCATGTGACACTCATACCAGG + Intergenic
1015504231 6:133964931-133964953 AATCAAGAGAAAGTACTGCATGG - Intronic
1018281103 6:162186657-162186679 ACTCATGAGAAACTGCTCCCAGG - Intronic
1018325171 6:162659971-162659993 AACCCTGTGAAACTTATGCCAGG + Intronic
1019696806 7:2450831-2450853 AATCATGGGAAACTCCCGTCAGG + Intergenic
1020270446 7:6591681-6591703 AATCATGTGCAATTATTTCCAGG + Exonic
1020426573 7:8073073-8073095 AATCATGTCACTCTCCTGCCAGG + Intronic
1021069144 7:16215552-16215574 AATCATTTGAAAGCACTGCCTGG - Intronic
1022552488 7:31254500-31254522 AGTCGTGTGAAACTGCCGCCTGG - Intergenic
1023731484 7:43196097-43196119 AGTCATGTGAAACTGCCGCCTGG + Intronic
1025033550 7:55576135-55576157 AGTCATGTGAAACTGCTCCCTGG + Intergenic
1025058392 7:55783842-55783864 AATAATGTGCAACTCCAGCCTGG - Intergenic
1025156948 7:56615501-56615523 AATAATGTGACTCTTCTGCCTGG - Intergenic
1025722484 7:64029010-64029032 AATAATGTGAAACTCCTTCCTGG - Intergenic
1025744002 7:64226900-64226922 AGTAATGTGAAACTCCTTCCTGG - Intronic
1025751592 7:64298562-64298584 AATGATGTGACTCTTCTGCCTGG - Intergenic
1027290883 7:76709156-76709178 AATCATGTGTTACTACTGTAGGG - Intergenic
1027303257 7:76864005-76864027 AATACTGTGAAAATACTCCCAGG + Intergenic
1027798073 7:82718694-82718716 AATCATTTGAATTTACTGACTGG + Intergenic
1027951664 7:84824207-84824229 AGTCATGTGAAATTGCTACCCGG - Intergenic
1031389572 7:121197306-121197328 GATCACATGAAAGTACTGCCAGG + Intronic
1032292293 7:130599237-130599259 AGTCATGTGAAACTGCTGCCTGG - Intronic
1034290001 7:149922694-149922716 ATTCATGTAACACTACTTCCTGG - Intergenic
1034527050 7:151671689-151671711 AATCAGGTTAACCTGCTGCCAGG + Intronic
1034661061 7:152770143-152770165 ATTCATGTAACACTACTTCCTGG + Intronic
1036295253 8:7529494-7529516 AATCAAGTGCAACAAATGCCTGG + Intergenic
1036327317 8:7791524-7791546 AATCAAGTGCAACAAATGCCTGG - Intergenic
1036454400 8:8894151-8894173 AGTCAAGTGAAACTGCTGCCTGG - Intergenic
1036508839 8:9381902-9381924 AGTCATGTAAAACTGTTGCCTGG + Intergenic
1037554883 8:20012707-20012729 AGTCATGTGGAACTGCTGCCTGG - Intergenic
1038279769 8:26153347-26153369 AGTCATGTGAAACTGCTATCTGG + Intergenic
1038472915 8:27840026-27840048 ACTCATGGGAAACTGCTGTCTGG + Intergenic
1039180865 8:34864492-34864514 AATCATGTAAAACTGTTGCCTGG + Intergenic
1040358931 8:46646351-46646373 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040371237 8:46778027-46778049 AGTGATGTGACACTTCTGCCAGG + Intergenic
1040371641 8:46781445-46781467 AATAATGTGACACTTCTGCCTGG + Intergenic
1040377355 8:46839306-46839328 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040378826 8:46852488-46852510 AATAATGTGACACTTCTGCCTGG + Intergenic
1040379566 8:46859194-46859216 AATAATGTGACTCTTCTGCCTGG + Intergenic
1040382244 8:46884206-46884228 AATAATGTGACTCTTCTGCCTGG - Intergenic
1041469479 8:58192897-58192919 AGTCATGTGGAACTGCTGCCTGG - Intronic
1041787686 8:61653465-61653487 AATGATGTGAAACAAATTCCAGG + Intronic
1043271651 8:78341396-78341418 TGTCATGTAAAACTACTGCCTGG - Intergenic
1043360753 8:79469185-79469207 AGTCACATGAAACTGCTGCCTGG + Intergenic
1044300732 8:90580293-90580315 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1045588560 8:103566279-103566301 AGTCATGTGAAACTGTTGCCTGG + Intronic
1048104572 8:131393736-131393758 AGTCATGTGAGACTGCGGCCTGG - Intergenic
1050163655 9:2742820-2742842 GGTCATGTGAAACTGCTGCCTGG + Intronic
1050375349 9:4966768-4966790 AGGCATGTGCCACTACTGCCCGG + Intergenic
1052496293 9:29229903-29229925 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1055181540 9:73393729-73393751 AGTCATGTGAAACTGCTGCCTGG - Intergenic
1055576346 9:77663281-77663303 TATTAAGTGTAACTACTGCCTGG - Intergenic
1056334979 9:85559554-85559576 GGTCATGTGAAACTGCTGCCTGG - Intronic
1056619165 9:88196145-88196167 AGCCATGTGAAACCACTGCCTGG - Intergenic
1056625976 9:88253642-88253664 AGTCATGTGAAACTTCTGCCTGG - Intergenic
1059314652 9:113413715-113413737 AAACATGTTAACCTGCTGCCTGG - Intronic
1060142132 9:121219479-121219501 AGTCATATAAAACTGCTGCCTGG - Intronic
1060689289 9:125642374-125642396 AGTCATGTGAAACTGCTGCCTGG - Intronic
1186967036 X:14798854-14798876 TGTCATGTGAAACTGCTGCCTGG - Intergenic
1187240479 X:17508612-17508634 AGGCATGTGCCACTACTGCCCGG + Intronic
1187654964 X:21461644-21461666 CAACCTATGAAACTACTGCCAGG - Intronic
1190804216 X:53819629-53819651 ATTCATGTGAAACCGCTGCCTGG + Intergenic
1191837171 X:65476808-65476830 AGTCATGTGAAACTGCTGACTGG + Intronic
1197220647 X:123910431-123910453 TATCATGTGAAACTAATGCTGGG - Exonic
1197294940 X:124707431-124707453 AATCATGTGAAACTGCTGCCTGG - Intronic
1200844895 Y:7821915-7821937 AGTGATGTGACACTTCTGCCTGG - Intergenic
1200867737 Y:8063154-8063176 AATAATGTGACTCTTCTGCCTGG + Intergenic
1200868598 Y:8073304-8073326 AATAATGTGACTCTGCTGCCTGG - Intergenic
1200894542 Y:8360848-8360870 AATGATGTGACTCTTCTGCCTGG - Intergenic
1200896801 Y:8384442-8384464 GATTATGTGACACTTCTGCCAGG - Intergenic
1202263114 Y:22990468-22990490 AATAATGTGAAACTTCTTCTTGG + Intronic
1202416104 Y:24624209-24624231 AATAATGTGAAACTTCTTCTTGG + Intronic
1202454683 Y:25045877-25045899 AATAATGTGAAACTTCTTCTTGG - Intronic